products - Integrated DNA Technologies
products - Integrated DNA Technologies
products - Integrated DNA Technologies
Create successful ePaper yourself
Turn your PDF publications into a flip-book with our unique Google optimized e-Paper software.
INTEGRATED<strong>DNA</strong>TECHNOLOGIESPRODUCTSFUNCTIONAL GENOMICSmiRCat TM Small RNA Cloning KitmiRCat small RNA cloning is based on the pre-activated, adenylated RNA linkering method that has been used successfullyin many labs since its development in 2001 1 . The kit includes the 5’ M.R.S. Linker and Linker-1 along with PCR and reversetranscription primers and necessary buffers and reagents to permit cloning of small RNAs from any cell or tissue source in anyspecies. Material sufficient for ten cloning experiments is provided in the miRCat kit.Kit Contents:• 3’ Linker-1 Pre-Activated, Adenylated Cloning Linker• 5’ M.R.S. Cloning Linker• miSPIKE 21-mer Internal RNA Control• Forward and Reverse/RT primers• T4 RNA Ligase• Ligation Buffer w/o ATP• Ligation Enhancer• 10 mM ATP• T4 <strong>DNA</strong> Ligase• 3M NaOAc (pH 5.2)• 10 mg/mL Glycogen• IDTE (pH 7.5)• Nuclease-free Water• Technical ManualmiRCat-33 TM Conversion Oligo PackmiRCat-33 is a conversion of the miRCat kit for the purpose of performing 5’ ligation-independent small RNA cloning using themethod of Pak and Fire 2 .Includes:• miRCat-33 3’ pre-activated, adenylated cloning linkerSequence- 5’- rAppTGGAATTCTCGGGTGCCAAGG/ddC/ -3’• miRCat-33 PCR PrimerSequence- 5’- CCTTGGCACCCGAGAATT -3’ProductmiRCat-33 Conversion Oligo Pack - 1 nmole or 5 nmolesReferences:1. Lau NC, Lim LP, Weinstein EG, and Bartel DP 2001 An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans. Science294:858-862.2. Pak J and Fire A 2007 Distinct populations of primary and secondary effectors during RNAi in C. elegans. Science 315: 241-244.©2008 <strong>Integrated</strong> <strong>DNA</strong> <strong>Technologies</strong> www.idtdna.com27