Lentiviral Vectors: design, production, and titration

More documents

Recommendations

Info

FXYD1 EGFP CMV IRES CMV polybrene LV FIG LV GIF 1:10 1:20 1:30 1:10 1:20 1:30 EGFP IRES LV FIG (1:30) LV GIF (1:30) FXYD1 GAPDH (36kDa) eGFP (27kDa) FXYD (14kDa) Infection of Hib5 (6 Well plate, 200,000 cells/well)
<strong>Lentiviral</strong> Vector System: Gene Suppression pPRIME Potent RNA Interference using MicroRNA Expression pPRIME-CMV-GFP miR30-shRNA CMV RRE GFP 5’miR30 CM R WRE Pol II driven shRNA was more active than the Pol III construct cPPT Xho I EcoRI pPRIME- TET-GFP CMV-dsRED CMV-Neo T-REX-GFP miR30= Retinoblastoma (Rb) Targeting sequence: AGCAGTTCGATATCTACTGAAA DU3 R U5 CMV 3’miR30 ∆U3 R U5 Stegmeier, 2005
Page 1 and 2: Lentiviral Vectors: design, product
Page 3 and 4: Lentiviral Vector System 2. Modific
Page 5 and 6: HIV provirus LTR ψ SD Gag Pro 2 nd
Page 7 and 8: Packaging plasmids 4 th generation?
Page 9 and 10: Lentiviral Vector Systems 5’LTR
Page 11 and 12: Lentiviral Vector System (3 rd gene
Page 13 and 14: Lentiviral Vector System (3 rd gene
Page 15: 1 2 3 4 5 DU3 R U5 DU3 R U5 DU3 R U
Page 19 and 20: Lentiviral Vector System: Gene Supp
Page 21 and 22: Lentiviral Vector System Transgene
Page 23 and 24: Control HEPES - Transfection BES -
Page 25 and 26: Titer Analysis Possibilities: Virus
Page 28 and 29: % fluorescence 70 60 50 40 30 20 10
Page 30 and 31: Replication Competent Lentivirus (R

Lentiviral Vectors: design, production, and titration

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?