Klinische (bio)chemie en methodologie - NVKC
Klinische (bio)chemie en methodologie - NVKC
Klinische (bio)chemie en methodologie - NVKC
Transform your PDFs into Flipbooks and boost your revenue!
Leverage SEO-optimized Flipbooks, powerful backlinks, and multimedia content to professionally showcase your products and significantly increase your reach.
Ned Tijdschr Klin Chem 1998; 23: 62-102<br />
Lipid<strong>en</strong><br />
Posterabstracts<br />
Sam<strong>en</strong>vatting<strong>en</strong> van de posterpres<strong>en</strong>taties tijd<strong>en</strong>s het 51e Congres van de Nederlandse Ver<strong>en</strong>iging voor<br />
<strong>Klinische</strong> Chemie 8 <strong>en</strong> 9 april 1998 te Lunter<strong>en</strong><br />
De bepaling van vet in faeces wordt tot nu toe binn<strong>en</strong> onze<br />
laboratoria uitgevoerd volg<strong>en</strong>s de 'van de Kamermethode'.<br />
Deze methode is zeer bewerkelijk, tijdrov<strong>en</strong>d <strong>en</strong> e<strong>en</strong> kwaliteitscontrole<br />
ontbreekt. In sam<strong>en</strong>werking met twee andere<br />
academische c<strong>en</strong>tra (Groning<strong>en</strong> <strong>en</strong> Utrecht) hebb<strong>en</strong> we e<strong>en</strong><br />
nieuwe vet in faecesbepaling ontwikkeld die gebruik maakt<br />
van mid-infraroodspectroscopie. Deze techniek wordt binn<strong>en</strong><br />
de klinische <strong>chemie</strong> al gebruikt voor de nierste<strong>en</strong>analyse.<br />
Na e<strong>en</strong> korte <strong>en</strong> e<strong>en</strong>voudige voorbewerking van de faecesmonsters,<br />
waarbij de vetzur<strong>en</strong> geïsoleerd word<strong>en</strong> uit de<br />
faeces m.b.v. e<strong>en</strong> aangezuurd m<strong>en</strong>gsel van petroleumether<br />
<strong>en</strong> ethanol, werd e<strong>en</strong> transmissiespectrum opg<strong>en</strong>om<strong>en</strong> in het<br />
<strong>Klinische</strong> (<strong>bio</strong>)<strong>chemie</strong> <strong>en</strong> <strong>methodologie</strong><br />
1. Bepaling van vet in faeces met behulp van mid-infraroodspectroscopie<br />
B.S. JAKOBS 1 , D.W. SWINKELS 1 , M. VOLMER 2 , B.G. WOLTHERS 2 , M.J. van LOON 3 <strong>en</strong> H.A.M. VOORBIJ 3<br />
CKCL, AZ Nijmeg<strong>en</strong>, St. Radboud 1 , CKCL, AZ Groning<strong>en</strong> 2 <strong>en</strong> ASL, AZ Utrecht 3<br />
2. γ-Linol<strong>en</strong>ic acid does not augm<strong>en</strong>t long chain polyunsaturated fatty acid ω-3 status<br />
Long chain polyunsaturated fatty acids of the ω3 and ω6 series<br />
(LCPUFAω3, LCPUFAω6; chain l<strong>en</strong>gth (20) are structural<br />
compon<strong>en</strong>ts of membrane phospholipids and precursors of<br />
eicosanoids. LCPUFA are synthesized from the ess<strong>en</strong>tial fatty<br />
acids linoleic (LA; 18:2ω6) and α-linol<strong>en</strong>ic (ALA; 18:3ω3)<br />
acids by alternating chain elongation and desaturation. The<br />
initial, and rate limiting, step in LCPUFA synthesis is by ∆-6<br />
desaturation. LA and ALA compete for conversion by ∆-6<br />
desaturase. Important metabolites of LA are γ-linol<strong>en</strong>ic (GLA;<br />
18:3ω6), dihomo-γ-linol<strong>en</strong>ic (20:3ω6) and arachidonic (20:4ω6)<br />
acids, whereas those of ALA are eicosap<strong>en</strong>ta<strong>en</strong>oic (EPA;<br />
20:5ω3) and docosahexa<strong>en</strong>oic (DHA; 22:6ω3) acids. Augm<strong>en</strong>tation<br />
of LCPUFAω3 status decreases the risk for coronary<br />
artery disease. It can be reached by consumption of<br />
LCPUFAω3-rich fish oils or improvem<strong>en</strong>t of the conversion<br />
of ALA to LCPUFAω3. Since it has be<strong>en</strong> suggested that GLA<br />
activates ∆-6 desaturase, we investigated whether GLA augm<strong>en</strong>ts<br />
LCPUFAω3 status. Sev<strong>en</strong> appar<strong>en</strong>tly healthy adults<br />
(23-47 years; female/male=3/4) received a daily oral dose of 4<br />
g linseed oil (2.2 g ALA) for 4 weeks, and subsequ<strong>en</strong>tly a<br />
combination of 4 g linseed oil and 6 g borage oil (2.2 g<br />
mid-infraroodgebied (400 - 4000 cm -1 ). Met behulp van<br />
'Partial Least Square' <strong>en</strong> multicompon<strong>en</strong>tanalyses van de golfl<strong>en</strong>gt<strong>en</strong>,<br />
gemet<strong>en</strong> bij diverse faecesmonsters met e<strong>en</strong> bek<strong>en</strong>de<br />
vetconc<strong>en</strong>tratie, werd e<strong>en</strong> model geg<strong>en</strong>ereerd. Tev<strong>en</strong>s werd<br />
stearinezuur gebruikt als standaard voor de ijklijn. Er bleek<br />
e<strong>en</strong> goede correlatie te zijn tuss<strong>en</strong> de vetconc<strong>en</strong>traties bepaald<br />
met infrarood <strong>en</strong> gemet<strong>en</strong> met de 'van de Kamermethode'<br />
(n=35, r 2 > 0,95). Conclusie: de bepaling van vet in faeces met<br />
behulp van mid-infraroodspectroscopie biedt, in zijn e<strong>en</strong>voud<br />
<strong>en</strong> standaardisatiemogelijkhed<strong>en</strong>, e<strong>en</strong> goed alternatief voor de<br />
conv<strong>en</strong>tionele 'van de Kamermethode'.<br />
D.A.J. BROUWER 1 , Y. HETTEMA 1 , J.J. van DOORMAAL 2 and F.A.J. MUSKIET 1<br />
C<strong>en</strong>tral Laboratory for Clinical Chemistry 1 and Atherosclerosis Lipid Outpati<strong>en</strong>t Clinic 2 , University Hospital Groning<strong>en</strong><br />
ALA+1.5 g GLA) daily for another 4 weeks. A second group<br />
of eight adults (22-49 years; female/male=3/5) received 6 g<br />
borage oil for 4 weeks, and subsequ<strong>en</strong>tly the same combination<br />
during the second 4 weeks. EDTA-blood was collected in<br />
the fasting state at -1, 0, 4 and 8 weeks. Erythrocytes,<br />
platelets, plasma cholesterol esters and plasma triglycerides<br />
were isolated. Their fatty acid compositions were determined<br />
by capillary gas chromatography/flame ionization detection.<br />
ALA and GLA administration augm<strong>en</strong>ted their cont<strong>en</strong>ts in<br />
each of the investigated compartm<strong>en</strong>ts. GLA, either alone or<br />
as GLA+ALA combination, increased 20:3ω6, but did not<br />
change arachidonic acid, 22:4ω6, or 22:5ω6. ALA, either<br />
alone or as ALA+GLA combination, did not significantly augm<strong>en</strong>t<br />
EPA and DHA cont<strong>en</strong>ts. We conclude that the<br />
LCPUFAω3 status can not be improved by supplem<strong>en</strong>tation<br />
with 4 g linseed oil, and that cosupplem<strong>en</strong>tation of 6 g borage<br />
oil does not augm<strong>en</strong>t LCPUFAω3 status either. Poor conversion<br />
of ALA to LCPU-FAω3 may be caused by negative feedback<br />
of the background intake of arachidonic acid from the<br />
carnivorous diet and/or by the remaining high dietary<br />
LA/ALA ratio.<br />
62 Ned Tijdschr Klin Chem 1998, vol. 23, no. 2
3. Analysis of fecal fat with Fourier Transform Infrared spectroscopy with horizontal Att<strong>en</strong>uated Total Reflection<br />
M. VOLMER, I.P. KEMA, A. KINGMA and B.G. WOLTHERS<br />
University Hospital Groning<strong>en</strong>, departm<strong>en</strong>t CKCL, Groning<strong>en</strong>, The Netherlands<br />
Quantitative fecal fat excretion analysis is a test that is frequ<strong>en</strong>tly<br />
used for the detection of steatorrhea in pati<strong>en</strong>ts with<br />
gastrointestinal problems. Traditionally this test is performed<br />
by a titrimetric method described by Van de Kamer et al.<br />
Other analytical techniques like gravimetry and gaschromatography<br />
(GC) are possible. These tests, however, are time<br />
consuming and cumbersome. We are developing a quick and<br />
direct quantitative fecal fat analysis method using Fourier<br />
Transform Infrared (FTIR) Spectroscopy. A small portion of a<br />
homog<strong>en</strong>ized stool is spread on a horizontal Total Att<strong>en</strong>uated<br />
Reflection (h-ATR) assembly that is placed in the FTIR instrum<strong>en</strong>t.<br />
Mid-infrared spectra are recorded from 650-4000 cm -1 .<br />
From 20 stool samples (range: 16-144 g/kg wet weight) the fat<br />
cont<strong>en</strong>ts were analyzed with GC as a secondary refer<strong>en</strong>ce<br />
method. From these 20 samples a FTIR spectrum was<br />
recorded. Partial Leased Squares (PLS) regression was used<br />
4. Effects of malnutrition on erythrocyte fatty acids of Pakistani childr<strong>en</strong><br />
In the Punjab area in Pakistan, 5% of infant mortality is<br />
caused by malnutrition and diarrhea, and only 46% of the childr<strong>en</strong><br />
is, according to WHO standards, adequately nourished.<br />
Lipid metabolism is disturbed in malnutrition. Malnourished<br />
childr<strong>en</strong> may have reduced dietary intake, and poor digestion<br />
and absorption of lipids, which could cause ess<strong>en</strong>tial fatty acid<br />
(EFA) defici<strong>en</strong>cy. In addition, changes in the hepatic chain<br />
elongation and desaturation <strong>en</strong>zyme systems may lead to<br />
shortage of long chain polyunsaturated fatty acids. We investigated<br />
the EFA status of 47 grade 2 and 21 grade 3 malnourished<br />
Pakistani childr<strong>en</strong> (ages 4-56 months). Erythrocyte fatty<br />
acids were determined as their methyl esters by capillary gas<br />
chromatography. Data were compared with those of 26 age<br />
and sex matched appar<strong>en</strong>tly healthy controls and evaluated<br />
Ned Tijdschr Klin Chem 1998, vol. 23, no. 2<br />
for calibration. For this calibration a spectral region from 650-<br />
1800 cm -1 was used. To prev<strong>en</strong>t overoptimistic calibration<br />
results, cross validation was used, taking out every calibration<br />
sample once and predicting this on the remaining 19 calibration<br />
samples. The regression equation of the cross validation<br />
samples had a slope of 1.009 and an intercept of 1.193. The<br />
correlation coeffici<strong>en</strong>t was 0.9556. The root mean square error<br />
of prediction (RMSEP) was 9.989 g/kg. From the results of<br />
these 20 stool samples we conclude that this method gives<br />
very promising results. The FTIR method is very fast and easy<br />
to perform. A maximum error of 20 g/kg (2 * 9.989 RMSEP)<br />
seems to be suffici<strong>en</strong>t for clinical practice. However, a more<br />
ext<strong>en</strong>sive study with more calibration and indep<strong>en</strong>d<strong>en</strong>t validation<br />
samples is needed to implem<strong>en</strong>t such a FTIR method,<br />
instead of the pres<strong>en</strong>tly used Van de Kamer method.<br />
In cooperation with the AZN and AZU.<br />
E.N. SMIT 1 , R.R. BAKKER 1 , J.M. DIJKSTRA 1 , T.A. SCHNATER 1 , F.A.J. MUSKIET 2 and E.R. BOERSMA 1<br />
Departm<strong>en</strong>t of Obstetrics and Gynecology 1 and C<strong>en</strong>tral Laboratory for Clinical Chemistry 2 , University and University Hospital,<br />
Groning<strong>en</strong><br />
with three statistical approaches (i.e. Mann Whitney-U test,<br />
stepwise logistic regression and odds-ratios). Tak<strong>en</strong> together<br />
they revealed that both grade 2 and grade 3 malnourished childr<strong>en</strong><br />
had decreased erythrocyte ω6 fatty acids and to a lesser<br />
ext<strong>en</strong>t decreased ω3 fatty acids. These decreases were comp<strong>en</strong>sated<br />
for by increased ω9 fatty acids. We conclude that<br />
malnourished Pakistani childr<strong>en</strong> have low EFA status, notably<br />
those of the ω6 series. It may be related to low dietary intake<br />
of fats and EFAs. The combination of low erythrocyte 22:6ω3<br />
and a low 22:5ω6/22:4ω6 ratio in grade 2 pati<strong>en</strong>ts suggests<br />
low ∆4-desaturation activity, which may be due to impaired<br />
peroxisomal ß-oxidation, since no changes in parameters of<br />
∆6-desaturation and elongation were found.<br />
5. Apolipoprotein E g<strong>en</strong>otype distribution and its relation with plasma lipid indices in consecutive Trinidadian<br />
newborns of African and Indian desc<strong>en</strong>t<br />
D.A.J. BROUWER 1 , D.D. RAMDATH 2 , H. MULDER 1 , B. FOKKENS 1 , S. RAMSEWAK 3 and F.A.J. MUSKIET 1<br />
C<strong>en</strong>tral Laboratory for Clinical Chemistry, Groning<strong>en</strong> University Hospital 1 ; University of the West Indies, Faculty of Medical Sci<strong>en</strong>ces,<br />
Biochemistry Unit, PreClinical Departm<strong>en</strong>t 2 (Trinidad & Tobago); University of the West Indies, Faculty of Medical Sci<strong>en</strong>ces,<br />
Obstetrics & Gynaecology, Dept of Medical Specialities 3 (Trinidad & Tobago)<br />
Trinidadians of East Indian and African ancestry have differ<strong>en</strong>t<br />
CAD incid<strong>en</strong>ces, which remain largely unexplained. We<br />
therefore determined apolipoprotein-E (apo-E) g<strong>en</strong>otypes, and<br />
umbilical plasma cholesterol, triglycerides, apo-A I, apo-B<br />
and lipoprotein (a) [Lp (a)] in 294 consecutive newborns in<br />
Trinidad. Samples of 234 Curaçao newborns were included to<br />
compare apo-E g<strong>en</strong>otype distributions and plasma lipid<br />
indices. We calculated the apo-B/apo-A I ratio and an adapted<br />
‘lipid tetrad index’ (i.e. cholesterol*triglycerides*Lp (a)/apo-A<br />
I). Apo-E g<strong>en</strong>otype distributions of Trinidadians of African<br />
(allele frequ<strong>en</strong>cies: apo-e2:e3:e4 = 10.4:66.4:23.2 %) and<br />
Indian (e2:e3:e4 = 3.5:83.1:13.4 %) desc<strong>en</strong>t were differ<strong>en</strong>t<br />
(p
6. Erythrocyte fatty acids of malnourished Pakistani childr<strong>en</strong>: Influ<strong>en</strong>ce of breastmilk composition and effect of<br />
fish oil supplem<strong>en</strong>tation<br />
E.N. SMIT 1 , R.R. BAKKER 1 , E. OELEN 1 , E. SEERAT 2 , F.A.J. MUSKIET 3 and E.R. BOERSMA 1<br />
Departm<strong>en</strong>t of Obstetrics and Gynecology 1 , Federal Governm<strong>en</strong>t Services Hospital, Departm<strong>en</strong>t of Pediatrics, Nutrition Rehabilitation<br />
C<strong>en</strong>ter 2 , Islamabad (Pakistan), and C<strong>en</strong>tral Laboratory for Clinical Chemistry, University and University Hospital 3 , Groning<strong>en</strong><br />
We determined fatty acids in mature milk of 10 North Pakistani<br />
mothers of malnourished childr<strong>en</strong>. During nutritional<br />
rehabilitation of the malnourished childr<strong>en</strong> we also investigated<br />
the effect of fish oil (FO) supplem<strong>en</strong>tation on their long<br />
chain polyunsaturated fatty acid-ω3 (LCPUFAω3) status. T<strong>en</strong><br />
childr<strong>en</strong> (ages 8-30 months) received 500 mg FO (305 mg<br />
LCPUFAω3) daily during 9 weeks. Sev<strong>en</strong> FO-unsupplem<strong>en</strong>ted<br />
childr<strong>en</strong> served as controls. Erythrocytes (RBC) were<br />
isolated at baseline and at the study <strong>en</strong>d. Fatty acids were<br />
determined by capillary gas chromatography. The breastmilk<br />
contained low perc<strong>en</strong>tages of α-linol<strong>en</strong>ic acid and LCP-<br />
UFAω3, compared with data of 25 Dutch mothers. FO-supplem<strong>en</strong>tation<br />
of the childr<strong>en</strong> augm<strong>en</strong>ted their RBC LCPUFAω3.<br />
We conclude that the marginal LCPUFAω3 status of the<br />
mother is an important cause of the low neonatal LCPUFAω3<br />
status. FO-supplem<strong>en</strong>tation of the childr<strong>en</strong> may have favourable<br />
effects on their c<strong>en</strong>tral nervous system developm<strong>en</strong>t. In<br />
terms of prev<strong>en</strong>tion, FO-supplem<strong>en</strong>tation of the mother during<br />
both pregnancy and lactation seems, however, a more effici<strong>en</strong>t<br />
approach.<br />
7. Influ<strong>en</strong>ce of the number of kringle IV repeats in apolipoprotein (a) on Lipoprotein (a) quantification by four<br />
commercial available assays<br />
J. PRINS, F.R. LEUS, H.J.M. van RIJN and H.A.M. VOORBIJ<br />
Departm<strong>en</strong>t of Clinical Chemistry, University Hospital Utrecht<br />
Lipoprotein (a) [Lp(a)] levels may vary among individuals<br />
from less than 1 mg/l to over 1000 mg/l and a Lp(a) level in<br />
the upper quartile of the population repres<strong>en</strong>ts an indep<strong>en</strong>d<strong>en</strong>t<br />
risk factor for the developm<strong>en</strong>t of atheroslerosis. In this study<br />
plasma obtained from 201 healthy Caucasian subjects was<br />
used to determine the pathological threshold of four commercially<br />
available assays. In addition the influ<strong>en</strong>ce of the apo(a)<br />
isoform size (determined by SDS-agarose gel electrophoresis)<br />
on the obtained Lp(a) conc<strong>en</strong>tration was considered. The<br />
applied assays were the Apo-Tek (Organon Teknika), Innotest<br />
(Innog<strong>en</strong>etics), Vidas (BioMerieux) and N-Latex (Behring)<br />
Lp(a) assay. The assays differ in method, antibodies used,<br />
degree of automation and suitability for large as well as small<br />
analytical series.<br />
With linear regression analysis satisfactory correlations were<br />
observed (R 0.943 - 0.981; Spearman test) for all assays. However,<br />
the Lp(a) conc<strong>en</strong>trations obtained in the Apo-Tek assay<br />
differ significantly from those obtained in the Innotest and<br />
N-Latex assays (p < 0.001; t-test Bonferroni corrected). This<br />
results in assay dep<strong>en</strong>d<strong>en</strong>t pathological threshold values<br />
ranging from 166 - 241 mg/l. The instruction leaflets of all<br />
four assays suggest a threshold of 300 mg/l. In an earlier study<br />
at our laboratory the Apo-Tek assay demonstrated to detect all<br />
apo(a) isoforms on an equival<strong>en</strong>t molar basis and this assay<br />
was used to evaluate the influ<strong>en</strong>ce of the isoform size in the<br />
other three assays. For the N-Latex assay a significant underestimation<br />
of apo(a) isoforms with up to 22 kringle IV repeats<br />
was observed, while the Vidas assay demonstrated an underestimation<br />
of apo(a) isoforms with 10 kringle IV repeats.<br />
8. High performance gel chromatography (HPGC) for the analysis of lipoprotein associated <strong>en</strong>dotoxin<br />
J.H.M. LEVELS, P.R. ABRAHAM 1 , S.J.H. van DEVENTER 1 and A. van d<strong>en</strong> ENDE<br />
Dept. of Hemostasis, Thrombosis, Atherosclerosis and Inflammation; Dept. Experim<strong>en</strong>tal Internal Medicine 1 , Academic Medical<br />
C<strong>en</strong>ter, Amsterdam, The Netherlands<br />
Endotoxin or lipopolysaccharide (LPS), a major compon<strong>en</strong>t of<br />
the gram-negative bacterial cell wall, is responsible for the<br />
pathophysiological symptoms such as fever, disseminated<br />
intravascular coagulation and cardiovascular shock following<br />
infection. Since <strong>en</strong>dotoxin in the circulation is primarily associated<br />
with all of the lipoprotein (LP) classes: Chylomicrons,<br />
VLDL, LDL and HDL, it has be<strong>en</strong> proposed that this complexation<br />
may be part of a humoral LPS detoxification system.<br />
Despite numerous studies, the mechanism of interaction<br />
betwe<strong>en</strong> <strong>en</strong>dotoxin and LP’s, as well as the <strong>bio</strong>logical role and<br />
consequ<strong>en</strong>ce of this interaction remain poorly understood and<br />
controversial. Previous studies which employed differ<strong>en</strong>tial<br />
c<strong>en</strong>trifugation for the analysis of the distribution of 125 Ilabeled<br />
LPS among LP classes showed that LDL had the<br />
highest appar<strong>en</strong>t capacity for <strong>en</strong>dotoxin. In view of the serious<br />
limitations of this technique for the separation of intact LP’s,<br />
we have re-examined the LP distribution and saturation<br />
kinetics of fluoresc<strong>en</strong>tly labeled LPS with the use of high<br />
performance gel permeation chromatography. BODIPY or<br />
NBD labeled LPS (E. coli 0111:B4 or J5) in the conc<strong>en</strong>tration<br />
range of 5 to 35 mg/ml was added to heparinized or citrated<br />
whole blood from healthy volunteers, incubated for up to 1h at<br />
37°C and the fluoresc<strong>en</strong>ce distribution and conc<strong>en</strong>tration of<br />
the LP classes determined by separation on a Superose 6 HR<br />
10/30 column with on-line fluoresc<strong>en</strong>ce and post-column<br />
cholesterol detection, respectively. Results showed that 52%<br />
of both types of added LPS was associated with HDL, 30%<br />
with LDL, 12% with VLDL and 6% with the plasma protein<br />
fraction. Saturation analysis showed that the binding capacity<br />
of LP’s for 0111:B4 LPS is in excess of 50 mg/ml whole<br />
blood and 200 mg LPS/ml for J5 LPS. A time-course analysis<br />
showed that binding of LPS to LP’s is ess<strong>en</strong>tially complete<br />
within 10 min and that a redistribution of LPS occurs during<br />
the subsequ<strong>en</strong>t 50 min incubation. We conclude that HDL has<br />
the highest binding capacity for <strong>en</strong>dotoxin, the saturation<br />
capacity of LP’s far exceeds the LPS conc<strong>en</strong>trations se<strong>en</strong> in<br />
clinical situations and that binding of LPS to LP’s is a<br />
reversible process.<br />
64 Ned Tijdschr Klin Chem 1998, vol. 23, no. 2
Enzym<strong>en</strong><br />
9. Leukocyturie bij hoge amylase in urine<br />
O. BEKERS 1 , M.H.L. CHRISTIAANS 2 , J.P. van HOOFF 2 <strong>en</strong> M.P. van DIEIJEN-VISSER 1<br />
Klinisch Chemisch Laboratorium 1 <strong>en</strong> Afdeling Nefrologie 2 , Academisch Ziek<strong>en</strong>huis Maastricht<br />
Medio 1997 hebb<strong>en</strong> wij, om het aantal microscopische urinesedim<strong>en</strong>tonderzoeking<strong>en</strong><br />
te verminder<strong>en</strong>, de ‘sedim<strong>en</strong>t-scre<strong>en</strong>ing’<br />
ingevoerd. Dit betek<strong>en</strong>t dat leukocyt<strong>en</strong> <strong>en</strong> erytrocyt<strong>en</strong><br />
uitsluit<strong>en</strong>d met e<strong>en</strong> teststrook <strong>en</strong> niet meer microscopisch<br />
beoordeeld word<strong>en</strong>. Het microscopisch sedim<strong>en</strong>t is alle<strong>en</strong> nog<br />
geïndiceerd bij onderzoek naar aanwezigheid van cilinders,<br />
kristall<strong>en</strong>, epitheelcell<strong>en</strong> of slijmdrad<strong>en</strong>. De scre<strong>en</strong>ing wordt<br />
uitgevoerd op e<strong>en</strong> Clinitek ® Atlas ® (Bayer BV, Mijdrecht,<br />
Nederland) met de Multistix 9 (Bayer BV).<br />
Na de introductie van deze werkwijze viel het de nefrolog<strong>en</strong><br />
van ons ziek<strong>en</strong>huis op dat patiënt<strong>en</strong> die e<strong>en</strong> pancreastransplantatie<br />
hadd<strong>en</strong> ondergaan altijd leukocyturie hadd<strong>en</strong>. Dit was<br />
voor de introductie van de scre<strong>en</strong>ing niet het geval. Er zijn<br />
twee red<strong>en</strong><strong>en</strong> waardoor dit veroorzaakt zou kunn<strong>en</strong> word<strong>en</strong>:<br />
de hoge pH of de hoge amylase in de urine. Experim<strong>en</strong>teel<br />
bleek dat de pH in het gebied van 5 tot 8.5 ge<strong>en</strong> invloed had<br />
op de leukocyt<strong>en</strong> uitslag, echter de leukocyt<strong>en</strong> uitslag werd<br />
hoger bij to<strong>en</strong>em<strong>en</strong>de amylase activiteit. In de tabel staat e<strong>en</strong><br />
voorbeeld vermeld, het betreft hier e<strong>en</strong> urine van e<strong>en</strong> patiënt<br />
met e<strong>en</strong> negatieve leukocyt<strong>en</strong> uitslag waaraan in to<strong>en</strong>em<strong>en</strong>de<br />
mate amylase is gevoegd:<br />
Ned Tijdschr Klin Chem 1998, vol. 23, no. 2<br />
Amylase uitslag leukocyt<strong>en</strong><br />
(U/l) (cell<strong>en</strong>/µl)<br />
0 negatief<br />
1312 negatief<br />
2229 15<br />
5204 70<br />
13317 125<br />
26259 125<br />
Conclusie: De leukocyt<strong>en</strong> in urine word<strong>en</strong> met de Clinitek ®<br />
Atlas ® bepaald met behulp van e<strong>en</strong> teststrip. Het bepalingsprincipe<br />
is gebaseerd op de leukocyt<strong>en</strong>-esterase activiteit. De<br />
constatering dat e<strong>en</strong> hoge amylase activiteit leidt tot e<strong>en</strong> vals<br />
verhoogde leukocyt<strong>en</strong> uitslag doet vermoed<strong>en</strong> dat er mogelijk<br />
kruisreactiviteit optreedt. Mom<strong>en</strong>teel do<strong>en</strong> wij hier nader<br />
onderzoek naar. Het is in ieder geval van belang bij patiënt<strong>en</strong><br />
na e<strong>en</strong> pancreastranplantatie of met e<strong>en</strong> pancreatitis rek<strong>en</strong>ing<br />
te houd<strong>en</strong> met vals verhoogde leucocyt<strong>en</strong> in urine uitslag, er<br />
di<strong>en</strong>t dan in geval van twijfel e<strong>en</strong> microscopisch sedim<strong>en</strong>t te<br />
word<strong>en</strong> verricht.<br />
10. Comparative values of fecal elastase-1 conc<strong>en</strong>trations and urine PABA/PAS ratios for the evaluation of exocrine<br />
pancreatic function<br />
C. POSTMA 1 , D.M. van d<strong>en</strong> BOOMGAARD 2 , J.J. NICOLAI 2 and A.J.P.F. LOMBARTS 1<br />
Departm<strong>en</strong>ts of Clinical Chemistry 1 and Gastro<strong>en</strong>terology 2 , Ley<strong>en</strong>burg Hospital, The Hague, The Netherlands<br />
Pancreatic function tests allow to assess the severity of<br />
exocrine pancreatic malfunction. Direct function tests are<br />
cumbersome, exp<strong>en</strong>sive and rather uncomfortable to the<br />
pati<strong>en</strong>t. The same holds true for the fecal fatty acid test.<br />
The simultaneous oral administration of para-aminosalicylic<br />
acid (PAS) and B<strong>en</strong>tiromide-para-aminob<strong>en</strong>zoic acid (BT-<br />
PABA) to the pati<strong>en</strong>t and subsequ<strong>en</strong>t (HPLC)-assays of PAS<br />
and PABA, allow for appropriate interpretation of the<br />
PABA/PAS ratio as an indication for exocrine (chymotrypsin)<br />
pancreatic function. However, disadvantages to the method are:<br />
1. The administration of BT-PABA is compromised, as it is<br />
no longer an officially registered drug.<br />
2. The procedure and the assay are time-consuming and h<strong>en</strong>ce<br />
exp<strong>en</strong>sive.<br />
Quite rec<strong>en</strong>tly, a relatively inexp<strong>en</strong>sive immunoreactive elastase-1<br />
test in spot stools was recomm<strong>en</strong>ded as a somewhat<br />
less cumbersome, accurate, non-invasive and pati<strong>en</strong>t fri<strong>en</strong>dly<br />
test for exocrine pancreatic function. Moreover, elastase-1 is<br />
11. Multic<strong>en</strong>ter harmonization of common <strong>en</strong>zyme results by fresh pati<strong>en</strong>t-pool sera<br />
A region consisting of 19 clinical laboratories harmonized<br />
their calibration of sev<strong>en</strong> common <strong>en</strong>zymes by using fresh<br />
pati<strong>en</strong>t-pool sera. Before harmonization the interlaboratory<br />
CVs varied from 16.9 % to 61.6 %. After harmonization CVs<br />
decreased to betwe<strong>en</strong> 5.0 % and 9.5 %. These results proved<br />
to be reproducible over a period of more than two years. Using<br />
internationally accepted inaccuracy and imprecision criteria<br />
(EGE-lab), the achieved interlaboratory CVs permit the use of<br />
one set of refer<strong>en</strong>ce ranges by all participating laboratories.<br />
pancreas specific and highly stable along the intestinal tract<br />
and during storage in the laboratory. Furthermore, it is hardly<br />
influ<strong>en</strong>ced by extra pancreatic disorders or therapy with<br />
exog<strong>en</strong>ous <strong>en</strong>zymes.<br />
In this study we compared the diagnostic values of the two<br />
tests for pancreatic function in some 40 pati<strong>en</strong>ts. In g<strong>en</strong>eral,<br />
there is a good agreem<strong>en</strong>t betwe<strong>en</strong> the tests. The discrepancies<br />
will be discussed.<br />
Refer<strong>en</strong>ces<br />
1. Stein J, Jung M, Sziegoleit A, Zeuzem St, Caspary WF, Lembecke<br />
B. Immunoreactive Elastase-1 clinical evaluation of a new noninvasive<br />
test of pancreatic function. Clin Chem 1996; 42: 222-226.<br />
2. Löser C, Möllgaard A, Fölsch UR. Faecal elastase 1; a novel,<br />
highly s<strong>en</strong>sitive, and specific tubeless pancreatic function test. Gut<br />
1996; 39: 580-586.<br />
3. Stein J, Caspary WF. Fecal tests in the Diagnosis of Exocrine Pancreatic<br />
Insuffici<strong>en</strong>cy. Clin Lab 1997; 43: 361-368.<br />
P.F.H. FRANCK 1 , G. STEEN 2 , A.J.P.F. LOMBARTS 1 , J.H.M. SOUVERIJN 3 and R.K.A. van WERMESKERKEN 4<br />
Ley<strong>en</strong>burg Hospital 1 , The Hague, Rijnland Hospital 2 , Leiderdorp, Leid<strong>en</strong> University Hospital 3 Leid<strong>en</strong>, Bronovo Hospital 4 , The Hague<br />
After harmonization the commutability of sera in use for<br />
quality control (CRM, SKZL, Liquid control sera of Bio-Rad<br />
and Ortho) was studied. The Certified Refer<strong>en</strong>ce Materials<br />
(CRM) showed interlaboratory CVs as low as those achieved<br />
with pati<strong>en</strong>t-pool sera. These materials can act as commutable<br />
refer<strong>en</strong>ce preparations, except for creatine kinase. In g<strong>en</strong>eral,<br />
the SKZL (Combi scheme 95.3) and both liquid control sera<br />
studied, are not commutable to pati<strong>en</strong>t sera.<br />
We conclude that the calibration of <strong>en</strong>zymes can be harmo-<br />
65
nized by making use of pati<strong>en</strong>t-pool sera. Ev<strong>en</strong> the analysis of<br />
α-amylase, carried out with a great variety of methods, could<br />
be harmonized. The same holds true for dry chemistry<br />
methodology, which is particularly s<strong>en</strong>sitive to matrix effects.<br />
12. Commercially available <strong>en</strong>zyme calibrators, an overview<br />
The role of <strong>en</strong>zyme calibrators in the reduction of interlaboratory<br />
variation of <strong>en</strong>zyme activity measurem<strong>en</strong>ts has rec<strong>en</strong>tly<br />
gained more interest. The properties of such a calibrator have<br />
be<strong>en</strong> defined and include commutability with pati<strong>en</strong>t sera over<br />
the various methods, stability over a prolonged period and<br />
traceability of the target values to refer<strong>en</strong>ce methods. G<strong>en</strong>erally,<br />
calibration sera and control sera consist of a pool of<br />
human serum spiked with purified <strong>en</strong>zymes of either human or<br />
animal origin. Information on the exact composition of such<br />
sera is usually not provided. In our view such information,<br />
including the source and purity of the added <strong>en</strong>zymes, the<br />
degree of commutability of the <strong>en</strong>zymes with human serum<br />
<strong>en</strong>zymes and the exact procedures of target value assessm<strong>en</strong>t,<br />
should be available to the customer.<br />
In this article we have summarized the information that was<br />
provided upon request by the manufacturers of <strong>en</strong>zyme cali-<br />
The results confirm our opinion, that the lack of good calibration<br />
standards rather than differ<strong>en</strong>ces in methodology is the<br />
major reason for discrepancies in the measurem<strong>en</strong>ts of<br />
<strong>en</strong>zymes.<br />
B.E.P.B. BALLIEUX 1 , S.C. ENDENBURG 2 , Y.Y. van der HOEK 3 , Y.B. de RIJKE 4 , A. WOLTHUIS 5 and C. van der HEIDEN 6<br />
Working group of the Enzyme Committee of the Netherlands Society for Clinical Chemistry. University Hospital Rotterdam 1 , Tw<strong>en</strong>teborg<br />
Hospital, Almelo 2 , Sint Antonius Hospital, Nieuwegein 3 , Bosch Medic<strong>en</strong>ter, D<strong>en</strong> Bosch 4 , De Wever/Gregorius Hospital, Heerl<strong>en</strong> 5 ,<br />
BCO Analytical Services B.V., Breda 6<br />
Eiwitt<strong>en</strong><br />
13. Plasma-expanders kunn<strong>en</strong> stor<strong>en</strong> bij de bepaling van eiwit in urine<br />
M.H. de KEIJZER <strong>en</strong> I.S. KLASEN<br />
C<strong>en</strong>traal Klinisch Chemisch Laboratorium, AZN St Radboud, Nijmeg<strong>en</strong><br />
Rec<strong>en</strong>t werd<strong>en</strong> wij geconfronteerd met e<strong>en</strong> patiënt in wi<strong>en</strong>s<br />
urine elders e<strong>en</strong> verhoogde hoeveelheid eiwit was gemet<strong>en</strong>.<br />
De organ<strong>en</strong> van de patiënt zoud<strong>en</strong> gedoneerd word<strong>en</strong>. Na <strong>en</strong>ig<br />
speurwerk werd duidelijk dat de geïnfundeerde plasmaexpander<br />
de hyperproteïnurische urine veroorzaakte. Wij hebb<strong>en</strong><br />
daarop onderzoek gedaan naar de verschill<strong>en</strong>de plasmaexpanders<br />
in relatie tot verschill<strong>en</strong>de bepalingsmethod<strong>en</strong> voor<br />
eiwit in urine. Onderzocht zijn Gelofusine ® (e<strong>en</strong> gemodificeerde<br />
gelatine), Haemaccel ® (e<strong>en</strong> polypeptide met ureum<br />
crosslinks) <strong>en</strong> EloHAES ® (plantaardig zetmeel gelijk<strong>en</strong>d op<br />
glycoge<strong>en</strong>), alle drie in e<strong>en</strong> conc<strong>en</strong>tratie van 5 g/l in urine.<br />
Voor de bepaling van eiwit in urine is gebruik gemaakt van de<br />
Coomassie Brilliant Blue (CBB) methode, de Pyrogallol Rood<br />
Molybdaat (PRM) methode met <strong>en</strong> zonder toevoeging van natrium<br />
dodecylsulfaat (SDS), de Ponceau-S (PON-S) methode,<br />
de biureet (BIU) methode <strong>en</strong> de trichloorazijnzuur (TCA) <strong>en</strong><br />
b<strong>en</strong>zethonium (BENZ) troebelingsmethodes.<br />
Uit de tabel valt af te leid<strong>en</strong> dat er verschill<strong>en</strong> in zowel het soort<br />
plasma-expander als in de bepalingsmethode bestaan. Het plant-<br />
Eiwitbepaling in urine (conc<strong>en</strong>tratie in g/l)<br />
brators and control sera with assigned values (CSAV) on the<br />
composition of the sera and the procedures of target value<br />
assessm<strong>en</strong>t. Only three commercially available sera are<br />
int<strong>en</strong>ded to be used as calibrators. One of them fulfils almost<br />
all criteria, while the others are not yet available on a large<br />
scale or lack information on the traceability of the target<br />
values. The second calibrator contains only human <strong>en</strong>zymes<br />
partly derived from cell-cultures.<br />
G<strong>en</strong>erally, information on the composition of CSAV was also<br />
available, but with one exception target values were not traceable<br />
to refer<strong>en</strong>ce methods and no information on the commutability<br />
with human sera was available.<br />
Several manufacturers are now working on the production of<br />
calibration sera containing only human <strong>en</strong>zymes. The need for<br />
commutability and the value of all-human <strong>en</strong>zyme calibrators<br />
is further discussed.<br />
aardige zetmeel EloHaes ® blijkt bij ge<strong>en</strong> <strong>en</strong>kele methode als eiwit<br />
meegemet<strong>en</strong> te word<strong>en</strong>; dit in teg<strong>en</strong>stelling tot Gelofusine ®<br />
<strong>en</strong> Haemaccel ® , dat met de methodes gebaseerd op kleurontwikkeling<br />
tot positieve resultat<strong>en</strong> leidt. E<strong>en</strong> uitzondering hierop<br />
is de CBB methode. De beide eiwitbepaling<strong>en</strong> gebaseerd op e<strong>en</strong><br />
troebelingsreactie met<strong>en</strong> ge<strong>en</strong> plasma-expanders.<br />
De vraag blijft of e<strong>en</strong> bepalingsmethode wel of niet plasmaexpanders<br />
als eiwit moet met<strong>en</strong>. In het onderhavige geval<br />
war<strong>en</strong> bijna twee goed-functioner<strong>en</strong>de nier<strong>en</strong> niet ter donatie<br />
aangebod<strong>en</strong>. Anderzijds is in geval van Gelofusine ® <strong>en</strong><br />
Haemaccel ® wel degelijk sprake van eiwitachtige verbinding<strong>en</strong>,<br />
zodat meting hiervan in urine niet als foutief beschouwd<br />
kan word<strong>en</strong>.<br />
Concluder<strong>en</strong>d: bij de bepaling van eiwit in urine kunn<strong>en</strong> geïnfundeerde<br />
plasma-expanders stor<strong>en</strong>. K<strong>en</strong>nis van de gebruikte<br />
bepalingsmethode voorkomt foutieve interpretatie van de gemet<strong>en</strong><br />
proteinurie. E<strong>en</strong> alternatieve methode voor het bepal<strong>en</strong><br />
van eiwit in urine kan dan uitsluitsel bied<strong>en</strong>.<br />
TCA PRM PRM/SDS PON-S BENZ CBB BIU<br />
Urine met:<br />
Gelofusine® NTD 3,9 3,1 NTD NTD NTD 4,7<br />
Haemaccel® NTD 3,8 3,3 NTD NTD NTD 4,7<br />
EloHAES® NTD NTD NTD NTD NTD NTD NTD<br />
NTD: niet te detecter<strong>en</strong><br />
66 Ned Tijdschr Klin Chem 1998, vol. 23, no. 2
14. Determination of monoclonal IgD by means of ELISA, agarose gel electrophoresis and capillary electrophoresis<br />
J. BROUWER and J. de WINTER<br />
Departm<strong>en</strong>t of Clinical Chemistry, Diagnostic C<strong>en</strong>tre SSDZ, Delft<br />
The single most important abnormality that is disclosed by<br />
serum protein electrophoresis is that of a monoclonal<br />
gammopathy. Scanning d<strong>en</strong>sitometry provides an acceptable<br />
means of quantitating monoclonal Ig and is unaffected by the<br />
antig<strong>en</strong>icity of the protein. In practice this is only a problem<br />
wh<strong>en</strong> a minor monoclonal Ig is superimposed on an appreciable<br />
background of polyclonal Ig. Analyses of sera with<br />
monoclonal IgD offer the opportunity to study the contribution<br />
of polyclonal Ig to the protein conc<strong>en</strong>tration in the monoclonal<br />
peak after electrophoretic separation. The actual conc<strong>en</strong>tration<br />
of a minor monoclonal IgD compon<strong>en</strong>t can be measured by<br />
means of an ELISA for IgD, because in that assay the<br />
pres<strong>en</strong>ce of other Ig classes does not affect the results.<br />
We analysed 14 sera from 3 pati<strong>en</strong>ts with IgD myeloma by<br />
means of ELISA, agarose gel electrophoresis (AGE) and<br />
capillary electrophoresis (CE). After CE, results were calcu-<br />
In an analytical evaluation, commercially available ELISA test<br />
kits for detection of antibodies directed against extractable<br />
nuclear antig<strong>en</strong>s (ENA) were compared with a combination of<br />
counterimmunoelectrophoresis and immunoblotting. Three<br />
scre<strong>en</strong>ing ELISAs (Relisa ® ENA (Immunoconcepts, Bio-<br />
Medical Diagnostics, Brugge, Belgium (BMD)); ENA-LISAÔ<br />
Polyval<strong>en</strong>t (BMD) and Mil<strong>en</strong>ia ENA scre<strong>en</strong> (Diagnostic<br />
Product Corporation Nederland bv, Apeldoorn, The Netherlands<br />
(DPC))) and two typing ELISAs (ENA-LISAÔ (BMD)<br />
and Mil<strong>en</strong>ia ENA combi (DPC) were tested. Sera from 180<br />
antinuclear antig<strong>en</strong>s positive pati<strong>en</strong>ts were evaluated for the<br />
pres<strong>en</strong>ce of antibodies directed against SS-A, SS-B, Sm and<br />
RNP. Besides samples with CIE/IB prov<strong>en</strong> ENA antibodies,<br />
samples with negative ENA results were included to check for<br />
cross-reactivity and purity. Additionally, 14 samples from<br />
pati<strong>en</strong>ts suspected for scleroderma were selected for Scl-70<br />
antibody detection. Finally, 5 Jo-1-positive and 6 Jo-1-negative<br />
samples were included in the study. All ELISAs were<br />
fairly simple, easy to perform and very "user fri<strong>en</strong>dly", since<br />
most of the reag<strong>en</strong>ts were ready to use. The agreem<strong>en</strong>t with<br />
the curr<strong>en</strong>t methods was good, but the scre<strong>en</strong>ing as well as<br />
typing ELISAs proved to be more s<strong>en</strong>sitive, especially with<br />
regard to detection of SS-A auto-antibodies. The Relisa®ENA<br />
showed a rather poor agreem<strong>en</strong>t and specificity, especially in<br />
case borderline reactivity was considered positive and selected<br />
for typing. The cut-off range of this assay was not well established.<br />
The DPC Mil<strong>en</strong>ia ENA combi ELISA method is<br />
designed for scre<strong>en</strong>ing and typing, since the first two wells of<br />
the microtiter-strip should contain an ENA-mix. This was<br />
clearly not the case, since only Sm antibodies could be<br />
detected. This kit also suffered from problems of purity of<br />
antig<strong>en</strong> and standardisation of reactivity betwe<strong>en</strong> lots (possibly<br />
caused by differ<strong>en</strong>ces in amount of coated antig<strong>en</strong>). The<br />
other three ELISAs were reliable and s<strong>en</strong>sitive assays for<br />
detection of ENA auto-antibodies in clinical specim<strong>en</strong>s,<br />
without substantial false negatives. However, the clinical<br />
value of <strong>en</strong>hanced s<strong>en</strong>sitivity and specificity needs to be<br />
assessed in a clinical managem<strong>en</strong>t study.<br />
Ned Tijdschr Klin Chem 1998, vol. 23, no. 2<br />
lated from peak area perc<strong>en</strong>t (CE 1) and from corrected peak<br />
area perc<strong>en</strong>t (CE 2). IgD conc<strong>en</strong>trations in the sera varied<br />
betwe<strong>en</strong> 2.2 and 14.4 g/l, as measured by ELISA. Polyclonal<br />
Ig was betwe<strong>en</strong> 6 and 8 g/l.<br />
Differ<strong>en</strong>ces betwe<strong>en</strong> the methods were assessed by means of<br />
the 95% CI for the mean differ<strong>en</strong>ces, showing that IgD (CE 2)<br />
> IgD (ELISA) = IgD (AGE) = IgD (CE 1).<br />
The differ<strong>en</strong>ce betwe<strong>en</strong> IgD (CE 2) and IgD (CE 1) is determined<br />
to a large ext<strong>en</strong>d by the differ<strong>en</strong>ce for albumin (ALB)<br />
in CE 1 and CE 2: ALB (CE 1) = ALB (CE 2) + 4.0.<br />
ALB was also determined on a Paramax analyser (PMX) and a<br />
Behring nephelometer analyser (BNA). Correlations were<br />
ALB (CE 1) > ALB (PMX) > ALB (BNA) = ALB (CE 2).<br />
For the conc<strong>en</strong>trations of minor IgD compon<strong>en</strong>ts (< 3 g/l) it<br />
was found that IgD (CE 2) = IgD (AGE) > IgD (CE 1) > IgD<br />
(ELISA).<br />
15. A comparison of ELISA assays as routine diagnostic test for detection of autoantibodies against extractable<br />
nuclear antig<strong>en</strong>s<br />
J.L.P. van DUIJNHOVEN 1 , F.J.M. van de WARENBURG 1 , A.J.W.P. WILLEMS 1 and A.A.M. ERMENS 2<br />
Clinical Laboratory 1 , Elkerliek Hospital, Helmond, The Netherlands and Clinical Laboratory 2 , Diaconess<strong>en</strong>huis, Eindhov<strong>en</strong>, The<br />
Netherlands<br />
S<strong>en</strong>sitivity and specificity (%) with confid<strong>en</strong>ce intervals in comparison<br />
to CIE/IB<br />
A. scre<strong>en</strong>ing assays<br />
S<strong>en</strong>sitivity Specificity<br />
Relisa®ENA 100 86 (80-92)<br />
ENA-LISAÔ polyval<strong>en</strong>t: 91 (87-95) 96 (93-99)<br />
Mil<strong>en</strong>ia ENA scre<strong>en</strong> 100 90 (86-94)<br />
B. typing assays<br />
S<strong>en</strong>sitivity Specificity<br />
ENA-LISAÔ:<br />
SS-A 100 79 (70- 88)<br />
SS-B 100 97 (93-100)<br />
RNP 69 (59-79) 99 (97-100)<br />
Sm 71 (61-81) 100<br />
Scl-70 86 (78-94) 86 (80- 92)<br />
Jo-1 100 83 (61-100)<br />
Mil<strong>en</strong>ia ENA combi:<br />
SS-A 100 80 (71- 89)<br />
SS-B 100 89 (82- 96)<br />
RNP 46 (35-57) 94 (89- 99)<br />
Sm 100 67 (57- 77)<br />
Scl-70 100 76 (69- 84)<br />
Jo-1 100 80 (55-100)<br />
67
16. Method for the detection of B<strong>en</strong>ce Jones proteins by capillary electrophoresis<br />
Y.M.C. HENSKENS and G.A.E. PONJEE<br />
Laboratory for Clinical Chemistry and Hematology, Diagnostic C<strong>en</strong>tre SSDZ, Reinier de Graaf Groep, Delft<br />
The technique of capillary electrophoresis (CE) is based on<br />
separating molecules on molecular size, electric charge and<br />
hydrophobicity. Our laboratory already described CE as a usefull<br />
and rapid alternative for conv<strong>en</strong>tional agarose gel electrophoresis<br />
(AGE) in detecting and id<strong>en</strong>tifying monoclonal<br />
gammopathies (<strong>NVKC</strong> 1997, 22:117). Detection of fragm<strong>en</strong>ts<br />
of monoclonal immunoglobulins in urine, B<strong>en</strong>ce Jones proteins,<br />
by CE has not be<strong>en</strong> reported yet. Therefore, the aim of<br />
this study was to develop a CE method to detect B<strong>en</strong>ce Jones<br />
proteins. The major problem that could be expected by<br />
analysis of urine for protein detection on CE is the interfer<strong>en</strong>ce<br />
of other urinary compon<strong>en</strong>ts as electrolytes, organic<br />
acids and other metabolites.The standard method for detection<br />
and quantitation of B<strong>en</strong>ce Jones proteins in our laboratory is<br />
AGE using home-made gels (after urine conc<strong>en</strong>tration, 200<br />
times), coomassie brilliant blue staining and d<strong>en</strong>sitometric<br />
scanning. The CE analysis was performed on a Beckman<br />
P/ACE system 5000 using UV detection and untreated fusedsilica<br />
capillaries (27 cm, 50 µm ID). First, t<strong>en</strong> urine samples of<br />
healthy subjects were conc<strong>en</strong>trated 200 times and analysed on<br />
CE using boric acid running buffer (150 mM, pH 9.65). All<br />
Elektrolyt<strong>en</strong><br />
17. Serum magnesium during pre-eclampsia and uncomplicated pregnancy<br />
Objective: In order to evaluate a relation betwe<strong>en</strong> magnesium<br />
(Mg) and calcium (Ca) conc<strong>en</strong>trations and the occurr<strong>en</strong>ce of<br />
pre-eclampsia we measured Mg and Ca in wom<strong>en</strong> with preeclampsia<br />
(PE), uncomplicated pregnancy and non-pregnant<br />
wom<strong>en</strong>.<br />
Introduction: PE occurs during the last part of the pregnancy<br />
and is the most important cause for maternal mortality and<br />
morbidity in Europe. The main expression of PE is a diastolic<br />
blood pressure of at least 90 mm Hg; most probably caused by<br />
a dysfunctional <strong>en</strong>dothelium.<br />
Mg and Ca are both cations involved in the regulation of blood<br />
pressure. Therefore a change in Mg or Ca conc<strong>en</strong>trations<br />
could affect the blood pressure during PE, resulting in vasoconstriction<br />
and thus hypert<strong>en</strong>sion.<br />
Subjects: Total and ionized serum Mg, ionized serum Ca, total<br />
and ionized intracellular Mg conc<strong>en</strong>trations were measured in<br />
non-pregnant wom<strong>en</strong> (n=24), wom<strong>en</strong> with severe PE (n=15)<br />
and uncomplicated pregnancy (n=34).<br />
Main outcome: Ionized Ca was similar in wom<strong>en</strong> with PE or<br />
the normal urine samples showed differ<strong>en</strong>t electropherograms<br />
on CE which was probably caused by a differ<strong>en</strong>t salt conc<strong>en</strong>tration<br />
in each sample. Therefore we developed a rapid and<br />
easy method to desalt these urine samples using equilibrated<br />
sephadex G-25 beads in a 1 ml syringe which was c<strong>en</strong>trifugated<br />
(1.5 min., 1500 rpm) after the conc<strong>en</strong>trated urine sample<br />
was added on top. The desalted normal urine samples were<br />
collected and injected on CE. CE electropherograms of<br />
desalted normal urine samples showed no spikes. Next, t<strong>en</strong><br />
differ<strong>en</strong>t samples of urine which contained B<strong>en</strong>ce Jones proteins<br />
according to our standard method (kappa or lambda light<br />
chains in high or low conc<strong>en</strong>trations) were analysed by CE<br />
after conc<strong>en</strong>tration (200 times) and desalting. In all these<br />
samples the B<strong>en</strong>ce Jones proteins were clearly visible in the<br />
gamma region (large or small spikes) of the CE electropherogram.<br />
We conclude that CE can be used, next to the detection<br />
of serum paraproteins, for detection of B<strong>en</strong>ce Jones proteins.<br />
Future studies will focus on the quantitation of B<strong>en</strong>ce Jones<br />
proteins using CE and the id<strong>en</strong>tification of the light chains<br />
(lamda or kappa) using immunosubtraction capillary electrophoresis.<br />
R. SANDERS 1 , A. KONIJNENBERG 2 , H.J. HUIJGEN 1 and G.T. SANDERS 1<br />
Academic Medical C<strong>en</strong>ter, University of Amsterdam, Departm<strong>en</strong>t of Clinical Chemistry 1 and Gynecology and Obstetrics 2 , Amsterdam,<br />
The Netherlands<br />
uncomplicated pregnancy and non-pregnant wom<strong>en</strong>, while<br />
both ionized and total Mg decrease during pregnancy. However,<br />
elevated total and ionized serum Mg conc<strong>en</strong>trations were<br />
found in wom<strong>en</strong> with PE compared with uncomplicated pregnant<br />
wom<strong>en</strong> (total Mg=0.85 vs. 0.72 mmol/l, p=0.02; ionized<br />
Mg=0.61 vs. 0.53 mmol/l, p=0.04). In addition, it could be<br />
demonstrated that the ionized serum Mg level was related to<br />
birth weight and gestational age at delivery. The total Mg conc<strong>en</strong>tration<br />
was similar in wom<strong>en</strong> with PE and non-pregnant<br />
wom<strong>en</strong> (p=0.24).<br />
Furthermore, intracellular Mg conc<strong>en</strong>trations in mononuclear<br />
blood cells (ionized and total Mg) and erythrocytes (total Mg)<br />
were id<strong>en</strong>tical in wom<strong>en</strong> with PE and uncomplicated pregnancy.<br />
Conclusions: Serum Mg conc<strong>en</strong>trations are elevated in wom<strong>en</strong><br />
with severe pre-eclampsia compared with uncomplicated<br />
pregnant wom<strong>en</strong>. A causative relation is hypothesized since<br />
Mg is involved in blood pressure regulation through an intracellular<br />
process in <strong>en</strong>dothelial cells.<br />
18. Comparison of Three Commercially Available Ion-Selective Electrodes for Ionized Magnesium Determination<br />
in Serum: a Two-C<strong>en</strong>ter Study<br />
H.J. HUIJGEN 1 , R. SANDERS 1 , S.A. CECCO 2 , N.N. REHAK 2 , G.T.B. SANDERS 1 and R.J. ELIN 3<br />
Departm<strong>en</strong>t of Clinical Chemistry, Academic Medical C<strong>en</strong>ter, University of Amsterdam, Amsterdam, The Netherlands 1 , Clinical<br />
Chemistry Service, Clinical Pathology Departm<strong>en</strong>t, National Institutes of Health, Bethesda, USA 2 , Departm<strong>en</strong>t of Pathology and<br />
Laboratory Medicine, University of Louisville, Louisville, USA 3 .<br />
In a two-c<strong>en</strong>ter study we compared all three curr<strong>en</strong>tly available<br />
magnesium ion-selective electrodes (Mg-ISE): AVL<br />
988/4, KONE Microlyte 6, and NOVA CRT. Serum samples<br />
obtained from both healthy volunteers (n=142) and pati<strong>en</strong>ts<br />
(n=95) were collected and measured at the Academic Medical<br />
C<strong>en</strong>ter on the AVL and KONE, and at the National Institutes<br />
of Health on the NOVA. Each sample collected at the AMC<br />
was measured fresh, one aliquot was stored (-20°C) and one<br />
68 Ned Tijdschr Klin Chem 1998, vol. 23, no. 2
aliquot was shipped to the NIH, and vice versa. The measurem<strong>en</strong>ts<br />
of froz<strong>en</strong> aliquots were coordinated so that each day the<br />
same samples were analyzed by both institutes. Besides comparison<br />
of the analyzers, imprecision and refer<strong>en</strong>ces ranges<br />
were established.<br />
In pati<strong>en</strong>t samples the best correlation was found betwe<strong>en</strong> the<br />
KONE and AVL analyzers: slope 0,964, intercept -0,01<br />
mmol/l. In samples from healthy volunteers all analyzers<br />
reported significantly differ<strong>en</strong>t (p0,05): slope 1,000, intercept<br />
-0,04 mmol/l, n=88. Best precision was found using the<br />
NOVA analyzer, CV's established at three iMg 2+ levels (0,21,<br />
Endocrinologie<br />
G<strong>en</strong>eralized thyroid hormone resistance (GTHR) is a syndrome<br />
characterized by tissue nonresponsiv<strong>en</strong>ess to thyroid<br />
hormone and by variable clinical ph<strong>en</strong>otype manifestations.<br />
GTHR results from single mutations in the g<strong>en</strong>e <strong>en</strong>coding the<br />
thyroid hormone receptor. These mutations are clustered in<br />
two major sites surrounding the ligand binding domain. Up to<br />
80 mutations in this g<strong>en</strong>e have be<strong>en</strong> id<strong>en</strong>tified, mostly located<br />
in exon 9 and exon 10.<br />
Ned Tijdschr Klin Chem 1998, vol. 23, no. 2<br />
0,53, 1,03 mmol/l) were all < 4,0%. CV's for the AVL and<br />
KONE analyzers were
met e<strong>en</strong> wissel<strong>en</strong>de hoeveelheid toegevoegd intact, humaan<br />
PTH (firma; 1-84). Deze series werd<strong>en</strong> gemet<strong>en</strong> met respectievelijk<br />
de N-tact PTH SP kit van Incstar (IRMA; V<strong>en</strong>lo), de<br />
intact PTH kit van Nichols (IRMA; Heerl<strong>en</strong> <strong>en</strong> Maastricht) <strong>en</strong><br />
de Immulite Intact PTH van DPC (FIEMA, Sittard). Alle drie<br />
method<strong>en</strong> vertoond<strong>en</strong> goede lineariteit (parallellisme), goede<br />
reproduceerbaarheid van van duplo’s (gemiddeld 1,9%) <strong>en</strong><br />
prima correlaties met elkaar (r>0,99). Echter de meetwaard<strong>en</strong><br />
<strong>en</strong> de recovery’s van toegevoegd PTH war<strong>en</strong> volstrekt niet<br />
met elkaar in overe<strong>en</strong>stemming. Met de methodes van Incstar<br />
(tweemaal) <strong>en</strong> DPC werd respectievelijk 32,0; 44,5; 46,2 <strong>en</strong><br />
65,8 pmol/l gevond<strong>en</strong> in poolserum (gemiddeld gemet<strong>en</strong><br />
conc<strong>en</strong>tratie 2,5 pmol/l met daaraan toegevoegd 31,3 pmol/l).<br />
22. S<strong>en</strong>sitivity and linearity of hCG assays for nicked hCG: a comparative study<br />
Rec<strong>en</strong>t data show that proteolytic cleavage of the β subunit of<br />
hCG (nicking) is relevant in both analytical and <strong>bio</strong>logical<br />
respect. To study the s<strong>en</strong>sitivity and linearity of hCG assays<br />
for intact hCG (hCG) and nicked hCG (n-hCG) we performed<br />
a comparative study. hCG was obtained from a commercial<br />
source; n-hCG was prepared as described by Birk<strong>en</strong> et al<br />
(Endocrinology 199; 129: 1551-8). Intact and n-hCG were<br />
added separately to pooled human serum samples in id<strong>en</strong>tical<br />
mass conc<strong>en</strong>trations. Dilutions were made according to the<br />
NCCLS EP6 protocol for evaluation of linearity (within the<br />
linear range as claimed by the manufacturers) and analysed for<br />
hCG with the following assays: IMMULITE One hCG *, IMx<br />
total beta hCG *, IMx hCG, MAIAclone hCG *, ACS:180<br />
total hCG +B *, and Elecsys hCG (assays marked with a *<br />
measure both intact hCG and free β hCG; unmarked assays<br />
measure only intact hCG). Deviations from linearity were not<br />
detected for either hCG or n-hCG; all measured conc<strong>en</strong>trations<br />
were within plus or minus 5% of the calculated conc<strong>en</strong>trations.<br />
The s<strong>en</strong>sitivity of the assays for hCG and n-hCG was<br />
Ook de recovery’s van de andere sera vertoond<strong>en</strong> hetzelfde<br />
beeld <strong>en</strong> gav<strong>en</strong> gemiddeld 96% (Incstar), 138% (Nichols) <strong>en</strong><br />
198% (Immulite, DPC). De oorzaak van de klaarblijkelijk te<br />
hoge meting bij Immulite <strong>en</strong> in iets mindere mate bij Nichols<br />
is moeilijk te gev<strong>en</strong>. Aangezi<strong>en</strong> niet-verrijkte LWBA-monsters<br />
<strong>en</strong> het in de regio Limburg gebruikte poolserum hetzelfde<br />
beeld verton<strong>en</strong> <strong>en</strong> het toegevoegde PTH intact is <strong>en</strong> chromatografisch<br />
gecontroleerd, lijkt het niet aan de toevoeging te ligg<strong>en</strong>.<br />
Ook gezi<strong>en</strong> de lineariteit van de waarneming<strong>en</strong> lijkt het<br />
eerder e<strong>en</strong> kwestie van onjuiste afijking van standaard<strong>en</strong> of<br />
verkeerde responsfactor<strong>en</strong>. Hoe dan ook is het onw<strong>en</strong>selijk als<br />
de meting van e<strong>en</strong> relevant hormoon afhankelijk van de<br />
gebruikte methode tot e<strong>en</strong> factor twee kan verschill<strong>en</strong>.<br />
H. E. van INGEN<br />
Departm<strong>en</strong>t of Clinical Chemistry, AZR Daniel d<strong>en</strong> Hoed Cancer C<strong>en</strong>tre, Rotterdam, The Netherlands<br />
Tumordiagnostiek<br />
23. P53: e<strong>en</strong> nieuwe prognostische marker voor oppervlakkige blaastumor<strong>en</strong>?<br />
De meeste blaastumor<strong>en</strong> zijn oppervlakkig als ze ontdekt word<strong>en</strong><br />
(70-75%) <strong>en</strong> 85% van deze oppervlakkige tumor<strong>en</strong> ker<strong>en</strong><br />
weer terug na behandeling. Van deze terugker<strong>en</strong>de tumor<strong>en</strong><br />
zal ongeveer 10-15% in de spierlaag ingroei<strong>en</strong> <strong>en</strong> uiteindelijk<br />
metastaser<strong>en</strong> (1). Het is daarom zeer belangrijk te wet<strong>en</strong> welke<br />
oppervlakkige blaastumor<strong>en</strong> de pot<strong>en</strong>tie hebb<strong>en</strong> te metastaser<strong>en</strong>.<br />
Prognostische markers die tot op hed<strong>en</strong> met name gebruikt<br />
word<strong>en</strong> om deze risicogroep te id<strong>en</strong>tificer<strong>en</strong> zijn het<br />
voorkom<strong>en</strong> van recidiev<strong>en</strong>, het klinische beeld carcinoma in<br />
situ (CIS), stadium, graad <strong>en</strong> grootte van de tumor (2). Onlangs<br />
is aangetoond dat mutaties in het p53 g<strong>en</strong> bij patiënt<strong>en</strong><br />
die behor<strong>en</strong> tot de risicogroep e<strong>en</strong> positief voorspell<strong>en</strong>de<br />
waarde van 86% hebb<strong>en</strong> voor de progressie van de ziekte.<br />
Hierbij werd<strong>en</strong> de mutaties voorafgaande aan de progressie<br />
aangetroff<strong>en</strong>. E<strong>en</strong> negatief voorspell<strong>en</strong>de waarde (ge<strong>en</strong> mutatie<br />
<strong>en</strong> ge<strong>en</strong> progressie) van 63% werd gevond<strong>en</strong> (3).<br />
Het p53 eiwit wordt ook wel de beschermer van ons g<strong>en</strong>oom<br />
g<strong>en</strong>oemd. Expressie van p53 vindt normaliter plaats naar<br />
aanleiding van DNA schade. Het p53 stagneert de celcyclus<br />
om DNA reparatie mogelijk te mak<strong>en</strong> of apoptose (geprogrammeerde<br />
celdood) te initiër<strong>en</strong> (4).<br />
calculated relative to the s<strong>en</strong>sitivity of the IMMULITE One<br />
hCG assay for hCG (=100%) and is shown in the table.<br />
Assay Immulite IMx IMx MAIA ACS:180 Elecsys<br />
One tbhCG hCG clone total hCG<br />
hCG hCG+β hCG+B<br />
hCG 100 113 79.6 91.6 74.5 87.1<br />
n-hCG 129 55.7 11.7 4.48 12.9 3.1<br />
In a further experim<strong>en</strong>t, samples containing id<strong>en</strong>tical conc<strong>en</strong>trations<br />
of hCG and n-hCG were distributed in a profici<strong>en</strong>cy<br />
scheme for hCG analysis to 98 laboratories in the Netherlands<br />
using 15 hCG methods. Results confirmed the results obtained<br />
in the internal study: differing s<strong>en</strong>sitivities for hCG and n-hCG<br />
are se<strong>en</strong>, while especially assays measuring intact hCG show a<br />
low response to n-hCG. This information is relevant in view of<br />
the rec<strong>en</strong>t standardisation efforts in the hCG field.<br />
J.M.T. KLEIN GUNNEWIEK 1 , J.D. OOSTING 1 <strong>en</strong> W.W. van SOLINGE 2<br />
Canisius-Wilhelmina Ziek<strong>en</strong>huis, Nijmeg<strong>en</strong> 1 <strong>en</strong> Algeme<strong>en</strong> Christelijk Ziek<strong>en</strong>huis Eemland, Amersfoort 2<br />
Om de waarde van e<strong>en</strong> p53 mutatiebepaling bij patiënt<strong>en</strong> met<br />
oppervlakkige blaastumor<strong>en</strong> te evaluer<strong>en</strong> word<strong>en</strong> in drie verschill<strong>en</strong>de<br />
ziek<strong>en</strong>huiz<strong>en</strong> (Eemland Ziek<strong>en</strong>huis, Amersfoort;<br />
Academisch Ziek<strong>en</strong>huis Nijmeg<strong>en</strong> (prof. dr. J. Schalk<strong>en</strong>); Canisius-Wilhelmina<br />
Ziek<strong>en</strong>huis, Nijmeg<strong>en</strong>) patiënt<strong>en</strong> getest op<br />
aanwezigheid van p53 mutaties. De patiënt<strong>en</strong> zijn geselecteerd<br />
op basis van de aanwezigheid van meerdere snel terugker<strong>en</strong>de<br />
pT1 tumor<strong>en</strong> of e<strong>en</strong> graad 2b/3 tumor of behor<strong>en</strong> tot de high<br />
risk groep in de zog<strong>en</strong>aamde kwanticiet bepaling (kwantitatieve<br />
cytologie gebaseerd op de vorm <strong>en</strong> de DNA inhoud van<br />
de celkern). Voor de mutatiebepaling wordt DNA, geïsoleerd<br />
uit blaaswassing<strong>en</strong> <strong>en</strong>/of tumormateriaal, geamplificeerd met<br />
behulp van PCR, geanalyseerd middels SSCP (Single-Strand<br />
Conformation Polymorphism) gevolgd door sequ<strong>en</strong>tie-analyse.<br />
1. Torti M and Lum BL. Cancer 1987; 59: 613.<br />
2. Kiem<strong>en</strong>ey LALM, Witjes JA, Heijbroek RP, Verbeek ALM and<br />
Debruyne FMJ. J Urol 1993; 150: 60-64.<br />
3. Vet JAM, Witjes JA, Marras SAE, Hessels D, Poel HG van der, Debruyne<br />
FMJ and Schalk<strong>en</strong> JA. Clin Cancer Res 1996; 2: 1055-1061.<br />
4. Lane DP. Nature 1992; 358: 15-16.<br />
70 Ned Tijdschr Klin Chem 1998, vol. 23, no. 2
24. Trombocyt<strong>en</strong> serotonine gehalte is de meest s<strong>en</strong>sitieve marker voor <strong>bio</strong>chemische diagnose van carcinoïd<br />
tumor<strong>en</strong><br />
I.P. KEMA 1 , W.G. MEIER 2 , P.H.B. WILLEMSE 2 , M. VOLMER 1 <strong>en</strong> E.G.E. de VRIES 1<br />
C<strong>en</strong>traal Klinisch Chemisch laboratorium 1 <strong>en</strong> Afdeling Interne Oncologie 2 , Academisch Ziek<strong>en</strong>huis Groning<strong>en</strong><br />
Carcinoïd tumor<strong>en</strong> kunn<strong>en</strong>, afhankelijk van hun primaire<br />
lokalisatie in voor-, midd<strong>en</strong>- of eind-darm, wissel<strong>en</strong>de hoeveelhed<strong>en</strong><br />
serotonine <strong>en</strong> 5-hydroxytryptofaan (5-HTP) producer<strong>en</strong>.<br />
Naast de productie van indol<strong>en</strong>, kunn<strong>en</strong> deze tumor<strong>en</strong><br />
e<strong>en</strong> verhoogde uitscheiding veroorzak<strong>en</strong> van andere <strong>bio</strong>g<strong>en</strong>e<br />
amin<strong>en</strong> <strong>en</strong> peptides. Carcinoïd patiënt<strong>en</strong> word<strong>en</strong> gewoonlijk<br />
<strong>bio</strong>chemisch gediagnosticeerd op basis van e<strong>en</strong> verhoogde uitscheiding<br />
van 5-hydroxyindolazijnzuur (5-HIAA) in urine. De<br />
gehaltes aan serotonine van plaatjes <strong>en</strong> urine kunn<strong>en</strong> bijdrag<strong>en</strong><br />
aan deze diagnose.<br />
Wij hebb<strong>en</strong>, in e<strong>en</strong> groep van 92 patiënt<strong>en</strong> met histologisch<br />
bewez<strong>en</strong> carcinoïd tumor<strong>en</strong>, met als primaire lokalisatie voordarm<br />
(n=31), midd<strong>en</strong>darm (n=54) of einddarm (7), de klinische<br />
bruikbaarheid geëvalueerd van 5-HIAA in urine <strong>en</strong><br />
serotonine in urine <strong>en</strong> trombocyt<strong>en</strong>. Refer<strong>en</strong>tiewaard<strong>en</strong> zijn<br />
vastgesteld in 50 in geslacht- <strong>en</strong> leeftijd overe<strong>en</strong>kom<strong>en</strong>de<br />
gezonde volwass<strong>en</strong><strong>en</strong>. Bij de analyses hebb<strong>en</strong> we gebruik<br />
26. Detection of tumour DNA in serum of colorectal cancer pati<strong>en</strong>ts<br />
J.B. de KOK 1 , W.W. van SOLINGE 1,4 , T.J.M. RUERS 2 , R.W.H.M. ROELOFS 1 , G.N.P. van MUIJEN 3 , J.L. WILLEMS 1<br />
<strong>en</strong> D.W. SWINKELS 1<br />
Depts. of Clin. Chemistry 1 , Surgery 2 and Pathology 3 , University Hospital Nijmeg<strong>en</strong>, Dept. of Clin. Chemistry 4 , Eemland Hospital,<br />
Amersfoort<br />
Circulating tumour DNA has previously be<strong>en</strong> detected in<br />
serum and plasma of pati<strong>en</strong>ts with lung cancer and head and<br />
neck cancer. These observations could pot<strong>en</strong>tially lead to new,<br />
specific and non-invasive tools for diagnosis, prognosis and<br />
follow-up in neoplastic disease, if found to be a more g<strong>en</strong>eral<br />
Ned Tijdschr Klin Chem 1998, vol. 23, no. 2<br />
gemaakt van HPLC met fluormetrische detectie. Uitkomst<strong>en</strong><br />
van berek<strong>en</strong>ing van ROC karakteristiek<strong>en</strong> zijn weergegev<strong>en</strong> in<br />
onderstaande tabel.<br />
Urine 5-HIAA Plt. 5-HT Urine 5-HT<br />
AUC AUC AUC<br />
Voordarm (31) 0,53 0,75 0,68<br />
Midd<strong>en</strong>darm (54) 0,87 0,93 0,84<br />
Einddarm (7) 0,59 0,57 0,86<br />
Plt. 5-HT: plaatjes serotonine; AUC: Area under the curve<br />
Omdat e<strong>en</strong> hoge AUC e<strong>en</strong> hoge diagnostische waarde aangeeft,<br />
kan geconcludeerd word<strong>en</strong> dat voor alle type carcinoïd tumor<strong>en</strong><br />
plaatjes serotonine e<strong>en</strong> betere marker is dan urine 5-HIAA.<br />
25. Analytical and clinical evaluation of the IMMULITE One monoclonal/monoclonal and monoclonal/polyclonal<br />
assays for determination of CA125<br />
P. HOEFKENS 1 , H.W.A. de BRUYN 2 and H.E. van INGEN 1<br />
Departm<strong>en</strong>t of Clinical Chemistry, AZR Daniel d<strong>en</strong> Hoed Cancer C<strong>en</strong>tre, Rotterdam 1 , The Netherlands and Laboratory of Obstetrics<br />
and Gynaecology, University Hospital Groning<strong>en</strong> 2 , The Netherlands<br />
DPC has rec<strong>en</strong>tly developed a modified version of the<br />
IMMULITE One assay for the determination of CA125. The<br />
new assay (OMMA-P/M) uses a polyclonal tracer antibody,<br />
instead of the monoclonal tracer antibody used in the OMMA-<br />
M/M assay. An analytical and clinical evaluation of both assay<br />
versions was performed. Within-run and total precision were<br />
determined following the NCCLS EP5 guidelines at 3 differ<strong>en</strong>t<br />
conc<strong>en</strong>tration levels:<br />
OMMa-M/M<br />
OMMA-M/P<br />
conc. CV % CV %<br />
kU/l within-run total<br />
9 7.6 12.9<br />
53 7.0 7.8<br />
407 8.2 8.2<br />
10 8.4 14.1<br />
60 6.5 9.0<br />
400 7.7 8.8<br />
Linearity (NCCLS EP6) was confirmed up to 500 kU/l for<br />
both assays. A high dose hook effect could not be demonstrated<br />
for conc<strong>en</strong>trations up to 35000 kU/l. Both assays were<br />
free from interfer<strong>en</strong>ce from hemoglobin (up to 196 Fmol/l),<br />
bilirubin (up to 519 Fmol/l) or an artificial triglyceride solution<br />
(up to 12.7 mmol/l). Refer<strong>en</strong>ce values were measured in<br />
100, appar<strong>en</strong>tly healthy female blood-donors. For the OMMA-<br />
M/M assay results ranged from 1.1-25.6 kU/l and 0.5-13.3<br />
kU/l for wom<strong>en</strong> under 40 years (n=50) and over 50 years<br />
(n=50) of age respectively.<br />
For the OMMA-M/P results were respectively 0.5-26.6 kU/l<br />
and 0.5-6.5 kU/l.<br />
Method comparisons (in the range 0-500 kU/l) betwe<strong>en</strong> the<br />
laboratories refer<strong>en</strong>ce method (CIS ELSA IRMA, using<br />
OC125/M11 antibodies), DPC OMMA-M/M and OMMA-<br />
P/M resulted in the following Bablok-Passing regression equations:<br />
OMMA-M/M=0.74 CIS ELSA - 7.1, r=0.934, n=185;<br />
OMMA-P/M=0.66 CIS ELSA - 3.0, r=0.963, n=185; OMMA-<br />
P/M=0.90 OMMA-M/M +3.5, r=0.972, n=185. By analysing<br />
samples from wom<strong>en</strong> with b<strong>en</strong>ign gynaecological diseases,<br />
pati<strong>en</strong>ts with ovarian carcinoma, and pati<strong>en</strong>ts with other malignancies<br />
it was shown that the OMMA-M/M and OMMA-P/M<br />
are comparable in clinical performance. Although in some<br />
samples from individual pati<strong>en</strong>ts being treated for ovarian<br />
carcinoma minor discrepancies were detected betwe<strong>en</strong><br />
OMMA-M/M and OMMA-P/M, in g<strong>en</strong>eral both methods are<br />
comparable and can be used in the diagnosis and follow-up of<br />
ovarian carcinoma.<br />
ph<strong>en</strong>om<strong>en</strong>on. To test if tumour DNA is also pres<strong>en</strong>t in serum<br />
of pati<strong>en</strong>ts with colorectal cancer, we selected fourte<strong>en</strong><br />
colorectal cancer pati<strong>en</strong>ts with advanced disease. Analyses<br />
were based on the detection of mutations of the K-ras g<strong>en</strong>e in<br />
serum by mutant allele specific amplification (MASA).<br />
71
In sev<strong>en</strong> pati<strong>en</strong>ts, K-ras mutations were detected in the<br />
primary tumour, using MASA primers for point mutations in<br />
codon 12 or 13 of the K-ras g<strong>en</strong>e. All 14 pati<strong>en</strong>ts were<br />
analysed for mutant DNA in serum. K-ras mutations were<br />
detected in serum of six pati<strong>en</strong>ts, all corresponding to the<br />
mutations found in the primary tumour. No mutant K-ras<br />
could be detected in serum of one pati<strong>en</strong>t with a mutation in<br />
the primary tumour and in all sev<strong>en</strong> pati<strong>en</strong>ts without K-ras<br />
mutations in the primary tumour.<br />
Hematologie<br />
We investigated whether pediatric pati<strong>en</strong>ts with sickle cell<br />
disease (9±4 years; 27 HbSS; 19 HbSC) have differ<strong>en</strong>t folate<br />
status compared with age, sex and race matched HbAA controls<br />
(n=20), and whether their folate status can be improved<br />
by folate supplem<strong>en</strong>tation. The pati<strong>en</strong>ts were supplem<strong>en</strong>ted<br />
with vitamins B6 and B12 during one week and with folate<br />
during the next week. Circulating folate, homocysteine,<br />
vitamin B6 and vitamin B12 levels were measured at baseline<br />
(pati<strong>en</strong>ts and controls), after 1 and after 2 weeks (pati<strong>en</strong>ts).<br />
The pati<strong>en</strong>ts had similar folate, vitamin B6 and vitamin B12,<br />
At pres<strong>en</strong>t, these results may be useful in assessing tumour<br />
burd<strong>en</strong> in pati<strong>en</strong>ts with neoplastic disease. Moreover, the<br />
results <strong>en</strong>courage further investigations to determine whether<br />
circulating tumour DNA is pres<strong>en</strong>t in early stages of neoplastic<br />
disease or may proof to be a reliable indicator of<br />
systemic disease at the time of surgery for the colorectal<br />
primary tumour.<br />
27. Elevated plasma homocysteine indicates suboptimal folate status in pediatric sickle cell pati<strong>en</strong>ts<br />
F.P.L. van der DIJS 1 , J.J.B. SCHNOG 2,3 , D.A.J. BROUWER 4 , H.J.R. VELVIS 1 , G.A. van d<strong>en</strong> BERG 5 , A.J. BAKKER 5 ,<br />
A.J. DUITS 3 , F.D. MUSKIET 6 and F.A.J. MUSKIET 2<br />
Departem<strong>en</strong>t of Clinical Chemistry and Hematology, Public Health Laboratory,Curaçao 1 ; Departem<strong>en</strong>t of Internal Medicine, St. Elisabeth<br />
Hospital, Curaçao 2 ; Red Cross Bloodbank, Curaçao 3 ; C<strong>en</strong>tral Laboratory for Clinical Chemistry, University Hospital Groning<strong>en</strong> 4 ;<br />
Departem<strong>en</strong>t of Clinical Chemistry, Clinical Chemical Laboratories, Leeuward<strong>en</strong> 5 ; Departem<strong>en</strong>t of Pediatrics, St. Elisabeth Hospital,<br />
Curaçao 6<br />
but higher homocysteine levels, compared with HbAA controls<br />
(12.7±4.5 vs 10.9±3.5 mmol/l; p=0.04). Vitamin B6 and<br />
B12 supplem<strong>en</strong>tation did not change their homocysteine<br />
levels, but folate supplem<strong>en</strong>tation caused a 53% reduction (to<br />
5.7±1.6). We conclude that pati<strong>en</strong>ts with sickle cell disease<br />
have adequate vitamin B6 and B12 status, but suboptimal<br />
folate status, leading to elevated plasma homocysteine levels.<br />
They may therefore b<strong>en</strong>efit from folate supplem<strong>en</strong>tation to<br />
reduce their high risk for <strong>en</strong>dothelial damage.<br />
28. De oudere rode bloedcel verliest de anti-complem<strong>en</strong>t eiwitt<strong>en</strong> CD55 <strong>en</strong> CD59: e<strong>en</strong> factor bij de verwijdering<br />
van de rode bloedcel?<br />
F.L.A. WILLEKENS 1 , H.J. BOS 2 , B. ROERDINKHOLDER-STOELWINDER 2 , Y.A.M. GROENEN-DOPP 1 ,<br />
G.C. v.d. PLAS 2 <strong>en</strong> J.M. WERRE 2<br />
<strong>Klinische</strong> Chemie 1 , Ziek<strong>en</strong>huis Rijnstate <strong>en</strong> Bloedbank Arnhem e.o. 2 , Arnhem<br />
Achtergrond: In oude rode bloedcell<strong>en</strong> (RBC) tred<strong>en</strong> verandering<strong>en</strong><br />
op in band 3, waardoor e<strong>en</strong> autoantistof zich daaraan<br />
kan bind<strong>en</strong>. Deze s<strong>en</strong>sibilisatie kan e<strong>en</strong> rol spel<strong>en</strong> bij de verwijdering<br />
van de oude rode bloedcel uit de circulatie. Dit proces<br />
wordt waarschijnlijk versterkt door complem<strong>en</strong>tactivatie.<br />
De afwezigheid van de anti-complem<strong>en</strong>t eiwitt<strong>en</strong> CD55 <strong>en</strong><br />
CD59 in PNH of van CD59 in aangebor<strong>en</strong> CD59-deficiëntie<br />
leid<strong>en</strong> tot complem<strong>en</strong>t hemolyse. Rode bloedcell<strong>en</strong> zoud<strong>en</strong><br />
deze eiwitt<strong>en</strong> kunn<strong>en</strong> verliez<strong>en</strong> door vesikelvorming.<br />
Methode: Rode bloedcell<strong>en</strong> van zes gezonde vrijwilligers<br />
word<strong>en</strong> gescheid<strong>en</strong> in vijf fracties van oplop<strong>en</strong>de celleeftijd<br />
(I-V) door e<strong>en</strong> combinatie van counterflowc<strong>en</strong>trifugatie <strong>en</strong><br />
dichtheidsscheiding. Met behulp van flowcytometrie is de gemiddelde<br />
fluoresc<strong>en</strong>tieint<strong>en</strong>siteit (MFI) van de binding van<br />
anti-CD55, anti-CD59 <strong>en</strong> anti-glycophorine A (anti-GPA; specifieke<br />
RBC-marker) aan rode bloedcell<strong>en</strong> gemet<strong>en</strong>. Als maat<br />
voor de gemiddelde celleeftijd van de fracties I - V is het perc<strong>en</strong>tage<br />
HbA1c gebruikt.<br />
Resultat<strong>en</strong>: 1) In fracties I tot V wordt e<strong>en</strong> oplop<strong>en</strong>d perc<strong>en</strong>tage<br />
HbA1c gevond<strong>en</strong>. 2) Voor glycophorine A wordt ge<strong>en</strong><br />
verandering in de MFI gevond<strong>en</strong>. 3) De MFI's van CD55 <strong>en</strong><br />
CD59 dal<strong>en</strong> met 11%, respectivelijk 8%.<br />
Conclusie: Het aantal molecul<strong>en</strong> CD55 <strong>en</strong> CD59 per cel nem<strong>en</strong><br />
af met het ouder word<strong>en</strong> van de rode bloedcel. Dit verlies<br />
van anti-complem<strong>en</strong>t eiwitt<strong>en</strong> speelt mogelijk e<strong>en</strong> rol bij het<br />
verdwijn<strong>en</strong> van de rode bloedcel.<br />
Rode HbA1c % MFI (% + SD, n=6)<br />
bloedcel<br />
fractie (% + SD, n=6) GPA CD55 CD59<br />
I 3,7 + 0,54 100 100 100<br />
II 4,5 + 0,34 102 + 4,2 96 + 3,7 96 + 2,3<br />
III 5,3 + 0,54 101 + 3,1 95 + 2,7 96 + 3,0<br />
IV 6,2 + 0,64 102 + 2,5 93 + 3,6 96 + 2,5<br />
V 6,7 + 0,59 102 + 3,6 89 + 1,8 92 + 2,8<br />
72 Ned Tijdschr Klin Chem 1998, vol. 23, no. 2
29. Enhanced sVCAM-1 levels in pediatric pati<strong>en</strong>ts with sickle cell disease<br />
J.B. SCHNOG 1 , C. de VRIES 1 , F.P.L. van der DIJS 2 , F.D. MUSKIET 3 , F.A.J. MUSKIET 4 and A.J. DUITS 1<br />
Red Cross Bloodbank Curaçao 1 ; Departm<strong>en</strong>t of Clinical Chemistry and Hematology, Public Health Laboratory, Curaçao 2 ; Departm<strong>en</strong>t<br />
of Pediatrics, St. Elisabeth Hospital, Curaçao 3 ; C<strong>en</strong>tral Laboratory for Clinical Chemistry, University Hospital Groning<strong>en</strong> 4<br />
Intricate adhesive interactions betwe<strong>en</strong> sickle (red) blood cells<br />
and activated <strong>en</strong>dothelium play a crucial role in the pathophysiology<br />
of sickle cell vasocclusion. Erythrocytes and<br />
leukocytes are thought to adhere to the vascular <strong>en</strong>dothelium,<br />
thereby impeding the microcirculation and increasing the<br />
transit-time of (sickled) erythrocytes, which ultimately results<br />
in vasoocclusion. We measured serum conc<strong>en</strong>trations of<br />
soluble vascular cell adhesion molecule-1 (sVCAM-1) and<br />
soluble intercellular adhesion molecule-1 (sICAM-1) in steady<br />
state pediatric sickle cell pati<strong>en</strong>ts. Serum levels of tissue<br />
necrosis factor-α (TNF-α), an <strong>en</strong>dothelial activating cytokine,<br />
were also measured. The study population consisted of 28<br />
pediatric pati<strong>en</strong>ts with sickle cell disease (15 HbSS, 13 HbSC;<br />
mean ± SD age 7.0 ± 3.7 years) and 16 healthy age, sex and<br />
race matched HbAA controls (5.6 ± 1.4 years). Serum<br />
sVCAM-1 levels were dramatically increased in sickle cell<br />
pati<strong>en</strong>ts (n=28; mean ± SD=1468+875 µg/l), as compared to<br />
Ned Tijdschr Klin Chem 1998, vol. 23, no. 2<br />
controls (n=16; 731+162 µg/l; p=0.002), whereas sICAM-1<br />
levels did not differ to a significant ext<strong>en</strong>t (24 pati<strong>en</strong>ts:<br />
574+149; 10 controls: 407+31 µg/l; p>0.05). Pati<strong>en</strong>ts also had<br />
significantly elevated serum TNF-α (n=9; 65+46 ng/l), compared<br />
with controls (n=10; 20+13 ng/l; p=0.01). The increased<br />
sVCAM-1 levels shown here are also reported for adult sickle<br />
cell pati<strong>en</strong>ts, and indicate <strong>en</strong>dothelial activation in clinically<br />
asymptomatics. As is the case in adult pati<strong>en</strong>ts this increm<strong>en</strong>t<br />
was specific, since sICAM-1 levels were comparable to controls.<br />
Several studies have shown VCAM-1 to be an important<br />
adhesion molecule involved in the pathological adhesion of<br />
sickle erythrocytes to the <strong>en</strong>dothelium. Our results therefore<br />
indicate that <strong>en</strong>dothelial activation, and perhaps vasoocclusion,<br />
already occurs at a very young age ev<strong>en</strong> wh<strong>en</strong> a pati<strong>en</strong>t is<br />
clinically pain-free. This activation is, at least in part, due to<br />
<strong>en</strong>dothelial activating cytokines, such as TNF-α.<br />
30. A new parameter for scre<strong>en</strong>ing on platelet dysfunction in subjects treated with haemodialysis<br />
P.C.M. BARTELS 1 , S.F. HEINE 1 , M. SCHOORL 1 and M.J. NUBE 2<br />
Departm<strong>en</strong>t of Clinical Chemistry, Hematology & Immunology 1 and Departm<strong>en</strong>t of Nephrology 2 , Medical C<strong>en</strong>tre Alkmaar, The<br />
Netherlands<br />
The Platelet Function Analyzer (PFA-100) has be<strong>en</strong><br />
designed for rapid in vitro evaluation of abnormal platelet<br />
function. The PFA-100 system is able to simulate conditions<br />
to which platelets are exposed in injured blood vessels.<br />
In this study Closure Times (CT) were measured in order to<br />
estimate the degree and variability of platelet aggregation in<br />
10 chronic haemodialysis (HD) pati<strong>en</strong>ts. Blood samples were<br />
tak<strong>en</strong> from the affer<strong>en</strong>t line at t=0, t=60 and t=150 minutes<br />
after the start of HD, respectively.<br />
At t=0 CT values (mean 178 ± 35 sec.) were significantly<br />
increased (p= 0.0004), if compared with a refer<strong>en</strong>ce group of<br />
appar<strong>en</strong>tly healthy donors (123 ± 15 sec.). Measurem<strong>en</strong>ts<br />
31. Pseudotrombocytop<strong>en</strong>ie nader bekek<strong>en</strong> I: Herk<strong>en</strong>ning<br />
P.C.M. BARTELS 1 , A.J.P.F. LOMBARTS 2 <strong>en</strong> M. SCHOORL 1<br />
Laboratoria van Medisch C<strong>en</strong>trum Alkmaar 1 <strong>en</strong> Ley<strong>en</strong>burg Ziek<strong>en</strong>huis, D<strong>en</strong> Haag 2<br />
Pseudotrombocytop<strong>en</strong>ie (PTCP) kan behalve door slechte<br />
antistolling ook veroorzaakt word<strong>en</strong> door anticoagulansgeïnduceerde<br />
trombocyt<strong>en</strong>aggregatie. Het niet herk<strong>en</strong>n<strong>en</strong> van<br />
PTCP als oorzaak van verlaagde trombocyt<strong>en</strong>conc<strong>en</strong>traties<br />
kan onnodig nader onderzoek <strong>en</strong> therapie t<strong>en</strong> gevolge hebb<strong>en</strong>,<br />
zelfs spl<strong>en</strong>ectomie is in het verled<strong>en</strong> beschrev<strong>en</strong>! Ook kan<br />
weg<strong>en</strong>s verme<strong>en</strong>de trombocytop<strong>en</strong>ie noodzakelijke therapie<br />
onthoud<strong>en</strong> of gestaakt word<strong>en</strong>.<br />
Het optred<strong>en</strong> van sam<strong>en</strong>klontering (aggregatie) van trombocyt<strong>en</strong><br />
wordt in bloedceltellers doorgaans automatisch gesignaleerd.<br />
De mate waarin sam<strong>en</strong>klontering van trombocyt<strong>en</strong><br />
optreedt is bepal<strong>en</strong>d voor de omvang van de gevormde<br />
aggregat<strong>en</strong>. De omvang is uiteraard van invloed op de posities<br />
in de histogramm<strong>en</strong> waar het f<strong>en</strong>ome<strong>en</strong> tot uiting kan kom<strong>en</strong>.<br />
De algoritm<strong>en</strong> die gebruikt word<strong>en</strong> voor bewerking van meetgegev<strong>en</strong>s<br />
alsmede de criteria waarop de discriminantfunctie<br />
gebaseerd is, zijn echter onbek<strong>en</strong>d. Di<strong>en</strong>t<strong>en</strong>gevolge kunn<strong>en</strong> er<br />
afwijking<strong>en</strong> bestaan in de gevoeligheid <strong>en</strong> de betrouwbaarheid<br />
van diverse apparat<strong>en</strong>. Aan de hand van voorbeeld<strong>en</strong> zal<br />
performed at t=60 and t=150 showed no further obvious<br />
deviations, if compared with t=0.<br />
Prolonged CT at t=0 in HD pati<strong>en</strong>ts may result from poor<br />
platelet function due to uremic toxins, a decreased amount of<br />
GPIb- and GPI-Ib/I-IIa receptors on the platelet membranes or<br />
late effects from previous anticoagulation treatm<strong>en</strong>t.<br />
In conclusion, scre<strong>en</strong>ing with the PFA-100TM system demonstrated<br />
impaired platelet function in most subjects already<br />
before starting HD. As significant changes were not observed<br />
during HD, the treatm<strong>en</strong>t itself is not considered to contribute<br />
to further aggravation or improvem<strong>en</strong>t of platelet dysfunction.<br />
word<strong>en</strong> getoond hoe PTCP gedetecteerd kan word<strong>en</strong> in 3 g<strong>en</strong>eraties<br />
Coulter Counters (SPLUS IV, STKS <strong>en</strong> G<strong>en</strong> S) <strong>en</strong> in<br />
de Sysmex NE 8000 (1-4).<br />
1. Lombarts AJPF, de Kieviet W. Recognition and Prev<strong>en</strong>tion of<br />
Pseudothrombocytop<strong>en</strong>ia and Concomitant Pseudoleukocytosis.<br />
Am J Clin Path 1988; 89: 634-639.<br />
2. Lombarts AJPF, de Kieviet W, Franck PFH, Baars JD. Recognition<br />
and Prev<strong>en</strong>tion of Two Cases of Erroneous Haemocytometry<br />
Counts Due to Platelet and White Blood Cell Aggregation. Eur J<br />
Clin Chem Clin Biochem 1992; 30: 429-432.<br />
3. Cárcamo C, Ferriz C, Martín P, Fernández-Castro M. Improvem<strong>en</strong>t<br />
in the diagnostic performance of the Coulter STKS. Lab<br />
Hematol 1997; 3: 264-270.<br />
4. Bartels PCM, Schoorl M, Lombarts AJPF. Scre<strong>en</strong>ing for EDTAdep<strong>en</strong>d<strong>en</strong>t<br />
deviations in platelet counts and abnormalities in<br />
platelet distribution histograms in pseudothrombocytop<strong>en</strong>ia. Scand<br />
J Clin Lab Invest 1997; 57: 629-636.<br />
73
32. Pseudotrombocytop<strong>en</strong>ie nader bekek<strong>en</strong> II: Kinetiek, vóórkom<strong>en</strong> <strong>en</strong> voorkóm<strong>en</strong><br />
A.J.P.F. LOMBARTS 1 , P.C.M. BARTELS 2 , M. SCHOORL 2 <strong>en</strong> W. de KIEVIET 3<br />
Laboratoria van Ley<strong>en</strong>burg Ziek<strong>en</strong>huis D<strong>en</strong> Haag 1 , Medisch C<strong>en</strong>trum Alkmaar 2 <strong>en</strong> St. Lucas/Andreas Ziek<strong>en</strong>huis Amsterdam 3<br />
Kinetiek. Pseudotrombocytop<strong>en</strong>ie (PTCP) is e<strong>en</strong> "in vitro"<br />
f<strong>en</strong>ome<strong>en</strong> dat optreedt t<strong>en</strong> gevolge van anticoagulans-geïnduceerde<br />
aggregatie van trombocyt<strong>en</strong> (PLT). E<strong>en</strong> belangrijk<br />
aspect van de aggregatie is de tijdsafhankelijkheid. Afhankelijk<br />
van het individuele monster <strong>en</strong> het gebruikte anticoagulans<br />
voltrekt de aggregatie zich geleidelijk in e<strong>en</strong> periode van<br />
5 - 90 minut<strong>en</strong> (1-3). Hiervan di<strong>en</strong>t m<strong>en</strong> zich bij evaluatie van<br />
de resultat<strong>en</strong> van vergelijk<strong>en</strong>de studies (inclusief microscopie)<br />
steeds terdege bewust te zijn.<br />
Vóórkom<strong>en</strong>. PTCP komt voor bij e<strong>en</strong> grote variëteit aan<br />
ziekt<strong>en</strong> zonder <strong>en</strong>ige specificiteit of klinische relevantie. Het<br />
verschijnsel kan plotseling optred<strong>en</strong> (4) <strong>en</strong> wek<strong>en</strong> tot maand<strong>en</strong><br />
aanhoud<strong>en</strong> (1). De beschrev<strong>en</strong> incid<strong>en</strong>tie varieert van 0,1% -<br />
2% (3). De grote variatie wordt mede veroorzaakt door de<br />
wissel<strong>en</strong>de mate van herk<strong>en</strong>ning, het tijdsgebond<strong>en</strong> karakter<br />
van het verschijnsel <strong>en</strong> het ontbrek<strong>en</strong> van e<strong>en</strong> e<strong>en</strong>sluid<strong>en</strong>de<br />
definitie.<br />
Voorkóm<strong>en</strong>. In e<strong>en</strong> vergelijk<strong>en</strong>de studie (1) werd door ons<br />
aangetoond dat EDTA-geïnduceerde PTCP het best voorkóm<strong>en</strong><br />
kan word<strong>en</strong> door bloedafname in ACD (zure citraatdextrose)<br />
te do<strong>en</strong> plaatsvind<strong>en</strong>. Citraat is minder effectief,<br />
33. Iron saturation of serum ferritin in haemochromatosis pati<strong>en</strong>ts during therapy<br />
In a rec<strong>en</strong>t paper (t<strong>en</strong> Kate et al., Eur J Clin Chem Clin<br />
Biochem 1997; 35: 53-6) we pres<strong>en</strong>ted a new method to<br />
measure the iron cont<strong>en</strong>t of ferritin and speculated on the usefulness<br />
of this method to establish the iron status in pati<strong>en</strong>ts<br />
suffering from anaemia of inflammation or haemochromatosis.<br />
This abstract deals with the last group of pati<strong>en</strong>ts.<br />
Hereditary haemochromatosis is an autosomal recessive disease.<br />
This condition is diagnosed on the basis of tranferrin saturation,<br />
serum ferritin and liver iron conc<strong>en</strong>tration. More rec<strong>en</strong>tly<br />
the diagnosis can be made on basis of mutation detection<br />
(Feder et al., Nature G<strong>en</strong>et 1996; 13: 399-408). Haemochromatosis<br />
is treated with regular phlebotomies. On basis of the<br />
ferritin conc<strong>en</strong>trations and the iron saturation of transferrin<br />
the therapy is followed.<br />
terwijl heparine het minst geschikt is. De getoonde herk<strong>en</strong>ningskarakteristiek<strong>en</strong><br />
bied<strong>en</strong> mogelijkhed<strong>en</strong> aan de gebruiker<br />
om te beoordel<strong>en</strong> "of" <strong>en</strong> zo ja in welke mate, PTCP door<br />
alternatieve anticoagulantia voorkóm<strong>en</strong> kan word<strong>en</strong> <strong>en</strong> in<br />
welke gevall<strong>en</strong> alsnog e<strong>en</strong> betrouwbare PLT-conc<strong>en</strong>tratie<br />
gemet<strong>en</strong> kan word<strong>en</strong> (1).<br />
1. Lombarts AJPF, de Kieviet W. Recognition and Prev<strong>en</strong>tion of<br />
Pseudothrombocytop<strong>en</strong>ia and Concomitant Pseudoleukocytosis.<br />
Am J Clin Path 1988; 89: 634-639.<br />
2. Lombarts AJPF, de Kieviet W, Franck PFH, Baars JD. Recognition<br />
and Prev<strong>en</strong>tion of Two Cases of Erroneous Haemocytometry<br />
Counts Due to Platelet and White Blood Cell Aggregation. Eur J<br />
Clin Chem Clin Biochem 1992; 30: 429-432.<br />
3. Bartels PCM, Schoorl M, Lombarts AJPF. Scre<strong>en</strong>ing for EDTAdep<strong>en</strong>d<strong>en</strong>t<br />
deviations in platelet counts and abnormalities in<br />
platelet distribution histograms in pseudothrombocytop<strong>en</strong>ia. Scand<br />
J Clin Lab Invest 1997; 57: 629-636.<br />
4. Gschwandtner ME, Siostrzonek P, Bodinger C, Neunteufl T, Zauner<br />
C, Heinz G, Maurer G, Panzer S. Docum<strong>en</strong>ted Sudd<strong>en</strong> onset of<br />
pseudothrombocytop<strong>en</strong>ia. Ann Hematol 1997; 74: 283-285.<br />
J. t<strong>en</strong> KATE 1 , K. MARELL 1 , R. HUIZENGA 3 , H. KREEFTENBERG 3 and C. van DEURSEN 2<br />
Depts. of Clinical Chemistry 1 and Internal Medicine 2 , De Wever & Gregorius Hospital, Heerl<strong>en</strong> and Brunssum, Dept. of Internal<br />
Medicine 3 , University Hospital, Groning<strong>en</strong>, the Netherlands<br />
34. Coating in vitro of erythrocytes with tamm horsfall-protein<br />
A method is described to coat isolated peripheral blood<br />
erythrocytes in vitro with Tamm-Horsfall Protein (THP, Uromodulin).<br />
Coating of erythrocytes with THP was accomplished<br />
by incubation of the cells in the pres<strong>en</strong>ce of THP,<br />
made monomeric by incubation in a high urea conc<strong>en</strong>tration.<br />
THP-coating of erythrocytes was dep<strong>en</strong>d<strong>en</strong>t on the THPconc<strong>en</strong>tration,<br />
maximal coating being obtained at a protein<br />
conc<strong>en</strong>tration ≥ 250 mg/mL. The best coating-results were<br />
obtained if during the coincubation of erythrocytes with THP<br />
urea was removed, while the sodium chloride conc<strong>en</strong>tration<br />
was increased up to a physiologic conc<strong>en</strong>tration by means of<br />
Serial serum samples from 8 haemochromatosis pati<strong>en</strong>ts<br />
during therapy were collected and stored in a freezer. These<br />
samples were used in this study after establishing the fact that<br />
the iron saturation of ferritin did not change during storage.<br />
As could be expected the serum ferritin conc<strong>en</strong>trations<br />
decreased in all pati<strong>en</strong>ts during the treatm<strong>en</strong>t. Surprisingly the<br />
iron saturation of ferritin remained fairly constant and appears<br />
to be more a characteristic of a giv<strong>en</strong> pati<strong>en</strong>t, than a measure<br />
of the succes of therapy.<br />
From these data we have to conclude that the measurem<strong>en</strong>t of<br />
the iron saturation of ferritin can not be used to follow<br />
therapy.<br />
P.M.W. JANSSENS 1 , S. KUIPER 1 , I.H. de VRIES 1 , J.L. WILLEMS 2 , I. KLASEN 2 , M. van OOSTERWIJK 1 and<br />
J. PAARDEKOOPER 1<br />
Klinisch Chemisch Laboratorium, Ziek<strong>en</strong>huis Rijnstate, Arnhem 1 <strong>en</strong> C<strong>en</strong>traal Klinisch Chemisch Laboratorium, AZN-St.Radboud,<br />
Nijmeg<strong>en</strong> 2<br />
dialysis. This alteration in chemical conditions promotes THPpolymerisation.<br />
Erythrocytes coated in this way could be<br />
preserved for at least 5 weeks in preserving solution, making<br />
them an interesting source of testing and control material.<br />
Coating of erythrocytes with THP could also be accomplished<br />
under conditions in which THP was preserved in a monomeric<br />
form, which suggests that peripheral blood erythrocytes have<br />
bindingsites for THP.<br />
Ref. Janss<strong>en</strong>s et al. Clin Chim Acta 1997; 258: 179-192.<br />
74 Ned Tijdschr Klin Chem 1998, vol. 23, no. 2
35. Verschuiving<strong>en</strong> in het bloedtransfusiebeleid in de ziek<strong>en</strong>huiz<strong>en</strong> in Noord Holland (exclusief het Gooi) <strong>en</strong> Almere<br />
J.P.M.C. GORGELS 1 <strong>en</strong> M.H. HERRUER 2<br />
K<strong>en</strong>nemer Gasthuis 1 <strong>en</strong> Spaarne Ziek<strong>en</strong>huis 2 , Haarlem<br />
Sinds 1983 bestaan er richtlijn<strong>en</strong> voor bloedtransfusie in ons<br />
land.<br />
In e<strong>en</strong> <strong>en</strong>quête naar het in de ziek<strong>en</strong>huiz<strong>en</strong> gevoerde beleid is<br />
in 1995 -ondanks de bestaande richtlijn<strong>en</strong>- e<strong>en</strong> grote variatie<br />
in beleid geconstateerd (Buiting <strong>en</strong> Dinkelaar, NTvG, 1998).<br />
In oktober 1995 is e<strong>en</strong> rapport over de organisatorische aspect<strong>en</strong><br />
van het "Bloedtransfusiebeleid in Ziek<strong>en</strong>huiz<strong>en</strong>" gepubliceerd<br />
door het College voor de Bloedtransfusie. In juni 1996 is<br />
onder auspiciën van het CBO e<strong>en</strong> cons<strong>en</strong>susbije<strong>en</strong>komst georganiseerd<br />
waarvan het resultaat is vastgelegd in het rapport<br />
"Tweede Herzi<strong>en</strong>ing Cons<strong>en</strong>sus Bloedtransfusiebeleid (in het<br />
bijzonder van erytrocyt<strong>en</strong>)" (van Ak<strong>en</strong>, Dinkelaar, Gorgels,<br />
Knape, van Everding<strong>en</strong>, NTvG 1998).<br />
Om na te gaan in hoeverre na de cons<strong>en</strong>susbije<strong>en</strong>komst <strong>en</strong> het<br />
verschijn<strong>en</strong> van de beide g<strong>en</strong>oemde rapport<strong>en</strong> het bloedtransfusiebeleid<br />
in de ziek<strong>en</strong>huiz<strong>en</strong> is veranderd hebb<strong>en</strong> wij de in<br />
1995 gehoud<strong>en</strong> <strong>en</strong>quête in december 1997 herhaald in de<br />
provincie Noord-Holland, exclusief het Gooi, <strong>en</strong> inclusief<br />
Almere. In 1995 nam<strong>en</strong> 16 van 18 aangeschrev<strong>en</strong> ziek<strong>en</strong>huiz<strong>en</strong><br />
deel aan de <strong>en</strong>quête. In 1997 war<strong>en</strong> dat er 16 van 17.<br />
De meest in het oog spring<strong>en</strong>de resultat<strong>en</strong> war<strong>en</strong> de volg<strong>en</strong>de.<br />
In 1995 had 80% van de ziek<strong>en</strong>huiz<strong>en</strong> in onze regio e<strong>en</strong> bloedtransfusiecommissie<br />
(landelijk 83%), in 1997 was dat 100%.<br />
De vergaderfrequ<strong>en</strong>tie daarvan lijkt overig<strong>en</strong>s afg<strong>en</strong>om<strong>en</strong> te<br />
zijn: in 1995 vergaderde slechts 8%
Stolling<br />
37. Evaluation of Dade-Behring coagulation analyser BCS<br />
P.C.M. BARTELS and M. SCHOORL<br />
Departm<strong>en</strong>t of Clinical Chemistry, Hematology& Immunology, Medical C<strong>en</strong>tre Alkmaar, The Netherlands<br />
Analytical performance characteristics concerning accuracy,<br />
precision and carry over were established for the Behring<br />
Coagulation Analyser (BCS). Results from analyses performed<br />
in a routine setting were compared with those obtained by<br />
the Coagulation Analyser ACL-3000.<br />
Samples from 200 subjects treated with anticoagulant therapy<br />
were selected for comparison purposes. If compared with<br />
ACL-3000 results increased BCS results for PTT are measured<br />
for samples in the range exceeding 20 seconds. The<br />
same consideration is valid for higher INR values. No bias is<br />
demonstrated after comparison results obtained for APTT and<br />
derived fibrinog<strong>en</strong> analyses on both analysers.<br />
Carry over was estimated to be insignificant for PT and APTT<br />
test <strong>methodologie</strong>s. Experim<strong>en</strong>ts concerning reproducibility<br />
yielded appropriate results for PT, APTT and fibrinog<strong>en</strong><br />
according to the manufacturer's specifications.<br />
With regard to stability it is an advantage that reag<strong>en</strong>ts are<br />
stored refrigerated on the analyser. If compared with manual<br />
test procedures main advantages from automation combined<br />
with 'random access' facilities are rapidity and precision, less<br />
sample volume requirem<strong>en</strong>t and labor saving b<strong>en</strong>efits. In<br />
particular wh<strong>en</strong> dealing with frequ<strong>en</strong>t batches comprising only<br />
few analyses substantial savings with regard to reag<strong>en</strong>ts and<br />
refer<strong>en</strong>ce materials can be realized in practice. After a thorough<br />
instruction period reduction of operator's time needed for<br />
processing of analyses amounting to 50% can be performed.<br />
38. Het effect van NSAID’s op de trombocyt<strong>en</strong>functie gemet<strong>en</strong> met de PFA-100 bij gezonde vrijwilligers<br />
M. de METZ 1 , A. de MEIJER 2 , H. VOLLAARD 3 <strong>en</strong> B. VERBRUGGEN 4<br />
Klinisch Chemisch Laboratorium 1 , Afdeling Interne G<strong>en</strong>eeskunde 2 <strong>en</strong> <strong>Klinische</strong>Farmacie 3 , Canisius Wilhelmina Ziek<strong>en</strong>huis, C<strong>en</strong>traal<br />
Hematologisch Laboratorium 4 , Academisch Ziek<strong>en</strong>huis Nijmeg<strong>en</strong><br />
In de PFA-100 analyzer van de firma Dade wordt citraat<br />
gebufferd volbloed door e<strong>en</strong> gaatje in e<strong>en</strong> membraan gezog<strong>en</strong>,<br />
die geïmpregneerd is met collage<strong>en</strong> <strong>en</strong> adr<strong>en</strong>aline of collage<strong>en</strong><br />
<strong>en</strong> ADP. De geactiveerde trombocyt<strong>en</strong> zull<strong>en</strong> het gaatje na<br />
verloop van tijd dicht<strong>en</strong> <strong>en</strong> deze sluitingstijd wordt geregistreerd.<br />
Wij hebb<strong>en</strong> het effect van indomethacine <strong>en</strong><br />
meloxicam op de sluitingstijd onderzocht. Meloxicam remt de<br />
prostacycline synthese in ontstekingsgebied<strong>en</strong> (cycloöxyg<strong>en</strong>ase-2).<br />
Indomethacine remt ook de cycloöxyg<strong>en</strong>ase-1 in<br />
trombocyt<strong>en</strong> <strong>en</strong> dus de aggregatie.<br />
Het betrof e<strong>en</strong> gerandomiseerde cross-over studie bij 15 gezonde<br />
vrijwilligers die begonn<strong>en</strong> met meloxicam (15 mg per<br />
dag gedur<strong>en</strong>de 7 dag<strong>en</strong>) of indomethacine (3 x 25 mg per dag<br />
gedur<strong>en</strong>de 3 dag<strong>en</strong>). Hierna volgde e<strong>en</strong> periode van 14 dag<strong>en</strong><br />
zonder medicatie <strong>en</strong> vervolg<strong>en</strong>s werd de andere NSAID ing<strong>en</strong>om<strong>en</strong>.<br />
Uitgangswaard<strong>en</strong> werd<strong>en</strong> verkreg<strong>en</strong> op dag 1 <strong>en</strong> dag<br />
14. Bloed werd verder 2 uur na de laatste inname van meloxicam<br />
of indomethacine afg<strong>en</strong>om<strong>en</strong>. Aggregatie in volbloed met<br />
0,35 mMol/l arachidonzuur gaf bij alle proefperson<strong>en</strong> e<strong>en</strong><br />
Toxicologie<br />
39. Degradation of neurofilam<strong>en</strong>ts after incubation with 2,5- hexanedione<br />
n-Hexane may cause peripheral neuropathy via the metabolite<br />
2,5-hexanedione (2,5-HD). The most characterizing morphological<br />
features are swellings of the preterminal axon containing<br />
aggregates of neurofilam<strong>en</strong>ts (NFs). It has be<strong>en</strong><br />
proposed that direct binding of 2,5-HD to the NF proteins,<br />
followed by coval<strong>en</strong>t crosslinking of the NF proteins, are<br />
implicated in the pathomechanism of 2,5-HD-induced neurotoxicity.<br />
How these molecular interactions ev<strong>en</strong>tually cause<br />
accumulation of NFs is unclear as yet. In this study we investigated<br />
whether 2,5-HD affects calpain-mediated degradation of<br />
NF proteins. Neuroblastoma cells SK-N-SH were exposed to<br />
10 mM 2,5-HD for 3 days, a conc<strong>en</strong>tration shown to induce<br />
volledige remming na indomethacine, terwijl meloxicam ge<strong>en</strong><br />
effect had op de aggregatie.<br />
De uitgangswaard<strong>en</strong> voor de sluitingstijd bedroeg<strong>en</strong> 89 - 180<br />
sec (gem 127, sd 26) <strong>en</strong> 73 - 110 sec (gem 94, sd 11) na<br />
activatie met respectievelijk collage<strong>en</strong>/adr<strong>en</strong>aline <strong>en</strong> collage<strong>en</strong>/ADP.<br />
Er was ge<strong>en</strong> verschil tuss<strong>en</strong> dag 1 <strong>en</strong> 14. De SD<br />
van de duplo voor de meting op dag 1 <strong>en</strong> 14 bedroeg 11 %. Na<br />
indomethacine lag de sluitingstijd met collage<strong>en</strong>/adr<strong>en</strong>aline<br />
buit<strong>en</strong> het meetgebied voor 14 person<strong>en</strong> (>300 sec) <strong>en</strong> bij 1<br />
persoon steeg de waarde van 112 naar 251 sec. Na meloxicam<br />
was de sluitingstijd met collage<strong>en</strong>/adr<strong>en</strong>aline 98 - 204 sec<br />
(gem 141, sd 33), waarbij net ge<strong>en</strong> significante verandering<br />
was waar te nem<strong>en</strong> t.o.v. de uitganswaarde (tweezijdig gepaarde<br />
T-toets, P = 0,07). De activatie met collage<strong>en</strong>/ADP<br />
werd niet beïnvloed door de NSAID’s, ev<strong>en</strong>min als door<br />
acetylsalicylzuur. Bij gebruik van collage<strong>en</strong>/adr<strong>en</strong>aline is de<br />
PFA-100 e<strong>en</strong> gevoelige methode om de remming van<br />
cycloöxyg<strong>en</strong>ase-1 door NSAID’s in trombocyt<strong>en</strong> te met<strong>en</strong>.<br />
E. HEIJINK 1 , S.W. SCHOLTEN 1 , P.A. BOLHUIS 2 and F.A. de WOLFF 1,3<br />
Coronel Institute, Div. of Human Toxicology 1 and Dept of Experim<strong>en</strong>tal Neurology, Academic Medical C<strong>en</strong>ter 2 , Amsterdam and<br />
Toxicology Laboratory, Leid<strong>en</strong> University Medical C<strong>en</strong>tre 3 , Leid<strong>en</strong><br />
NF accumulation in the cells. Subsequ<strong>en</strong>tly, NF were isolated<br />
and degraded in vitro by calpain. SDS-PAGE and immunoblotting<br />
revealed crosslinked NF proteins. The degradation<br />
rates of NF and crosslinked NF from exposed cells were id<strong>en</strong>tical<br />
to the rates of NF from control cells. Pulse-chase studies<br />
were set up to further examine intracellular NF-metabolism.<br />
The results suggest that 72 hrs after pulse-labeling of cells<br />
with [ 35 S]-methionine, labeled NF proteins had disappeared<br />
from 5 mM 2,5-HD-exposed cells in a similar rate as from<br />
non-exposed cells. Together, these results indicate that 2,5-HD<br />
does not interfere with the degradation of NF proteins.<br />
76 Ned Tijdschr Klin Chem 1998, vol. 23, no. 2
G<strong>en</strong>eesmiddel<strong>en</strong>; pharmakinetica; vitamines<br />
40. Snel g<strong>en</strong>eesmiddelmetabolisme : detectie van CYP2D6 g<strong>en</strong> duplicatie<br />
L.S.W. STEIJNS <strong>en</strong> J. van der WEIDE<br />
Klinisch Chemisch Laboratorium, Psychiatrisch Ziek<strong>en</strong>huis Veldwijk, Ermelo<br />
Het <strong>en</strong>zym CYP2D6 is betrokk<strong>en</strong> bij het oxidatief metabolisme<br />
van e<strong>en</strong> groot aantal g<strong>en</strong>eesmiddel<strong>en</strong>, waaronder vele<br />
psychofarmaca. De activiteit van het <strong>en</strong>zym is vanwege e<strong>en</strong><br />
g<strong>en</strong>etisch polymorfisme individueel bepaald. Dit leidt tot<br />
interindividuele variatie in metabole capaciteit: er kan onderscheid<br />
gemaakt word<strong>en</strong> tuss<strong>en</strong> trage, normale <strong>en</strong> snelle metaboliseerders.<br />
Bij 5 tot 10% van de Kaukasische populatie verloopt het<br />
CYP2D6-afhankelijke g<strong>en</strong>eesmiddelmetabolisme als gevolg<br />
van deficiëntie-veroorzak<strong>en</strong>de mutaties op het CYP2D6 g<strong>en</strong><br />
uiterst traag. Hierdoor kan de serumconc<strong>en</strong>tratie van psychofarmaca<br />
bij standaarddosering hoog oplop<strong>en</strong>, waardoor het<br />
risico op bijwerking<strong>en</strong> sterk to<strong>en</strong>eemt <strong>en</strong> de compliance afneemt.<br />
Extreem snel metabolisme komt voor bij 2 tot 7% van<br />
de Kaukasiërs. Dit wordt veroorzaakt door e<strong>en</strong> CYP2D6 g<strong>en</strong><br />
duplicatie, waardoor de <strong>en</strong>zymexpressie verhoogd is. Bij deze<br />
snelle metaboliseerders blijft bij standaarddosering de serumconc<strong>en</strong>tratie<br />
over het algeme<strong>en</strong> subtherapeutisch. Hierdoor<br />
slaat de therapie niet aan <strong>en</strong> wordt e<strong>en</strong> patiënt van noncompliance<br />
verdacht.<br />
41. Plasma folic acid cut-off value, as derived from its relation with homocysteine<br />
We established the cut-off value for plasma folic acid, using<br />
plasma homocysteine as functional marker. For this we investigated<br />
the relations of the plasma folic acid of 103 appar<strong>en</strong>tly<br />
healthy adults with their fasting plasma homocysteine, and<br />
with their plasma homocysteine 6 h after a standard oral gift of<br />
methionine (100 mg/kg). We also studied the relation of their<br />
plasma folic acid with the decline of fasting plasma homocysteine,<br />
following 7 days folic acid supplem<strong>en</strong>tation (5 mg/day).<br />
Ned Tijdschr Klin Chem 1998, vol. 23, no. 2<br />
Door trage <strong>en</strong> snelle metaboliseerders vòòr aanvang van farmacotherapie<br />
te id<strong>en</strong>tificer<strong>en</strong>, kunn<strong>en</strong> de keuze van psychofarmaca<br />
<strong>en</strong> de dosering van begin af aan zodanig word<strong>en</strong> aangepast,<br />
dat de kans op e<strong>en</strong> positief klinisch effect maximaal is.<br />
Op PCR gebaseerde tests voor het opspor<strong>en</strong> van traag g<strong>en</strong>eesmiddelmetabolisme<br />
word<strong>en</strong> in ons ziek<strong>en</strong>huis sinds 1 1 /2 jaar<br />
routinematig toegepast. PCR-assays voor de detectie van snel<br />
metabolisme als gevolg van CYP2D6 g<strong>en</strong>duplicatie zijn rec<strong>en</strong>telijk<br />
ontwikkeld. Hierbij wordt gescre<strong>en</strong>d op PCR fragm<strong>en</strong>t<strong>en</strong><br />
die alle<strong>en</strong> bestaan als er sprake is van meer dan één CYP2D6<br />
g<strong>en</strong> per allel. De methode is betrouwbaar. Positieve <strong>en</strong> negatieve<br />
controles zijn ingebouwd <strong>en</strong> bij heterozygot<strong>en</strong> wordt<br />
nagegaan of de duplicatie zich op het wildtype dan wel op het<br />
mutant allel bevindt. De test is relatief e<strong>en</strong>voudig <strong>en</strong> snel uitvoerbaar.<br />
Bij scre<strong>en</strong>ing in ons ziek<strong>en</strong>huis in e<strong>en</strong> groep van 202<br />
psychiatrische patiënt<strong>en</strong> bleek de preval<strong>en</strong>tie van snel g<strong>en</strong>eesmiddelmetabolisme<br />
als gevolg van CYP2D6 g<strong>en</strong>duplicatie<br />
3,5% te zijn.<br />
Op de poster zal de methode word<strong>en</strong> besprok<strong>en</strong> <strong>en</strong> zull<strong>en</strong> de<br />
resultat<strong>en</strong> word<strong>en</strong> bediscussiëerd.<br />
D.A.J. BROUWER 1 , H.T.M.E. WELTEN 1 , D.-J. REIJNGOUD 2 , J.J. van DOORMAAL 3 and F.A.J. MUSKIET 1<br />
C<strong>en</strong>tral Laboratory for Clinical Chemistry 1 , Laboratory for Metabolic Disorders 2 , Atherosclerosis & Lipid Outpati<strong>en</strong>t Clinics 3 ,<br />
Groning<strong>en</strong> University Hospital<br />
42. Moet de aanbevol<strong>en</strong> dagelijkse hoeveelheid van foliumzuur word<strong>en</strong> verhoogd?<br />
Hyperhomocysteïnemie is e<strong>en</strong> onafhankelijk risicofactor voor<br />
premature atherosclerose. Plasma homocysteïne spiegels zijn<br />
afhankelijk van g<strong>en</strong>etische- <strong>en</strong> voedingsfactor<strong>en</strong>. Wij onderzocht<strong>en</strong><br />
het effect van e<strong>en</strong> kort-dur<strong>en</strong>de suppletie van vitamine<br />
B6 (1 mg/kg/dag; 7 dag<strong>en</strong>) <strong>en</strong> aansluit<strong>en</strong>d foliumzuur (5 mg/<br />
dag; 7 dag<strong>en</strong>) op het nuchtere plasma homocysteïne van 103<br />
og<strong>en</strong>schijnlijk gezonde Nederlanders van 20-75 jaar. Bij de<br />
aanvang van de studie lag<strong>en</strong> de foliumzuurconc<strong>en</strong>traties van<br />
alle deelnemers bov<strong>en</strong> de ondergr<strong>en</strong>s van het refer<strong>en</strong>tie gebied.<br />
De vitamine B6 <strong>en</strong> vitamine B12 conc<strong>en</strong>traties war<strong>en</strong><br />
verlaagd bij respectievelijk 8 <strong>en</strong> 2 van h<strong>en</strong>. Op dat mom<strong>en</strong>t<br />
bleek het plasma homocysteïne invers gerelateerd te zijn aan<br />
de plasma spiegels van foliumzuur <strong>en</strong> vitamine B12. Het<br />
gemiddelde plasma homocysteïne veranderde niet vanwege<br />
de vitamine B6 suppletie. Slechts één deelnemer vertoonde in<br />
The three approaches suggested a cut-off value of 10 nmol/l.<br />
The 10 nmol/l cut-off value was objectified by defining the<br />
plasma folic acid cut-off value as the conc<strong>en</strong>tration at, or<br />
below, which an individual has a significantly higher chance<br />
to lower its plasma homocysteine following folic acid supplem<strong>en</strong>tation,<br />
compared with the chance to exhibit such a<br />
decrease wh<strong>en</strong> the plasma folic acid conc<strong>en</strong>tration exceeds<br />
this level (odds ratio: 5.02; 95% CI 1.87-13.73).<br />
D.A.J. BROUWER 1 , H.T.M.E. WELTEN 1 , J.J. van DOORMAAL 2 , D.-J. REIJNGOUD 3 and F.A.J. MUSKIET 1<br />
C<strong>en</strong>traal Klinisch Chemisch Laboratorium 1 , Atherosclerose Lipid<strong>en</strong> Polikliniek 2 , Laboratorium voor Metabole Ziekt<strong>en</strong> 3 , Universiteit<br />
<strong>en</strong> Academisch Ziek<strong>en</strong>huis Groning<strong>en</strong><br />
die periode e<strong>en</strong> significante plasma homocysteïne daling. Na<br />
foliumzuur suppletie daalde het plasma homocysteïne van<br />
11,7±5,6 naar 9,1±3,4 µmol/l (gemiddelde±SD; p
Moleculaire Biologie<br />
43. Kwantificer<strong>en</strong> van Vascular Endothelial Growth Factor mRNA<br />
P.T.J. MARX, A.B. MULDER, C. HAANEN <strong>en</strong> I.VERMES<br />
Klinisch Chemisch Laboratorium, Medisch Spectrum Tw<strong>en</strong>te, Enschede<br />
Het kwantificer<strong>en</strong> van mRNA middels e<strong>en</strong> RT-PCR is e<strong>en</strong> bek<strong>en</strong>d<br />
methodisch probleem. In het kader van het onderzoek<br />
"Endotheelfunctie bij Diabetes mellitus" werd e<strong>en</strong> methode<br />
ontwikkeld voor het kwantitatief bepal<strong>en</strong> van Vascular Endothelial<br />
Growth Factor (VEGF) mRNA met behulp van e<strong>en</strong><br />
competitieve RT-PCR.<br />
In het kort wordt de methode als volgt uitgevoerd. Het RNA<br />
wordt met behulp van e<strong>en</strong> Reverse Transcriptase (RT) omgezet<br />
tot cDNA. Vervolg<strong>en</strong>s wordt het cDNA geamplificeerd<br />
met behulp van TAQ-polymerase. E<strong>en</strong> nadeel van deze amplificatiestap<br />
is het feit dat uit de hoeveelheid geproduceerd<br />
DNA niet af te leid<strong>en</strong> is hoeveel DNA er oorspronkelijk aanwezig<br />
was. Om deze tekortkoming te omzeil<strong>en</strong>, wordt er aan<br />
het RNA e<strong>en</strong> interne standaard toegevoegd. De basevolgorde<br />
van de RNA-standaard komt overe<strong>en</strong> met die van het te bepal<strong>en</strong><br />
VEGF mRNA, afgezi<strong>en</strong> van e<strong>en</strong> deletie van 100 basepar<strong>en</strong>.<br />
De standaard wordt in e<strong>en</strong> bek<strong>en</strong>de conc<strong>en</strong>tratie reeks<br />
aan de monsters toegevoegd. De hoeveelheid PCR product van<br />
standaard <strong>en</strong> van monster word<strong>en</strong> na elektroforese bepaald<br />
mbv e<strong>en</strong> CCD-camera <strong>en</strong> software.<br />
Het verband tuss<strong>en</strong> de hoeveelheid toegevoegde standaard <strong>en</strong><br />
de verhouding<strong>en</strong> van de hoeveelheid PCR-product van de<br />
standaard <strong>en</strong> het monster vormt e<strong>en</strong> ijklijn, waaruit m.b.v.<br />
logaritmische regressie de oorspronkelijke hoeveelheid mRNA<br />
is te herleid<strong>en</strong>.<br />
Er zijn maatregel<strong>en</strong> g<strong>en</strong>om<strong>en</strong> om veel voorkom<strong>en</strong>de fout<strong>en</strong> te<br />
vermijd<strong>en</strong>. De RNA-standaard werd vóór de RT-reactie aan het<br />
monster toegevoegd, waardoor latere pipeteerfout<strong>en</strong> of inefficiënte<br />
<strong>en</strong>zymreacties ge<strong>en</strong> invloed op de verhouding tuss<strong>en</strong> de<br />
hoeveelheid monster <strong>en</strong> standaard kunn<strong>en</strong> hebb<strong>en</strong>. De ijklijn<br />
heeft e<strong>en</strong> richtingscoëfficiënt gelijk aan één, alle<strong>en</strong> dan geldt<br />
dat de reactie-omstandighed<strong>en</strong> voor standaard <strong>en</strong> monster overe<strong>en</strong>kom<strong>en</strong>.<br />
En e<strong>en</strong> cruciale stap bij de detectie is het mak<strong>en</strong> van<br />
opnames die in het lineaire gebied van de camera ligg<strong>en</strong>.<br />
De methode bleek na validatie betrouwbaar <strong>en</strong> reproduceerbaar.<br />
44. Opzett<strong>en</strong> van kwantitatieve RT-PCR voor de meting van mucine-1 g<strong>en</strong> expressie m.b.v homologe interne<br />
standaard<br />
M.A.M. BON, F.A.J.T.M van d<strong>en</strong> BERGH <strong>en</strong> I. VERMES<br />
Klinisch Chemisch Laboratorium, Medisch Spectrum Tw<strong>en</strong>te, Enschede<br />
Uit eig<strong>en</strong>, eerdere resultat<strong>en</strong> <strong>en</strong> ook uit de literatuur is geblek<strong>en</strong><br />
dat ieder individu e<strong>en</strong> lage Muc-1 achtergrond g<strong>en</strong><br />
expressie bij zich draagt als de detectie techniek maar gevoelig<br />
g<strong>en</strong>oeg is. Dit impliceert dat de RT-PCR reacties gekwantificeerd<br />
di<strong>en</strong><strong>en</strong> te word<strong>en</strong>.<br />
In e<strong>en</strong> kwantitative RT-PCR di<strong>en</strong>t gebruik gemaakt te word<strong>en</strong><br />
van e<strong>en</strong> exog<strong>en</strong>e interne homologe controle. Dit houdt in dat<br />
er gewerkt moet word<strong>en</strong> met e<strong>en</strong> controle die toegevoegd<br />
wordt aan het template (exoge<strong>en</strong>, intern) in e<strong>en</strong> bek<strong>en</strong>de hoeveelheid.<br />
Vervolg<strong>en</strong>s di<strong>en</strong>t deze controle homoloog te zijn aan<br />
het template, d.w.z dat er in de PCR gebruik gemaakt kan<br />
word<strong>en</strong> van dezelfde primers. De reactie is dan verzekerd van<br />
dezelfde thermodynamica <strong>en</strong> dus dezelfde amplificatie-effici<strong>en</strong>tie.<br />
Deze homologe interne standaard wordt als volgt bereid:<br />
na RNA-isolatie wordt er cDNA gesynthetiseerd m.b.v<br />
de specifieke priming methode. Deze eerste specifieke primer<br />
heeft e<strong>en</strong> modificatie ondergaan, er wordt n.l e<strong>en</strong> ‘loop’ gecreëerd<br />
doordat 25 bas<strong>en</strong> complem<strong>en</strong>tair zijn aan het RNA,<br />
vervolg<strong>en</strong>s word<strong>en</strong> er 80 bas<strong>en</strong> overgeslag<strong>en</strong> (loop) <strong>en</strong> hierna<br />
zijn weer 20 bas<strong>en</strong> complem<strong>en</strong>tair aan het RNA. In de PCR<br />
bevat de tweede primer e<strong>en</strong> T7-sequ<strong>en</strong>tie. Het fragm<strong>en</strong>t dat nu<br />
ontstaat is 80 bas<strong>en</strong> korter dan het doelwit-fragm<strong>en</strong>t <strong>en</strong> bevat<br />
e<strong>en</strong> T7-sequ<strong>en</strong>tie. Dit product wordt opgezuiverd <strong>en</strong> vervol-<br />
g<strong>en</strong>s m.b.v e<strong>en</strong> T7-RNA-polymerase getranscribeerd tot RNA.<br />
Het uiteindelijke product is e<strong>en</strong> RNA-competitieve refer<strong>en</strong>tie<br />
standaard (RNACRS). Van deze RNACRS wordt de opbr<strong>en</strong>gst<br />
<strong>en</strong> zuiverheid gemet<strong>en</strong> <strong>en</strong> vervolg<strong>en</strong>s in verdunningsreeks toegevoegd<br />
aan het pati<strong>en</strong>t<strong>en</strong>-RNA. De detectie van de twee product<strong>en</strong><br />
kan op twee manier<strong>en</strong> geschied<strong>en</strong>:<br />
- Het scann<strong>en</strong> van de ontstane product<strong>en</strong> na elektroforese.<br />
Uit de verhouding tuss<strong>en</strong> de RNACRS <strong>en</strong> pati<strong>en</strong>t<strong>en</strong>-RNA<br />
kan vervolg<strong>en</strong>s m.b.v d<strong>en</strong>sitometrie de aanwezige hoeveelheid<br />
pati<strong>en</strong>t<strong>en</strong>-RNA semi-kwantitatief berek<strong>en</strong>d word<strong>en</strong>.<br />
- M.b.v e<strong>en</strong> PCR-ELISA. De PCR wordt uitgevoerd m.b.v<br />
digoxig<strong>en</strong>ine gelabelde nucleotides. Het PCR-product<br />
wordt random gelabeld. Vervolg<strong>en</strong>s wordt er onderscheid<br />
gemaakt m.b.v e<strong>en</strong> hybridisatie met twee <strong>bio</strong>tine-gelabelde<br />
probes tuss<strong>en</strong> 100% (RNACRS + pati<strong>en</strong>t<strong>en</strong>-RNA) <strong>en</strong> patiënt<strong>en</strong>-RNA.<br />
De probes sam<strong>en</strong> met het specifieke target<br />
word<strong>en</strong> weggevang<strong>en</strong> op e<strong>en</strong> vaste fase (microtiterplaat gecoat<br />
met streptavidine) <strong>en</strong> via anti-DIG-horse-POD wordt<br />
het specifieke product gekleurd <strong>en</strong> kan de extinctie gemet<strong>en</strong><br />
word<strong>en</strong> in e<strong>en</strong> ELISA-reader. Vervolg<strong>en</strong>s 100% - pati<strong>en</strong>t<strong>en</strong>-RNA=<br />
RNACRS. Deze standaard is in e<strong>en</strong> bek<strong>en</strong>de<br />
hoeveelheid toegevoegd <strong>en</strong> nu kan middels berek<strong>en</strong>ing de<br />
hoeveelheid pati<strong>en</strong>t<strong>en</strong>-RNA vastgesteld word<strong>en</strong>.<br />
45. A simple PCR scre<strong>en</strong>ing method for the pres<strong>en</strong>ce of the alpha-spectrin low-expression allele α LELY<br />
M.M.M. SALIMANS, G. de KORT, J. POSTMA, A. SPAANS and P.F.H. FRANCK<br />
Departm<strong>en</strong>t of Clinical Chemistry, Ley<strong>en</strong>burg Hospital, The Hague, The Netherlands<br />
Hereditary elliptocytosis (HE) and its aggrivated form hereditary<br />
pyropoikilocytosis (HPP) are cong<strong>en</strong>ital hemolytic<br />
anaemias. The responsible mutations lie in several g<strong>en</strong>es<br />
<strong>en</strong>coding proteins of the red cell membrane skeleton. In particular,<br />
they involve the SPTA1 g<strong>en</strong>e, that <strong>en</strong>codes the ery-<br />
throid protein α-spectrin, a major protein of the membrane<br />
skeleton.<br />
One of these mutations in the SPTA1 g<strong>en</strong>e, allele α LELY<br />
(LELY: Low Expression LYon) is widespread, repres<strong>en</strong>ting<br />
approximately one third of all α-alleles, and remains asympto-<br />
78 Ned Tijdschr Klin Chem 1998, vol. 23, no. 2
matic both in the heterozygous and the homozygous state. The<br />
pres<strong>en</strong>ce of allele α LELY allows the expanded expression of<br />
any mutated HE α-allele located in trans and results in severe<br />
HE or in HPP.<br />
Allele α LELY contains three mutations in exon 40, intron 45<br />
and intron 46 respectively, the latter change is not specific.<br />
These mutations result in the skipping of 50% of α LELY<br />
transcripts and thus protein products, which explains the<br />
designation "Low Expression". However, since a combination<br />
Apolipoprotein E (apo-E) plays a c<strong>en</strong>tral role in the clearance<br />
of lipoprotein remnants, by serving as a ligand for the LDLand<br />
apo-E receptors. Three common alleles (apo-e2, e3 and<br />
e4) give rise to 6 ph<strong>en</strong>otypes. Apo-E3 is the ancestral form.<br />
The apo-E2 and apo-E4 isoforms are associated with increased<br />
CAD risk: 1-10% of subjects with apo-E2/E2 develop familial<br />
dysbetalipoproteinaemia, whereas apo-E4 is associated with<br />
increased LDL-cholesterol. We observed a persist<strong>en</strong>t, unexplained,<br />
discrepancy betwe<strong>en</strong> the outcomes of two differ<strong>en</strong>t<br />
apo-E g<strong>en</strong>otyping methods, in a sample from a pati<strong>en</strong>t with<br />
clinical and laboratory features of familial dysbetalipoproteinaemia.<br />
PCR, followed by restriction isotyping<br />
according to Hixson and Vernier, resulted in the apo-E2/E2<br />
g<strong>en</strong>otype. A commercially available kit (Sangtec, Bromma,<br />
Swed<strong>en</strong>), based on a minisequ<strong>en</strong>ce method, indicated the<br />
apo-E2/E3 g<strong>en</strong>otype. We hypothesised that the discrepancy<br />
resulted either from an altered restriction site or a mutation at<br />
the annealing site of one of the primers that are used in the<br />
restriction isotyping method. A new primer set for subsequ<strong>en</strong>t<br />
sequ<strong>en</strong>cing was designed to amplify a 629 bp DNA fragm<strong>en</strong>t<br />
Ned Tijdschr Klin Chem 1998, vol. 23, no. 2<br />
of α LELY with a HE- α allele can cause severe HE or HPP, the<br />
detection of the pres<strong>en</strong>ce of the α LELY allele is important in<br />
studying these disorders.<br />
A simple diagnostic PCR assay is pres<strong>en</strong>ted, using a modified<br />
primer that g<strong>en</strong>erates a restriction site in the pres<strong>en</strong>ce of the<br />
α LELY mutation in exon 40 of the α-spectrin g<strong>en</strong>e. This assay<br />
demonstrates the pres<strong>en</strong>ce of the α LELY allele in approximately<br />
40% of the caucasian population, confirming former findings.<br />
46. Apolipoprotein E g<strong>en</strong>otype discrepancy leads to discovery of apo-E3 Groning<strong>en</strong>: G-insertion in codons 95-96<br />
resulting in a premature stop codon<br />
D.A.J. BROUWER 1 , L.D. DIKKESCHEI 2 , J. PRINS 3 , A.M. BRUGMAN 1 , A.W. KINGMA 1 , I.P. KEMA 1 ,<br />
J.J. van DOORMAAL 4 , P. TERPSTRA 5 and F.A.J. MUSKIET 1<br />
C<strong>en</strong>tral Laboratory for Clinical Chemistry, Groning<strong>en</strong> University Hospital 1 , C<strong>en</strong>tral Laboratory, De Weez<strong>en</strong>land<strong>en</strong> Hospital,<br />
Zwolle 2 , C<strong>en</strong>tral Laboratory for Clinical Chemistry, Utrecht University Hospital 3 , Atherosclerosis Lipid Outpati<strong>en</strong>t Clinic, Groning<strong>en</strong><br />
University Hospital 4 , Biomedical Technology C<strong>en</strong>tre, Groning<strong>en</strong> University 5<br />
that included both these restriction sites and the primer<br />
annealing sites. Sequ<strong>en</strong>cing demonstrated a G-insertion in<br />
codons 95 or 96 ( 95 AAG- 96 GAG→AAG-GGA-G). The <strong>en</strong>suing<br />
frameshift gives rise to a premature stop at codon 146 (AAG--<br />
>TAA). This codon is located in the receptor binding domain.<br />
The discrepancy betwe<strong>en</strong> the two apo-E g<strong>en</strong>otype methods is<br />
conceivable, since the G-insertion causes a mismatch at the 3’<br />
<strong>en</strong>d of one of the restriction isotyping primers (sequ<strong>en</strong>ce:<br />
5’TAAGCTTGGCACGGCTGTCCAAGGA3’) and consequ<strong>en</strong>tly<br />
the inability of this primer to become ext<strong>en</strong>ded. The<br />
G-insertion is likely to be located on the apo-E3 allele, since<br />
this allele was not amplified with the apo-E restriction isotyping<br />
method. The preval<strong>en</strong>ce, and the ph<strong>en</strong>otypic and<br />
functional consequ<strong>en</strong>ces of this G-insertion are curr<strong>en</strong>tly<br />
under investigation.<br />
Hixson JE and Vernier DT. Restriction isotyping of human<br />
apolipoprotein E by g<strong>en</strong>e amplification and cleavage with Hha I. J<br />
Lipid Res 1990; 31: 545-548.<br />
47. Ontwikkeling van moleculaire diagnostiek op faeces voor vroegdetectie colonkanker<br />
R.H.N. van SCHAIK 1 , M. SMID 2 , D. SWINKELS 3 , J. LINDEMANS 1 , J.W. OOSTERHUIS 4 <strong>en</strong> L.C.J. DORSSERS 2<br />
Afd. <strong>Klinische</strong> Chemie 1 , Afd. Moleculaire Biologie 2 , Laboratorium voor Experim<strong>en</strong>tele Patho-Oncologie 4 , Academisch Ziek<strong>en</strong>huis<br />
Rotterdam <strong>en</strong> Afd. <strong>Klinische</strong> Chemie 3 , Academisch Ziek<strong>en</strong>huis Radboud Nijmeg<strong>en</strong><br />
Colorectale tumor<strong>en</strong> tred<strong>en</strong> met e<strong>en</strong> hoge frequ<strong>en</strong>tie op, waarbij<br />
de incid<strong>en</strong>tie to<strong>en</strong>eemt met de leeftijd. Prognose van de<br />
patiënt hangt af van het tumorstadium waarin de ziekte wordt<br />
ontdekt. Er bestaat derhalve e<strong>en</strong> grote behoefte aan scre<strong>en</strong>ing.<br />
De huidige detectie-techniek<strong>en</strong> (occult bloed test <strong>en</strong> colonoscopie)<br />
zijn hiervoor niet geschikt. De ontwikkeling van<br />
colonkanker gaat gepaard met het optred<strong>en</strong> van specifieke<br />
mutaties in het DNA van de tumorcell<strong>en</strong>, waaronder het k-ras<br />
g<strong>en</strong>. Het aanton<strong>en</strong> van k-ras gemuteerd DNA in faeces zou<br />
mogelijk gebruikt kunn<strong>en</strong> word<strong>en</strong> als scre<strong>en</strong>ingsmethode.<br />
Voorwaard<strong>en</strong> bij de ontwikkeling van moleculaire diagnostiek<br />
betreff<strong>en</strong> de kwaliteit <strong>en</strong> kwantiteit van humaan DNA in<br />
faeces, <strong>en</strong> s<strong>en</strong>sitiviteit <strong>en</strong> specificiteit van de mutant k-ras g<strong>en</strong><br />
detectiemethode.<br />
Uit faeces van 30 colonkanker patiënt<strong>en</strong> werd met de XT-<br />
RAX-methode DNA geïsoleerd. Middels hybridisatie met e<strong>en</strong><br />
humaan specifieke probe werd 300 µg humaan<br />
DNA/gram faeces aangetoond. De kwetsbaarheid van DNA in<br />
faeces is onderzocht met betrekking tot invriez<strong>en</strong>, koelkast-op-<br />
slag <strong>en</strong> incubatie bij kamertemperatuur. PCR (30-cycli) voor<br />
k-ras op minimaal 20 ng DNA geïsoleerd uit faeces, bleek in<br />
alle gevall<strong>en</strong> e<strong>en</strong> EtBr-zichtbare band op te lever<strong>en</strong>. Voor de<br />
k-ras mutatie-detectie wordt e<strong>en</strong> GAP-LCR methode gebruikt,<br />
waarmee mom<strong>en</strong>teel e<strong>en</strong> gevoeligheid van 1 mutant k-ras g<strong>en</strong><br />
op e<strong>en</strong> achtergrond van 1.000-10.000 wild-type k-ras g<strong>en</strong><strong>en</strong><br />
wordt bereikt.<br />
We concluder<strong>en</strong> dat we e<strong>en</strong> relatief simpele procedure voor de<br />
isolatie van DNA uit faeces hebb<strong>en</strong>, wat DNA oplevert dat geschikt<br />
is voor PCR. De hoeveelheid humaan DNA gevond<strong>en</strong><br />
in faeces van colontumor patiënt<strong>en</strong> varieert sterk, <strong>en</strong> is bij e<strong>en</strong><br />
aantal patiënt<strong>en</strong> niet detecteerbaar. Dit heeft grote consequ<strong>en</strong>ties<br />
voor ev<strong>en</strong>tuele moleculaire diagnostiek die gericht is op<br />
het aanton<strong>en</strong> van gemuteerde g<strong>en</strong><strong>en</strong> middels amplificatie-techniek<strong>en</strong>.<br />
Immers, e<strong>en</strong> negatieve uitkomst heeft alle<strong>en</strong> waarde<br />
wanneer is geverifieerd dat e<strong>en</strong> minimale hoeveelheid humaan<br />
DNA is onderzocht. De manier van verzamel<strong>en</strong> <strong>en</strong> opslag van<br />
faeces kan grote invloed hebb<strong>en</strong> op de uiteindelijke DNA opbr<strong>en</strong>gst.<br />
79
Divers<strong>en</strong><br />
48. Evaluatie Advia 120 van Bayer<br />
C. BANK, J. de BLAEY, Y. SENTURK <strong>en</strong> M. van der WELLE<br />
Klinisch Chemisch Laboratorium, Ziek<strong>en</strong>huis Walcher<strong>en</strong>, Vlissing<strong>en</strong><br />
In het kader van de vervanging van de huidige celtel-apparatuur<br />
werd de Advia 120 van de firma Bayer, in e<strong>en</strong> periode<br />
van 2 wek<strong>en</strong>, vergelek<strong>en</strong> met de in gebruik zijnde H1 system<strong>en</strong><br />
van Bayer. Voor n=200 monsters werd<strong>en</strong> de parameters<br />
gecorreleerd met die van de H1 system<strong>en</strong>. Goede correlatiecoëfficiënt<strong>en</strong><br />
(r=0.9956 tot r=0.9598) werd<strong>en</strong> gevond<strong>en</strong> voor<br />
celparameters, met uitzondering van de vergelijking van de<br />
MCHC.<br />
Voor de signalering afwijk<strong>en</strong>de differ<strong>en</strong>tiaties (afkapwaarde ><br />
3 stav<strong>en</strong> of 1 atypisch lymfocyt) is voor de Advia 120 e<strong>en</strong><br />
s<strong>en</strong>sitiviteit van 78% <strong>en</strong> e<strong>en</strong> specificiteit van 60% bepaald.<br />
Reproduceerbaarheid (binn<strong>en</strong> de dag <strong>en</strong> van dag tot dag) is<br />
goed. De houdbaarheid tot t<strong>en</strong>minste 24 uur na afname vertoonde<br />
ge<strong>en</strong> afwijking<strong>en</strong>. Ge<strong>en</strong> aanwijzing<strong>en</strong> voor carry-over.<br />
Verbeterde meettechniek, verbeterde signalering <strong>en</strong> moderne<br />
software (Windows NT) met e<strong>en</strong> uitgebreide help-functie<br />
mak<strong>en</strong> de Advia 120 e<strong>en</strong> geschikte opvolger van de, binn<strong>en</strong><br />
ons laboratorium in gebruik zijnde, H1 system<strong>en</strong>.<br />
49. The influ<strong>en</strong>ce of blood collection site on refer<strong>en</strong>ce values for clinical chemical and hematological parameters<br />
N. de JONGE, A. STEENKS, A. E. M. BALLERING, Y. V. WILDENBERG-KROON and A. J. P. F. LOMBARTS<br />
Departm<strong>en</strong>t of Clinical Chemistry, Ley<strong>en</strong>burg Hospital, The Hague, The Netherlands<br />
The preferred site for collecting v<strong>en</strong>ous blood in adults is the<br />
median cubital vein in the antecubital fossa, since this vein is<br />
both large and close to the surface of the skin. Refer<strong>en</strong>ce<br />
values of clinical laboratory analytes are usually based on<br />
blood collection from this site. However, this vein may not be<br />
used under certain circumstances (e.g. pati<strong>en</strong>ts with uni- or<br />
bilateral paresis, pati<strong>en</strong>ts with a cannula or arteriov<strong>en</strong>ous<br />
fistula in the arm, after mastectomy, etc.). Veins at the ankle<br />
or foot offer a practical alternative. Diminished circulation,<br />
hemodilution with extravascular fluid or lymph, increased<br />
hydrostatic pressure, and metabolism, however, may influ<strong>en</strong>ce<br />
the conc<strong>en</strong>tration of analytes found in blood samples obtained<br />
from differ<strong>en</strong>t blood collection sites.<br />
We studied the influ<strong>en</strong>ce of blood collection site on refer<strong>en</strong>ce<br />
values for 40 clinical chemical and haematological parameters,<br />
including electrolytes, <strong>en</strong>zymes, proteins, lipids, blood<br />
cell counts, and erythrocyte sedim<strong>en</strong>tation rate (ESR). Blood<br />
was collected from 64 appar<strong>en</strong>tly healthy volunteers from both<br />
the arm and foot or ankle and analyzed according to standard<br />
50. First experi<strong>en</strong>ces with the Axis homocysteine EIA; a comparison with HPLC<br />
Homocysteine is a parameter of increasing importance. So far,<br />
only HPLC methods were available for its quantifiction.<br />
Rec<strong>en</strong>tly, however, an alternative method was introduced: the<br />
Axis homocysteine <strong>en</strong>zyme immunoassay.<br />
Here the total homocysteine cont<strong>en</strong>t of a sample is measured<br />
after reduction, followed by <strong>en</strong>zymatic conversion using<br />
bovine S-ad<strong>en</strong>osyl-L-homocysteine (SAH) hydrolase. The<br />
measurem<strong>en</strong>t is th<strong>en</strong> performed by competitive immunoassay<br />
with a mouse antiSAH antibody.<br />
The costs of the EIA kit are a serious obstacle for an evaluation<br />
of the method in the individual laboratory. Therefore,<br />
during the introductory period, exchange of results obtained<br />
may be of additional interest to the field. Here we report the<br />
combined experi<strong>en</strong>ces of a comparison of the Axis homocysteine<br />
EIA with HPLC in two Dutch hospital laboratories. In<br />
addition, the results of the comparison performed in Berg<strong>en</strong><br />
(Norway) are added.<br />
In this way a total of 100 results was available for analysis.<br />
operating procedures. Results were analyzed by the paired<br />
t-test, with a p-value 0.05 for statistical significance.<br />
Unsignificant differ<strong>en</strong>ces were found for ALAT, calcium,<br />
creatinin, protein spectrum, sodium, TSH, urea, uric acid, erythrocytes,<br />
hemoglobin, hematocrite, MCV, MCH, platelets,<br />
RDW, and ESR.<br />
Significantly lower results for blood obtained from ankle or<br />
foot compared to the arm were found for bicarbonate (-6.2%),<br />
glucose (-2.6%), and potassium (-2.1%).<br />
Higher results were found for albumin (1.9%), alkaline phosphatase<br />
(1.8%), inorganic phosphate (2.5%), ASAT (2.4%),<br />
total bilirubin (2.5%), direct bilirubin (8.3%), chloride (0.8%),<br />
CK (1.0%), CK-MB (14.1%), cholesterol (1.5%), γGT (1.7%),<br />
iron (4.6%), LD (4.1%), total protein (1.9%), triglycerides<br />
(3.5%) and leukocytes (1.9%).<br />
Although statistical significant differ<strong>en</strong>ces were found, these<br />
differ<strong>en</strong>ces do not seem to be of clinical importance, implicating<br />
that the ankle or foot veins are good alternatives for the<br />
collection of blood samples.<br />
F.J. HOEK 1 and J. van PELT 2<br />
Academic Medical C<strong>en</strong>ter, Clinical Chemistry Departm<strong>en</strong>t, Amsterdam 1 , St Maart<strong>en</strong>s Gasthuis, Clinical Chemistry and Hematology<br />
Laboratory, V<strong>en</strong>lo 2<br />
In a third of the samples the results were compared to the<br />
HPLC method of Ubbink, in the other monobromobimane was<br />
used as the fluorophore. No internal standardization was used.<br />
In 11 of the samples the HPLC result was in the range of 50 to<br />
70 µmol/l, which is higher than the upper limit of 50 µmol/l<br />
recomm<strong>en</strong>ded for the Axis EIA, which corresponds to the<br />
highest standard.<br />
The correlations betwe<strong>en</strong> the methods were excell<strong>en</strong>t with<br />
coeffici<strong>en</strong>ts of 0.96 or better. Also the x-coeffici<strong>en</strong>ts obtained<br />
in the separate laboratories were not significantly differ<strong>en</strong>t<br />
from 1.00, betwe<strong>en</strong> 0.945 and 1.116 (Passing and Bablok).<br />
In 71 samples the average homocysteine conc<strong>en</strong>tration<br />
obtained with the two methods was below 30 µmol/l. In only<br />
4 of those the differ<strong>en</strong>ce betwe<strong>en</strong> the methods was more than<br />
5 µmol/l. This is of course still a substantial differ<strong>en</strong>ce in or<br />
around the refer<strong>en</strong>ce range (5-15 µmol/l). We observed a tr<strong>en</strong>d<br />
to lower results with the EIA than with HPLC in this range.<br />
Above 30 µmol/l, 15 of 29 cases showed differ<strong>en</strong>ces of more<br />
80 Ned Tijdschr Klin Chem 1998, vol. 23, no. 2
than 5µmol/l, but there were only 2 outliers with a differ<strong>en</strong>ce<br />
larger than 10 µmol/l.<br />
In our laboratories for three levels of controls the coeffici<strong>en</strong>ts<br />
of variation were calculated. For each control nine values were<br />
available, after exclusion of outliers. Mean homocysteine<br />
levels of the controls were 6.0, 10.1 and 21.9 µmol/l. The CV's<br />
found were 7.6%, 11.1% and 7.3% respectively.<br />
51. Evaluation of the Immulite 2000 automated immunoanalyzer<br />
J.L.P. van DUIJNHOVEN, J.J. TREPELS, and A.J.W.P. WILLEMS<br />
Clinical Laboratory, Elkerliek Hospital, Helmond, The Netherlands<br />
The Immulite 2000 (Diagnostic Product Corporation, Apeldoorn,<br />
The Netherlands (y)) was evaluated and rec<strong>en</strong>tly introduced<br />
into our laboratory. We studied sev<strong>en</strong> immunoassays<br />
(free T4, total T3, LH, FSH, prolactin, ferritin and 3rd g<strong>en</strong>eration<br />
TSH), and compared the results with our former system<br />
(ES-607, Boehringer Mannheim, Almere, The Netherlands<br />
(x)). We estimated betwe<strong>en</strong> run imprecision (pati<strong>en</strong>t sera and<br />
commercially available QC samples, 3 levels each, n=12),<br />
drift, adjustm<strong>en</strong>t-stability, linearity (EP-6), correlation with<br />
our curr<strong>en</strong>t method (Passing and Bablok statistics, y= a+b*x,<br />
Ned Tijdschr Klin Chem 1998, vol. 23, no. 2<br />
n=70), and the 27 sample Krouwer multifactor design protocol,<br />
to simultaneously estimate slope and intercept, drift,<br />
linearity, sample carryover and within run imprecision.<br />
Additionally, we assessed the random-access capabilities and<br />
ease of use in routine operation. Results: Adjustm<strong>en</strong>ts didn’t<br />
cause any shifts and drift was not observed. Imprecision<br />
results (CV) of pati<strong>en</strong>t pools and commercial controls (pres<strong>en</strong>ted<br />
in the table below) were comparable. The following<br />
specifics were noted (table):<br />
Betwe<strong>en</strong>-run CV% P&B regression Linearity (N=not)<br />
Assay: Units: Conc CV% Conc CV% Conc CV% b a r Krouwer EP-6<br />
Free T4 pmol/l 7.0 9.7 21.7 9.6 58.5 3.8 1.34 -0.83 0.961 NA NA<br />
TSH mIU/l 2.8 4.2 10.2 6.4 34.3 7.2 0.89 0.02 0.996 Linear Linear<br />
Total T3 nmol/l 0.7 14.5 2.1 6.7 3.8 6.7 1.10 -0.45 0.919 N-linear Linear<br />
LH IU/l 4.4 7.4 23.2 5.8 68.3 5.2 0.97 -1.18 0.983 Linear Linear<br />
FSH IU/l 10.0 4.5 14.1 4.8 40.2 5.8 0.93 -0.18 0.992 N-linear Linear<br />
Prolactin mIU/l 234 5.3 358 3.9 1088 4.1 0.84 -40.4 0.990 Linear N-Linear<br />
Ferritin µg/l 27 11.4 147 2.8 428 4.0 1.07 -0.5 0.994 Linear Linear<br />
The Immulite 2000 is linked to our laboratory information<br />
system by a bi-directional interface (host-query). For thyroid<br />
testing, we use an automated reflexive testing protocol. Conclusion:<br />
the modern layout of the instrum<strong>en</strong>t, easy of use, long<br />
52. Evaluatie van e<strong>en</strong> volbloed kreatinine-meting met de NOVA 16 CRT analyser<br />
Het bepal<strong>en</strong> van kreatinine bij behandeling van patiënt<strong>en</strong> met<br />
e<strong>en</strong> nierfunctiestoornis gebeurt tot op hed<strong>en</strong> in bloedplasma.<br />
De uitslag is echter niet direct bek<strong>en</strong>d. Wij hebb<strong>en</strong> e<strong>en</strong> kreatinine<br />
bepaling geevalueerd waarbij in volbloed kreatinine<br />
m.b.v. e<strong>en</strong> <strong>bio</strong>specifieke elektrode wordt gemet<strong>en</strong>. Hierdoor<br />
kan de uitslag veel sneller bek<strong>en</strong>d zijn, hetge<strong>en</strong> grote voordel<strong>en</strong><br />
geeft wat betreft diagnose <strong>en</strong> behandeling van de patiënt.<br />
Het doel van de evaluatie van de volbloed kreatinine<br />
meting op de NOVA 16 CRT analyser is om na te gaan of<br />
deze methode voldoet aan de eis<strong>en</strong> die aan e<strong>en</strong> kreatinine<br />
bepaling word<strong>en</strong> gesteld.<br />
De evaluatie van de NOVA 16 CRT is gedaan m.b.v. de EP-5<br />
(precisie), EP-6 (lineariteit) <strong>en</strong> Krouwer-27 (drift <strong>en</strong> carryover)<br />
protocoll<strong>en</strong>. De method<strong>en</strong>vergelijking met de <strong>en</strong>zymatische<br />
plasma kreatininemeting (Boehringer) op de Hitachi 747<br />
is gedaan volg<strong>en</strong>s Passing & Bablok. De totale imprecisie van<br />
Analysis of samples in 1:1 dilution with assay buffer gave<br />
good recoveries.<br />
Conclusions: Ev<strong>en</strong> without a familiarization period the results<br />
for the Axis homocysteine EIA are good. The test is easy to<br />
perform and gives results with good interlaboratory comparability.<br />
The variability of the results is higher than with HPLC.<br />
walk-away time, minimal maint<strong>en</strong>ance, reliability, as well as<br />
the analytical performance make this instrum<strong>en</strong>t highly suitable<br />
for implem<strong>en</strong>tation in an automated clinical laboratory.<br />
T. BRUIN 1 , M. NIERS 2 <strong>en</strong> G.T. SANDERS 1<br />
Afdeling <strong>Klinische</strong> Chemie, Academisch Medisch C<strong>en</strong>trum 1 , Amsterdam <strong>en</strong> M<strong>en</strong>arini B<strong>en</strong>elux, Valk<strong>en</strong>swaard 2<br />
de kreatinine bepaling is 7.6% bij 303 µmol/l, 7.0 % bij 90.6<br />
µmol/l <strong>en</strong> 17.8 % bij 40.2 µmol/l. Monster carry-over was niet<br />
aanwezig, echter er was wel drift aantoonbaar. De lineariteit is<br />
gemet<strong>en</strong> tuss<strong>en</strong> 0 <strong>en</strong> 1000 µmol/l <strong>en</strong> is goed. De correlatie<br />
tuss<strong>en</strong> beide method<strong>en</strong> is goed (r = 0.97). De helling van de<br />
regressielijn (slope = 0.90) was afwijk<strong>en</strong>d maar de asafsnijding<br />
niet (intercept = -1.400 (n = 111).<br />
Concluder<strong>en</strong>d: de kreatinine meting met e<strong>en</strong> <strong>bio</strong>specifieke<br />
elektrode op de NOVA 16 CRT voldoet niet aan de criteria<br />
voor e<strong>en</strong> analytische CV onder de 2.4%, zoals aanbevol<strong>en</strong> op<br />
basis van intra-individuele variatie voor e<strong>en</strong> kreatinine bepaling.<br />
Echter, als citobepaling in e<strong>en</strong> dec<strong>en</strong>trale setting, bijv. op<br />
e<strong>en</strong> int<strong>en</strong>sive care, kan het zeker van di<strong>en</strong>st zijn. De vraag die<br />
dan echter gesteld moet word<strong>en</strong> is waar de prioriteit<strong>en</strong> ligg<strong>en</strong>;<br />
e<strong>en</strong> snelle kreatinine maar iets minder betrouwbare uitslag, of<br />
e<strong>en</strong> meer exacte uitslag na 45 minut<strong>en</strong>.<br />
81
53. Heeft frequ<strong>en</strong>t prikk<strong>en</strong> van capillair bloed invloed op de pre-analytische fase van laboratorium bepaling<strong>en</strong>?<br />
T. BRUIN 1 , J.C. de GRAAFF 2 , G.J. HEMMES 3 , D.TH. UBBINK 2 , R.P.J. MICHELS 3 <strong>en</strong> G.T. SANDERS 1<br />
Afdeling <strong>Klinische</strong> Chemie 1 , Chirurgie 2 <strong>en</strong> Inw<strong>en</strong>dige G<strong>en</strong>eeskunde 3 van het Academisch Medisch C<strong>en</strong>trum, Amsterdam<br />
Diabetes patiënt<strong>en</strong> bepal<strong>en</strong> hun eig<strong>en</strong> bloed glucose gehalte uit<br />
e<strong>en</strong> vingerprik. Als dit gedur<strong>en</strong>de langere tijd gebeurt, ontwikkelt<br />
zich mogelijk littek<strong>en</strong>weefsel op de vingertopp<strong>en</strong>. De<br />
microcirculatie in de vingertop kan hierdoor verander<strong>en</strong>, met<br />
e<strong>en</strong> mogelijke invloed op de lokale sam<strong>en</strong>stelling van het<br />
bloed <strong>en</strong> dus ook op de pre-analytische fase van laboratoriumbepaling<strong>en</strong>.<br />
In deze studie is onderzocht of frequ<strong>en</strong>t prikk<strong>en</strong> in<br />
de vinger invloed heeft op de microcirculatie van de huid, gemet<strong>en</strong><br />
m.b.v. e<strong>en</strong> laser Doppler perfusie monitor, <strong>en</strong> of er<br />
verschill<strong>en</strong> zijn in laboratorium uitslag<strong>en</strong> van e<strong>en</strong> cholesterol<strong>en</strong><br />
e<strong>en</strong> glucose bepaling in vergelijking met e<strong>en</strong> vinger waarin<br />
niet geprikt wordt.<br />
De patiënt<strong>en</strong> in deze studie met type I diabetes mellitus (23<br />
mann<strong>en</strong> <strong>en</strong> 27 vrouw<strong>en</strong>) hebb<strong>en</strong> zich gedur<strong>en</strong>de gemiddeld 13<br />
jaar in de vingers geprikt. De huiddoorbloeding gemet<strong>en</strong><br />
m.b.v. e<strong>en</strong> fluxto<strong>en</strong>ame na arteriele occlusie is 0,98 ± 0,72<br />
54. Vergelijking van vier flowcytometrische techniek<strong>en</strong> voor de detectie van apoptose<br />
R. OVERBEEKE, I. VERMES, C. REUTELINGSPERGER 2 <strong>en</strong> C. HAANEN<br />
Klinisch Chemisch Laboratorium, Medisch Spectrum Tw<strong>en</strong>te, Enschede, Universiteit Maastricht 2<br />
Vier veel gebruikte flowcytometrische apoptose-detectietechniek<strong>en</strong><br />
werd<strong>en</strong> onderzocht op s<strong>en</strong>sitiviteit, specificiteit <strong>en</strong><br />
reproduceerbaarheid.<br />
Apoptose, ofwel geprogrammeerde celdood, werd geïnduceerd<br />
door middel van bestraling in twee T-lymfoblastaire cellijn<strong>en</strong>,<br />
HSB <strong>en</strong> Jurkat.<br />
HSB- <strong>en</strong> Jurkatcel monsters werd<strong>en</strong> gemet<strong>en</strong> voor bestraling<br />
<strong>en</strong> op de tijdstipp<strong>en</strong> 0, 2, 4, 6, 8 <strong>en</strong> 24 uur na bestraling met<br />
respectievelijk 6 <strong>en</strong> 10 Gy <strong>en</strong> 10 <strong>en</strong> 14 Gy. De volg<strong>en</strong>de vier<br />
flowcytometrische detectietechniek<strong>en</strong> werd<strong>en</strong> getest: 1) de<br />
annexine V/propidiumjodide bepaling, deze techniek toont de<br />
translocatie van fosfatidylserine aan naar de buit<strong>en</strong>kant van de<br />
celmembraan. Tegelijkertijd wordt er gekek<strong>en</strong> naar de integriteit<br />
van de membraan. 2) Terminal deoxynucleotidyl Transferase<br />
(TdT) Uridin Triphosphate (UTP) Nick End Labeling<br />
(TUNEL), met deze techniek word<strong>en</strong> specifieke ds DNA-<br />
55. Soluble Fas: e<strong>en</strong> indicator voor apoptose ex vivo?<br />
R. OVERBEEKE <strong>en</strong> I. VERMES<br />
Klinisch Chemisch Laboratorium, Medisch Spectrum Tw<strong>en</strong>te, Enschede<br />
Fas/Apo-1 (CD95) is e<strong>en</strong> geglycosyleerd transmembraan-eiwit<br />
dat familie is van de TNF receptor. Ligatie van Fas resulteert<br />
in e<strong>en</strong> snelle inductie van apoptose.<br />
Nu is aangetoond dat bij sommige ziekt<strong>en</strong> e<strong>en</strong> oplosbaar Fas<br />
molecuul (sFas) aanwezig is in het perifeer bloed. Door aanwezigheid<br />
van sFas zou apoptose van de cel geremd word<strong>en</strong><br />
doordat het Fas-ligand bindt aan de oplosbare molecul<strong>en</strong>. De<br />
sFas ELISA is e<strong>en</strong> techniek voor de kwantitatieve detectie van<br />
oplosbaar humaan Fas (Apo-1) in celcultuur-supernatant, humaan<br />
serum, plasma of andere lichaamsvloeistoff<strong>en</strong>.<br />
Het doel van dit onderzoek was om te test<strong>en</strong> of het mogelijk is<br />
m.b.v. de sFas ELISA methode apoptose ex vivo aan te ton<strong>en</strong><br />
<strong>en</strong> om de betrouwbaarheid van deze methode te test<strong>en</strong>.<br />
Voor de meting werd gebruik gemaakt van e<strong>en</strong> met anti-sFas<br />
gecoate microtiterplaat. Het sFas, dat aanwezig is in het monster,<br />
bindt aan het monoclonale antilichaam. Daarna wordt er<br />
<strong>bio</strong>tine-geconjugeerd anti-sFas toegevoegd dat bindt aan het<br />
Volt voor de "prik"vinger <strong>en</strong> 1,04 ± 0,79 Volt voor de "controle"vinger,<br />
<strong>en</strong> dus niet significant verschill<strong>en</strong>d. De gemiddelde<br />
cholesterolconc<strong>en</strong>tratie in capillair bloed van de prikvinger<br />
is 5,15 ± 1,07 mmol/l <strong>en</strong> in de controlevinger 5,17 ± 1,03<br />
mmol/l. Voor de capillaire glucose conc<strong>en</strong>traties zijn deze<br />
resultat<strong>en</strong> respectievelijk 10,1 ± 4,7 mmol/l <strong>en</strong> 10,2 ± 4,4<br />
mmol/l. Er war<strong>en</strong> ook ge<strong>en</strong> significante verschill<strong>en</strong> tuss<strong>en</strong> de<br />
laboratorium bepaling<strong>en</strong> aantoonbaar.<br />
Uit de resultat<strong>en</strong> blijkt dat het gedur<strong>en</strong>de lange tijd herhaald<br />
prikk<strong>en</strong> in de vingertopp<strong>en</strong> ge<strong>en</strong> significante invloed heeft op<br />
de huiddoorbloeding van de vingers. Bov<strong>en</strong>di<strong>en</strong> blijkt dat er<br />
ge<strong>en</strong> significant verschill<strong>en</strong> optred<strong>en</strong> bij de cholesterol- <strong>en</strong><br />
glucose bepaling uit capillair bloed. Er kan dan ook geconcludeerd<br />
word<strong>en</strong> dat frequ<strong>en</strong>t prikk<strong>en</strong> van capillair bloed ge<strong>en</strong><br />
invloed heeft op de pre analytische fase van deze laboratorium<br />
bepaling<strong>en</strong>.<br />
breuk<strong>en</strong> die tijd<strong>en</strong>s apoptose ontstaan aangetoond. 3) DNAflowcytometrie,<br />
waarmee de hoeveelheid DNA in de celkern<br />
wordt gemet<strong>en</strong>. 4) Phycoërytrine (PE)-gelabelde APO2.7 test,<br />
e<strong>en</strong> monocolonaal antilichaam teg<strong>en</strong> het 7A6 antige<strong>en</strong>, e<strong>en</strong><br />
eiwit dat tijd<strong>en</strong>s celdood tot expressie komt op het mitochondriaal<br />
membraan.<br />
Als goud<strong>en</strong> standaard voor apoptose werd de DNA elektroforese<br />
meeg<strong>en</strong>om<strong>en</strong> om het voor apoptose specifieke ladderpatroon<br />
zichtbaar te mak<strong>en</strong>. Tev<strong>en</strong>s werd<strong>en</strong> de cell<strong>en</strong> morfologisch<br />
beoordeeld met behulp van microscopie.<br />
Uit het onderzoek bleek dat de expressie van het 7A6 antige<strong>en</strong><br />
op het mitochondriale membraan niet specifiek is voor apoptotische<br />
celdood. De fluoresceïne isothiocyanaat (FITC)-gelabeld<br />
annexine V/propidiumjodide bepaling bleek de minst tijdrov<strong>en</strong>de<br />
<strong>en</strong> de meest gevoelige <strong>en</strong> specifieke flowcytometrische<br />
methode te zijn voor de detectie van apoptose in celsusp<strong>en</strong>sies.<br />
sFas. Streptavidine-HRP bindt vervolg<strong>en</strong>s aan het <strong>bio</strong>tine <strong>en</strong><br />
er ontstaat e<strong>en</strong> gekleurd produkt na toevoeg<strong>en</strong> van TMBsubstraat.<br />
E<strong>en</strong> sFas positief monster <strong>en</strong> de te onderzoek<strong>en</strong><br />
monsters werd<strong>en</strong> gemet<strong>en</strong> bij e<strong>en</strong> golfl<strong>en</strong>gte van 450 nm. Over<br />
de reproduceerbaarheid kan gezegd word<strong>en</strong> dat de techniek<br />
betrouwbaar is. De berek<strong>en</strong>de variatiecoëffici<strong>en</strong>t is: 2,2 %.<br />
De volg<strong>en</strong>de monsters werd<strong>en</strong> onderzocht: 10 normale sera, 9<br />
sera van SLE patiënt<strong>en</strong>, 20 sera van sepsis-patiënt<strong>en</strong>, 10 normaal<br />
liquor<strong>en</strong> <strong>en</strong> 20 liquor<strong>en</strong> van Alzheimerpatiënt<strong>en</strong>.<br />
Uit het onderzoek bleek dat de normale monsters, zowel liquor<strong>en</strong><br />
als sera, <strong>en</strong> de liquor<strong>en</strong> van Alzheimerpatiënt<strong>en</strong> b<strong>en</strong>ed<strong>en</strong><br />
de detectiegr<strong>en</strong>s van 1,5 ng/ml sFas ligg<strong>en</strong>. De sera van SLE<br />
patiënt<strong>en</strong> blek<strong>en</strong> alle positief. Uit het onderzoek bleek dat de<br />
conc<strong>en</strong>tratie sFas in sera van sepsispatiënt<strong>en</strong> correleert met de<br />
ernst van het ziektebeeld.<br />
De sFas ELISA geeft bij sommige ziekt<strong>en</strong> aanwijzing voor het<br />
bestaan van e<strong>en</strong> apoptose f<strong>en</strong>ome<strong>en</strong> in het bloed.<br />
82 Ned Tijdschr Klin Chem 1998, vol. 23, no. 2
56. Precisie <strong>en</strong> juistheid van e<strong>en</strong> HPLC methode voor het met<strong>en</strong> van conc<strong>en</strong>traties van porfyrines in urine<br />
F.M.J. ZUIJDERHOUDT, J. DORRESTEIJN-de BOK <strong>en</strong> S.G.A. KOEHORST<br />
Afdeling <strong>Klinische</strong> Chemie, Dev<strong>en</strong>ter Ziek<strong>en</strong>huis, Dev<strong>en</strong>ter<br />
Er is in de literatuur niet veel te vind<strong>en</strong> omtr<strong>en</strong>t precisie <strong>en</strong><br />
juistheid bij de bepaling van individuele porfyrinecompon<strong>en</strong>t<strong>en</strong><br />
in urine zoals gemet<strong>en</strong> met HPLC.<br />
Kwaliteitscontroleprogramma's van de SKZL <strong>en</strong> het Yorkshire<br />
Regional Analytical Committee gev<strong>en</strong> sterk wissel<strong>en</strong>de resultat<strong>en</strong><br />
waarbij interlab variatiecoeffici<strong>en</strong>t<strong>en</strong> vaak vele ti<strong>en</strong>tall<strong>en</strong><br />
proc<strong>en</strong>t<strong>en</strong> bedrag<strong>en</strong>.<br />
Hoewel waarschijnlijk kalibratieverschill<strong>en</strong> of het ontbrek<strong>en</strong><br />
van kalibratie e<strong>en</strong> rol spel<strong>en</strong>, vroeg<strong>en</strong> wij ons tev<strong>en</strong>s af hoe<br />
groot de bijdrage van variatie in de precisie kan zijn. Voor<br />
deze studie koz<strong>en</strong> wij urinemonsters van pati<strong>en</strong>t<strong>en</strong> met leverziekte<br />
zonder porfyrie, porfyria cutanea tarda, acute intermitter<strong>en</strong>de<br />
porfyrie, porfyria variegata <strong>en</strong> hereditaire coproporfyrie.<br />
Tev<strong>en</strong>s werd e<strong>en</strong> controle urine meeg<strong>en</strong>om<strong>en</strong>. De totale porfyrine<br />
gehaltes van de urines war<strong>en</strong> licht tot matig verhoogd<br />
(300 - 1200 nmol/l; refer<strong>en</strong>tiewaarde < 285 nmol/l).<br />
Elk urinemonster werd in porties verdeeld, afgeschermd van<br />
licht <strong>en</strong> diepgevror<strong>en</strong> bewaard. In ope<strong>en</strong>volg<strong>en</strong>de wek<strong>en</strong> werd<strong>en</strong><br />
de porfyrines in elk monster één keer per week gemet<strong>en</strong><br />
57. Drug use on raves; some laboratory and demographic data<br />
Use of XTC (MDMA) and XTC-analogues is popular among<br />
youth visiting raves. Until now few reliable data are available<br />
from XTC users which were interviewed and tested on site at<br />
the raves.<br />
In a large study in the Netherlands, which was initiated by the<br />
Ministry of Health, drugs use on raves was investigated by<br />
means of a structured questionnaire. On 10 differ<strong>en</strong>t raves 1121<br />
visitors were interviewed and on 3 raves 312 visitors were also<br />
asked to deliver 2 urine samples; one at the beginning of the<br />
party and one at the <strong>en</strong>d. Drugscre<strong>en</strong>ing on cannabinoids,<br />
opiates, amphetamines, cocaine and alcohol was performed<br />
by EMIT ® . Analysis of MDMA (XTC) and analogues was<br />
performed by GC/MS.<br />
Ned Tijdschr Klin Chem 1998, vol. 23, no. 2<br />
(n=6 wek<strong>en</strong>) waarbij de HPLC methode gekalibreerd werd<br />
met speciale kalibratie- m<strong>en</strong>gsels (Sigma) of werd uitgevoerd<br />
(n=4 wek<strong>en</strong>) met e<strong>en</strong> niet gekalibreerde oplossing (S) met opgegev<strong>en</strong><br />
conc<strong>en</strong>traties (Sigma). In beide reeks<strong>en</strong> werd<strong>en</strong> deze<br />
oplossing<strong>en</strong> (S) als standaard gebruikt.<br />
Gemet<strong>en</strong> werd<strong>en</strong> de uro-, hepta-, hexa-, p<strong>en</strong>ta-, <strong>en</strong> coproporfyrines<br />
(I <strong>en</strong> II).<br />
Variatiecoeffici<strong>en</strong>t<strong>en</strong> varieerd<strong>en</strong> meestal tuss<strong>en</strong> 2% <strong>en</strong> 10%<br />
doch war<strong>en</strong> zoals te verwacht<strong>en</strong> hoger bij erg lage conc<strong>en</strong>traties<br />
van sommige porfyrines.<br />
De resultat<strong>en</strong> van bepaling<strong>en</strong> waarbij niet gekalibreerd was<br />
wek<strong>en</strong> alle<strong>en</strong> voor de uro- <strong>en</strong> heptaporfyrineconc<strong>en</strong>traties<br />
sterk af van de resultat<strong>en</strong> verkreg<strong>en</strong> na kalibratie (resp. 27%<br />
<strong>en</strong> 21%).<br />
De resultat<strong>en</strong> ton<strong>en</strong> dat de precisie goed in de hand te houd<strong>en</strong> is<br />
doch dat grote verschill<strong>en</strong> vooral bij de uro- <strong>en</strong> heptaporfyrineconc<strong>en</strong>traties<br />
kunn<strong>en</strong> optred<strong>en</strong> als ge<strong>en</strong> gebruik gemaakt wordt<br />
van speciale kalibratiematerial<strong>en</strong>.<br />
L.J. MOSTERT 1 , D.E. de BRUIN 2 , N.J.M. MAALSTE 2 and G.F. van de WIJNGAART 2<br />
Deltalab, Delta Psychiatric Hospital, Poortugaal 1 , CVO Addiction Research Institute 2 , Utrecht University<br />
From the interviews the following data were obtained; most of<br />
the visitors are Dutch (88%), male (70%), have an age of 18-<br />
24 (65%), live with their par<strong>en</strong>ts (68%), have a (full time) job<br />
44% or go to school (51%), are visiting parties regularly (13-<br />
52/year, (53%)) and like hardcore raves most (73%).<br />
Of the urine samples 68% were positive on MDMA or analogues,<br />
37% on amphetamine, 11% on cocaine metabolite and<br />
41% on cannabinoids. The overall agreem<strong>en</strong>t betwe<strong>en</strong> the analytical<br />
results and the self reported data of the questionnaire<br />
was more than 90% which means that questionnaires are considered<br />
to be a valid instrum<strong>en</strong>t to investigate drug use of<br />
youth visiting raves.<br />
58. Bepaling van totaal lichaamswater met e<strong>en</strong> "contineous flow" isotoop ratio massaspectrometer (GC/CF-IRMS)<br />
B.K. van KREEL<br />
Afdeling klinische <strong>chemie</strong>, Academisch Ziek<strong>en</strong>huis Maastricht<br />
Het bepal<strong>en</strong> van de voedingstoestand (nutritional assessm<strong>en</strong>t)<br />
van patiënt<strong>en</strong> komt in de praktijk neer op het vaststell<strong>en</strong> van<br />
de cel massa c.q. het intracellulaire water (ICV).<br />
Dit wordt verkreg<strong>en</strong> door het totaal lichaamswater (TBW) <strong>en</strong><br />
het extra cellulaire water (ECV) te bepal<strong>en</strong> <strong>en</strong> deze van elkaar<br />
af te trekk<strong>en</strong>. ICV = TBW - ECV.<br />
De gangbare methode voor de TBW bepaling berust op het<br />
bepal<strong>en</strong> van de verdunning van e<strong>en</strong> dosis D2O. Indi<strong>en</strong> m<strong>en</strong> de<br />
beschikking heeft over e<strong>en</strong> GC/CF-IRMS waar Helium als<br />
drager gas wordt gebruikt, ontstaan problem<strong>en</strong> indi<strong>en</strong> m<strong>en</strong> bij<br />
massa 3 <strong>en</strong> 4 wil met<strong>en</strong>. Reductie van D2O tot D2 voorafgaande<br />
aan de meting is dan ook niet de aangewez<strong>en</strong> weg.<br />
In ons laboratorium werd e<strong>en</strong> methode ontwikkeld om water<br />
om te zett<strong>en</strong> in acetyle<strong>en</strong>. Hiertoe wordt 350 mg CaC 1<br />
2 (carbid)<br />
in e<strong>en</strong> vacutainer gedaan; de buiz<strong>en</strong> word<strong>en</strong> geëvacueerd<br />
<strong>en</strong> 25 µl monster (urine, speeksel of serum) op het carbid<br />
gespot<strong>en</strong>. Vervolg<strong>en</strong>s word<strong>en</strong> de buiz<strong>en</strong> op e<strong>en</strong> monsterwisselaar<br />
geplaatst <strong>en</strong> wordt de 27/26 massa ratio gemet<strong>en</strong>. De<br />
verdunning wordt bepaald door de 27/26 ratio te vergelijk<strong>en</strong><br />
met e<strong>en</strong> verdunningsreeks van het D2O dat is toegedi<strong>en</strong>d. De<br />
methode werd vergelek<strong>en</strong> met e<strong>en</strong> methode die gebruik maakt<br />
van de omzetting van H2O in H2 in e<strong>en</strong> reductie ov<strong>en</strong> (ge<strong>en</strong><br />
contineous flow!) met behulp van e<strong>en</strong> "dedicated instrum<strong>en</strong>t",<br />
de Aqua-Sira. De voordel<strong>en</strong> van de hier beschrev<strong>en</strong> methode<br />
zijn o.a. ge<strong>en</strong> monstervoorbereiding, ge<strong>en</strong> "memory" effect<strong>en</strong><br />
zoals aanwezig bij het gebruik van e<strong>en</strong> reductie ov<strong>en</strong>, patiëntvri<strong>en</strong>delijk,<br />
urine of speeksel monsters gev<strong>en</strong> dezelfde verrijking<br />
als serum. E<strong>en</strong> nadeel is dat bij het gebruik van e<strong>en</strong><br />
isotoop ratio MS één Faraday cup moet word<strong>en</strong> gerepositioneerd.<br />
83
59. Langere bewaartijd van urine monsters bij kamertemperatuur met behulp van StabilurR tablett<strong>en</strong><br />
W. van GELDER <strong>en</strong> C. PRONK<br />
Klinsch Chemisch laboratorium, Drechtsted<strong>en</strong> Ziek<strong>en</strong>huis Dordrecht<br />
Inleiding: Het basale urineonderzoek biedt de mogelijkheid<br />
om snel <strong>en</strong> betrouwbaar de klinische conditie van nier<strong>en</strong> <strong>en</strong><br />
urineweg<strong>en</strong> te beoordel<strong>en</strong>. E<strong>en</strong> groot nadeel is echter dat de<br />
sam<strong>en</strong>stelling van urine niet stabiel is. Binn<strong>en</strong> <strong>en</strong>kele ur<strong>en</strong> na<br />
lozing zal - zonder de juiste voorzorgsmaatregel<strong>en</strong> - de conc<strong>en</strong>tratie<br />
van e<strong>en</strong> aantal compon<strong>en</strong>t<strong>en</strong> in de urine (bijv. leukocyt<strong>en</strong>)<br />
snel afnem<strong>en</strong>. Daarnaast is de sam<strong>en</strong>stelling van de<br />
urine sterk afhankelijk van het tijdstip van lozing.<br />
In dit onderzoek wordt e<strong>en</strong> e<strong>en</strong>voudige techniek beschrev<strong>en</strong><br />
om urinemonsters gedur<strong>en</strong>de langere tijd (24-48 uur) stabiel te<br />
houd<strong>en</strong> voor basaal urine onderzoek.<br />
Material<strong>en</strong> <strong>en</strong> method<strong>en</strong>: Aan 205 urinemonsters werd binn<strong>en</strong><br />
1 uur na lozing e<strong>en</strong> Stabilur R tablet (Instru<strong>chemie</strong>, Nederland)<br />
toegevoegd <strong>en</strong> de monsters werd<strong>en</strong> gedur<strong>en</strong>de 5 dag<strong>en</strong> bij<br />
kamertemperatuur bewaard. Dagelijks werd de sam<strong>en</strong>stelling<br />
van de monsters beoordeeld met behulp van Multistix reag<strong>en</strong>s<br />
strips afgelez<strong>en</strong> op e<strong>en</strong> Clinitek 200+. De resultat<strong>en</strong> werd<strong>en</strong><br />
geanalyseerd met de Friedman parameter vrije test voor k-gerelateerde<br />
samples.<br />
Resultat<strong>en</strong>: Bij analyse van verse urine monsters (< 2 uur na<br />
lozing) werd ge<strong>en</strong> verschil gevond<strong>en</strong> tuss<strong>en</strong> monsters met <strong>en</strong><br />
zonder Stabilur R . Leukocyt<strong>en</strong>, eiwit, glucose, keton<strong>en</strong>, pH, <strong>en</strong><br />
nitriet resultat<strong>en</strong> vertoond<strong>en</strong> ge<strong>en</strong> statistisch significante verschill<strong>en</strong><br />
gedur<strong>en</strong>de de eerste 5 dag<strong>en</strong>. De erytrocyt<strong>en</strong> conc<strong>en</strong>tratie<br />
daalde significant vanaf dag 2 (p < 0,05), maar dit verschil<br />
verdwe<strong>en</strong> nag<strong>en</strong>oeg wanneer de monsters met e<strong>en</strong><br />
initiële erytrocyt<strong>en</strong> score "spoor" buit<strong>en</strong> beschouwing werd<strong>en</strong><br />
gelat<strong>en</strong>. Deze gegev<strong>en</strong>s werd<strong>en</strong> bevestigd met behulp van<br />
microscopische sedim<strong>en</strong>t analyse.<br />
Inmiddels is in het Drechtsted<strong>en</strong> Ziek<strong>en</strong>huis al e<strong>en</strong> aantal<br />
maand<strong>en</strong> ervaring opgedaan met deze techniek.<br />
Conclusies:<br />
- Met behulp van Stabilur R tablett<strong>en</strong> kan m<strong>en</strong> urinemonsters<br />
gedur<strong>en</strong>de langere tijd (24 - 48 uur) stabiliser<strong>en</strong> bij kamertemperatuur.<br />
- De techniek kan e<strong>en</strong>voudig word<strong>en</strong> geïntroduceerd op klinische<br />
afdeling<strong>en</strong> van ziek<strong>en</strong>huiz<strong>en</strong> <strong>en</strong> vergt ge<strong>en</strong> speciale<br />
apparatuur (bijv. koelkast).<br />
- Op deze wijze wordt e<strong>en</strong> meer efficiënte verwerking van<br />
routine urine onderzoek<strong>en</strong> buit<strong>en</strong> kantoorur<strong>en</strong> bewerkstelligd.<br />
60. Meting van 15 NH3 verrijking voor de bepaling van totaal eiwit turnover, met behulp van de 15 NGlycine methode<br />
B.K. van KREEL<br />
Afdeling klinische <strong>chemie</strong>, Academisch Ziek<strong>en</strong>huis Maastricht<br />
Alhoewel de exacte bepaling van de turnover van e<strong>en</strong> specifiek<br />
eiwit slechts mogelijk is indi<strong>en</strong> de verrijking van de precursor<br />
(m-RNA-AZ) bek<strong>en</strong>d is, wordt al sinds 1949 de<br />
15 NGlycine methode gebruikt om e<strong>en</strong> indruk te krijg<strong>en</strong> over de<br />
gemiddelde eiwit turnover.<br />
In de kliniek wordt deze methode veel gebruikt omdat ze niet<br />
invasief is, weinig tijd kost <strong>en</strong> poliklinisch of zelfs buit<strong>en</strong> het<br />
ziek<strong>en</strong>huis kan plaatsvind<strong>en</strong>. De methode komt er op neer, dat<br />
de patiënt op tijdstip nul e<strong>en</strong> dosis 15 NGlycine drinkt <strong>en</strong><br />
vervolg<strong>en</strong>s gedur<strong>en</strong>de 9 uur zijn urine verzamelt. Aan de hand<br />
van o.a. de 15 NH3 verrijking in de urine kunn<strong>en</strong> de turnover,<br />
afbraak <strong>en</strong> opbouw word<strong>en</strong> berek<strong>en</strong>d. Voor het bepal<strong>en</strong> van de<br />
15 NH3 verrijking is e<strong>en</strong> e<strong>en</strong>voudige methode ontwikkeld.<br />
Urine wordt ev<strong>en</strong>tueel drooggevror<strong>en</strong> ter conc<strong>en</strong>tratie van de<br />
NH3 (in de vorm van NH4Cl), vervolg<strong>en</strong>s wordt dit in e<strong>en</strong><br />
klein volume opgelost. Er wordt nu één “diffusie vaatje” geassembleerd,<br />
bestaande uit e<strong>en</strong> 100 cc flesje waarin 10 µl HCl<br />
61. Dielectrische spectroscopie<br />
B.K. van KREEL<br />
Afdeling klinische <strong>chemie</strong>, Academisch Ziek<strong>en</strong>huis Maastricht<br />
Dielectrische spectroscopie is e<strong>en</strong> fysische methode die wordt<br />
toegepast in o.a. de polymeer <strong>chemie</strong>. E<strong>en</strong> techniek die hieraan<br />
verwant is, is de multi frequ<strong>en</strong>cy-<strong>bio</strong>-impedance (MFBIA). In<br />
principe berust de methode op het feit dat de impedantie die<br />
gemet<strong>en</strong> wordt als gelijkstroom door het lichaam wordt gestuurd,<br />
wordt bepaald door het extracellulaire volume (ECV).<br />
De impedantie bij hoge frequ<strong>en</strong>tie (waar de cell<strong>en</strong> ook geleid<strong>en</strong>)<br />
is e<strong>en</strong> maat voor het totaal lichaamswater (TBW). Indirect<br />
is het dus mogelijk het totale cel volume te bepal<strong>en</strong> (ICV). De<br />
b<strong>en</strong>odigde apparatuur is relatief goedkoop, makkelijk verplaatsbaar<br />
<strong>en</strong> de meetmethode niet invasief. Het ICV is de belangrijkste<br />
parameter voor het vaststell<strong>en</strong> van de voedingstoestand<br />
("Nutritional assessm<strong>en</strong>t"). Indirect kan hiermee ook<br />
op de bodem wordt gepipetteerd. Aan e<strong>en</strong> kleiner flesje (2 cc)<br />
wordt 400 mg CaO gedaan <strong>en</strong> dit wordt in het grote flesje geschov<strong>en</strong>.<br />
Het grote flesje wordt nu met e<strong>en</strong> rubber dop afgeslot<strong>en</strong>.<br />
Vervolg<strong>en</strong>s wordt 100 µl geconc<strong>en</strong>treerde urine door<br />
middel van e<strong>en</strong> injectie op de ongebluste kalk gespot<strong>en</strong>. Het<br />
water wordt chemisch gebond<strong>en</strong> <strong>en</strong> het resulter<strong>en</strong>de NH3 gas<br />
diffundeert in de HCl waarbij het als NH4Cl wordt geïmmobiliseerd.<br />
Na 15' is het diffusie proces t<strong>en</strong> einde. Het NH3 kan<br />
met behulp van hypobromide in N2 word<strong>en</strong> omgezet <strong>en</strong> gemet<strong>en</strong><br />
in e<strong>en</strong> isotoop ratio massa spectrometer (IRMS). De tijd<br />
nodig voor de eig<strong>en</strong>lijke meting is 2 minut<strong>en</strong>; dit is voordelig.<br />
De methode is e<strong>en</strong>voudig snel (de vriesdroog stop is vaak<br />
overbodig), terwijl alle handeling<strong>en</strong> door de onderzoeker zelf<br />
kunn<strong>en</strong> word<strong>en</strong> uitgevoerd tot op het mom<strong>en</strong>t waarop de<br />
hypobromide wordt toegevoegd. Op dit mom<strong>en</strong>t wordt de<br />
methode in Maastricht o.a. gebruikt om het effect van dieet op<br />
kinder<strong>en</strong> met groeistoorniss<strong>en</strong> te bestuder<strong>en</strong>.<br />
de hoeveelheid vet word<strong>en</strong> bepaald. Binn<strong>en</strong> de klinische <strong>chemie</strong><br />
zou het ICV de plaats moet<strong>en</strong> innem<strong>en</strong> van het gewicht bij<br />
de groothed<strong>en</strong> die word<strong>en</strong> uitgedrukt per kg. zoals bij 24-uurs<br />
creatinine uitscheiding per kg., totale eiwit turnover etc. Ook<br />
biedt de MFBIA in principe de mogelijkheid plaatselijk vochtophoping<br />
te kwantificer<strong>en</strong>.<br />
T<strong>en</strong>einde na te gaan in hoeverre deze methode betrouwbare<br />
resultat<strong>en</strong> oplevert, werd e<strong>en</strong> model opgesteld dat de impedantie<br />
van het m<strong>en</strong>selijk lichaam weergeeft. Dit fysisch model<br />
bevat alle fysische parameters zoals l<strong>en</strong>gte, gewicht, specifiek<br />
geleidingsvermog<strong>en</strong> etc., <strong>en</strong> ge<strong>en</strong> groothed<strong>en</strong> waaraan ge<strong>en</strong><br />
fysische betek<strong>en</strong>is kan word<strong>en</strong> toegek<strong>en</strong>d zoals geslacht, leeftijd<br />
etc. E<strong>en</strong> dergelijk model bevat minst<strong>en</strong>s één onbek<strong>en</strong>de<br />
84 Ned Tijdschr Klin Chem 1998, vol. 23, no. 2
onev<strong>en</strong>redigheidsconstante, die moet word<strong>en</strong> bepaald door de<br />
door het model voorspelde TBW <strong>en</strong> ECV, verkreg<strong>en</strong> door impedantie<br />
meting<strong>en</strong> te vergelijk<strong>en</strong> met TBW <strong>en</strong> ECV, die werd<strong>en</strong><br />
bepaald met e<strong>en</strong> verdunningsmethode. Voor deze vergelijking<br />
werd e<strong>en</strong> heterog<strong>en</strong>e groep van patiënt<strong>en</strong> g<strong>en</strong>om<strong>en</strong><br />
waarbij het TBW door D2O verdunning werd bepaald <strong>en</strong> het<br />
TBW werd bepaald door impedantie meting. De correlatie,<br />
uitgevoerd tuss<strong>en</strong> deze twee meting<strong>en</strong>, verschaft ons de onbek<strong>en</strong>de<br />
constante. De regressie coëfficiënt (R 2 = 0.96) is e<strong>en</strong><br />
maat voor het succes van het model. In het ideale geval zal de<br />
asafsnede nul zijn. De verkreg<strong>en</strong> ev<strong>en</strong>redigheidsfactor wordt<br />
nu aan het model toegevoegd. M<strong>en</strong> is nu in staat TBW te bere-<br />
62. Adsorptie aan glas: e<strong>en</strong> valkuil bij de kwantificering van organische zur<strong>en</strong> in urine<br />
Uit resultat<strong>en</strong> van externe kwaliteitscontroleprogramma’s voor<br />
kwantificering van organische zur<strong>en</strong> blijkt dat de gebruikte<br />
method<strong>en</strong> voor verbetering vatbaar zijn. Reproduceerbaarheid<br />
<strong>en</strong> recovery zijn in het algeme<strong>en</strong> matig <strong>en</strong> de spreiding tuss<strong>en</strong><br />
laboratoria is groot. E<strong>en</strong> aantal zak<strong>en</strong> kunn<strong>en</strong> hieraan t<strong>en</strong><br />
grondslag ligg<strong>en</strong>: voorbewerking, keuze van interne standaard,<br />
de manier waarop responsfactor<strong>en</strong> word<strong>en</strong> bepaald, calibratie<br />
van de massadetector etc.<br />
Wij constateerd<strong>en</strong> herhaaldelijk e<strong>en</strong> verschil in regressielijn<strong>en</strong><br />
van m.n. kleine hydroxy-zur<strong>en</strong> v.w.b. lineariteit <strong>en</strong> spreiding<br />
rond de lijn wanneer in de voorbewerking al of niet e<strong>en</strong><br />
ethoximeringsstap werd ingebouwd <strong>en</strong> ook wanneer bij kwantificering<br />
e<strong>en</strong> interne danwel externe standaardmethode werd<br />
gebruikt. Vermoedelijk speelde adsorptie aan glas hierbij e<strong>en</strong><br />
rol. Dit f<strong>en</strong>ome<strong>en</strong> werd nader onderzocht.<br />
1 E<strong>en</strong> m<strong>en</strong>gstandaard van e<strong>en</strong> neg<strong>en</strong>tal organische zur<strong>en</strong><br />
(hydroxy- <strong>en</strong> niet hydroxy-zur<strong>en</strong>) in methanol werd in<br />
vijfvoud in glasbuiz<strong>en</strong> (regelmatig gebruikt <strong>en</strong> o.a. met<br />
zuur gereinigd), gesilyleerde glasbuiz<strong>en</strong> <strong>en</strong> teflonbuiz<strong>en</strong><br />
gepipetteerd, drooggedampt <strong>en</strong> gesilyleerd.<br />
2 Dezelfde m<strong>en</strong>gstandaard, opgelost in gestripte urine, werd<br />
in verschill<strong>en</strong>de conc<strong>en</strong>traties in twee-voud in glasbuiz<strong>en</strong><br />
Ned Tijdschr Klin Chem 1998, vol. 23, no. 2<br />
k<strong>en</strong><strong>en</strong> met behulp van impedantie meting<strong>en</strong>. Bij e<strong>en</strong> nieuwe<br />
groep patiënt<strong>en</strong> werd nu TBW bepaald door middel van<br />
MFBIA <strong>en</strong> tev<strong>en</strong>s door D2O dilutie. De resultat<strong>en</strong> werd<strong>en</strong><br />
vergelek<strong>en</strong> door middel van de methode van Altman, met als<br />
resultaat dat twee keer de SD van de grootheid TBWD2O –<br />
TBWBIA kleiner is dan 3 l. Dit resultaat stemt optimistisch.<br />
Echter, de mogelijkhed<strong>en</strong> van de impedantie meting<strong>en</strong> zijn<br />
hierbij niet uitgeput. Indi<strong>en</strong> in de toekomst door verder onderzoek<br />
blijkt dat TBW op deze manier betrouwbaar bij iedere<br />
individuele patiënt gebruikt kan word<strong>en</strong>, heeft het de voorkeur<br />
bov<strong>en</strong> D2O verdunning, mede omdat de resultat<strong>en</strong> binn<strong>en</strong> de 5<br />
minut<strong>en</strong> (inclusief rek<strong>en</strong><strong>en</strong>) beschikbaar zijn.<br />
A.A.J. van LANDEGHEM 1 , Y. SOMERS-PIJNENBURG 1 , W. SOMERS 1 , C. STOKWIELDER 1 , W. de BRUYN 1 <strong>en</strong><br />
G. van d<strong>en</strong> BERG 2<br />
C<strong>en</strong>traal Klinisch Chemisch <strong>en</strong> Hematologisch Laboratorium, St. Elisabeth Ziek<strong>en</strong>huis, Tilburg 1 <strong>en</strong> De Hondsberg, Oisterwijk 2<br />
63. De ABL SYSTEM 625 glucose <strong>bio</strong>s<strong>en</strong>sor: lev<strong>en</strong>sduur <strong>en</strong> betrouwbaarheid<br />
H. M. BAKKER <strong>en</strong> P. BIJSTER<br />
C<strong>en</strong>trum <strong>Klinische</strong> Laboratoria, Martini Ziek<strong>en</strong>huis, Groning<strong>en</strong><br />
De belangstelling voor betrouwbare glucose meting<strong>en</strong> in volbloed<br />
met korte ‘turn around time’ is de laatste jar<strong>en</strong> toeg<strong>en</strong>om<strong>en</strong>.<br />
We hebb<strong>en</strong> de performance van de RADIOMETER ABL 625<br />
glucose <strong>bio</strong>s<strong>en</strong>sor membraan over e<strong>en</strong> periode van 12 wek<strong>en</strong><br />
getest. De door de fabrikant gegarandeerde lev<strong>en</strong>sduur is 1<br />
maand. Dit is gedaan door dagelijks vier levels van RADIO-<br />
METER QUALICHECK 4 Metabolite te met<strong>en</strong> in <strong>en</strong>kelvoud.<br />
De streefwaard<strong>en</strong> voor de 4 kwaliteits controles war<strong>en</strong><br />
respectievelijk 13,2 ± 1,5; 5,6 ± 0,8; 2,4 ± 0,5 <strong>en</strong> -0,1 ± 0,4<br />
mM glucose (gemiddelde ± controle gr<strong>en</strong>z<strong>en</strong>). Gevond<strong>en</strong> over<br />
de hele periode werd respectievelijk 13,1 ± 0,37; 5,6 ± 0,14;<br />
2,3 ± 0,08 <strong>en</strong> -0,1 ± 0,10 mM glucose (gemiddelde ± SD).<br />
Over de totale periode bezi<strong>en</strong> was er alle<strong>en</strong> in de QC met hoge<br />
glucose (level 1) e<strong>en</strong> geringe dal<strong>en</strong>de tr<strong>en</strong>d zichtbaar.<br />
Dagelijks werd<strong>en</strong> ook drie plasma pools gemet<strong>en</strong>, aan twee<br />
pools was extra glucose toegevoegd. De pools werd<strong>en</strong> ‘at random’<br />
in triplo gemet<strong>en</strong>. De gemiddelde glucose conc<strong>en</strong>traties<br />
in de pools war<strong>en</strong> respektievelijk: pool A 6,0 mM, pool B 10,1<br />
mM <strong>en</strong> pool C 25,0 mM glucose. De berek<strong>en</strong>de variatie coëfficiënt<strong>en</strong><br />
voor de drie pools over de 12 weeks periode zijn<br />
(weergegev<strong>en</strong> als % VC):<br />
<strong>en</strong> teflonbuiz<strong>en</strong> gepipetteerd, geëthoximeerd, aangezuurd,<br />
verzadigd met NaCl, geëxtraheerd, drooggedampt <strong>en</strong> gesilyleerd.<br />
De monsters werd<strong>en</strong> pulse-splitless geïnjecteerd op e<strong>en</strong> HP<br />
5890 gaschromatograaf, gekoppeld aan e<strong>en</strong> HP 5971 A massaselectieve<br />
detector.<br />
De respons (recovery) van hydroxy-zur<strong>en</strong> <strong>en</strong> in mindere mate<br />
van 3-ph<strong>en</strong>yl-boterzuur (interne standaard) is nag<strong>en</strong>oeg gehalveerd<br />
t.o.v. teflon <strong>en</strong> gesilyleerd glas wanneer in gewoon glas<br />
wordt gewerkt. Voor niet-hydroxy-zur<strong>en</strong> wordt dit verschil<br />
niet gevond<strong>en</strong>. Tuss<strong>en</strong> gesilyleerd glas <strong>en</strong> teflon bestaat ge<strong>en</strong><br />
verschil.<br />
Variatiecoëfficiënt<strong>en</strong> van respons van hydroxy-zur<strong>en</strong> <strong>en</strong> 3ph<strong>en</strong>yl-boterzuur<br />
zijn dramatisch hoger wanneer in glas wordt<br />
gewerkt <strong>en</strong> variër<strong>en</strong> van 15 tot 35%. In gesilyleerd glas <strong>en</strong><br />
teflon blijv<strong>en</strong> die voor zowel hydroxy- als niet-hydroxy-zur<strong>en</strong><br />
onder de 7%.<br />
De regressielijn<strong>en</strong> van kleine hydroxy-zur<strong>en</strong>, voorbewerkt in<br />
glas, gaan niet door nul, i.t.t. die in teflon. Pas bij hogere conc<strong>en</strong>traties<br />
wordt de respons lineair.<br />
Voor betrouwbare kwantificering van organische zur<strong>en</strong> is het<br />
gebruik van teflon of gesilyleerd glaswerk aan te bevel<strong>en</strong>.<br />
within run day-to-day totaal<br />
pool A 1,6 1,5 2,2<br />
pool B 1,3 1,3 1,8<br />
pool C 1,2 2,0 2,3<br />
Van e<strong>en</strong> aantal monsters (N=18) werd de resultat<strong>en</strong> verkreg<strong>en</strong><br />
met de ABL 625 vergelek<strong>en</strong> met de BECKMAN SYNCHRON<br />
CX-7. Uit e<strong>en</strong> heparine-gelbuis met bloed werd, na afkoeling<br />
op ijswater, met e<strong>en</strong> injectiespuit e<strong>en</strong> monster getrokk<strong>en</strong> <strong>en</strong> in<br />
duplo gemet<strong>en</strong> op de ABL 625. Tegelijkertijd werd de gelbuis<br />
koud afgedraaid. Uit de plasmafase werd glucose op de CX-7<br />
bepaald. De correlatie volg<strong>en</strong>s Passing-Bablok geeft de lijn:<br />
ABL = -0,325 + 0,987*CX-7; r (lineaire regressie) = 0,998.<br />
Conclusie: De glucose meting op de ABL625 is betrouwbaar<br />
<strong>en</strong> de lev<strong>en</strong>sduur van de membran<strong>en</strong> is aanzi<strong>en</strong>lijk langer dan<br />
de gespecificeerde maand. Vergelijking met SYNCHRON<br />
CX-7 levert e<strong>en</strong> goede correlatie op.<br />
85
64. De ABL SYSTEM 625 lactaat <strong>bio</strong>s<strong>en</strong>sor, lev<strong>en</strong>sduur <strong>en</strong> betrouwbaarheid<br />
H. M. BAKKER <strong>en</strong> P. BIJSTER<br />
C<strong>en</strong>trum <strong>Klinische</strong> Laboratoria, Martini Ziek<strong>en</strong>huis,Groning<strong>en</strong><br />
De laatste jar<strong>en</strong> is de belangstelling voor lactaat meting<strong>en</strong> in<br />
volbloed toeg<strong>en</strong>om<strong>en</strong>. Lactaat conc<strong>en</strong>traties kunn<strong>en</strong> di<strong>en</strong><strong>en</strong> als<br />
e<strong>en</strong> prognostische index <strong>en</strong> gev<strong>en</strong> e<strong>en</strong> indicatie van metabole<br />
ontregeling bij ernstig zieke pati<strong>en</strong>t<strong>en</strong>.<br />
We hebb<strong>en</strong> de performance van de RADIOMETER ABL 625<br />
lactaat <strong>bio</strong>s<strong>en</strong>sor membraan over e<strong>en</strong> periode van 12 wek<strong>en</strong><br />
getest. De door de fabrikant gegarandeerde lev<strong>en</strong>sduur is 1<br />
maand. Dit is gedaan door dagelijks vier levels van RADIO-<br />
METER QUALICHECK 4 Metabolite te met<strong>en</strong> in <strong>en</strong>kelvoud.<br />
De streefwaard<strong>en</strong> voor de 4 kwaliteits controles war<strong>en</strong><br />
respectievelijk 9,0 ± 1,2; 4,5 ± 0,7; 1,3 ± 0,4 <strong>en</strong> -0,1 ± 0,4 mM<br />
lactaat (gemiddelde ± controle gr<strong>en</strong>z<strong>en</strong>). Gevond<strong>en</strong> over de<br />
hele periode werd respectievelijk 8,9 ± 0,14; 4,4 ± 0,08; 1,3 ±<br />
0,02 <strong>en</strong> 0,0 ± 0,05 mM lactaat (gemiddelde ± SD). Over de<br />
totale periode bezi<strong>en</strong> was er ge<strong>en</strong> stijg<strong>en</strong>d of dal<strong>en</strong>de tr<strong>en</strong>d<br />
zichtbaar.<br />
Dagelijks werd<strong>en</strong> ook drie plasma pools gemet<strong>en</strong>, aan twee<br />
pools was extra lactaat toegevoegd. De pools werd<strong>en</strong> ‘at random’<br />
in triplo gemet<strong>en</strong>. De gemiddelde lactaat conc<strong>en</strong>traties in<br />
de pools war<strong>en</strong> respektievelijk: pool A 1,8 mM, pool B 9,2<br />
mM <strong>en</strong> pool C 4,6 mM lactaat. De berek<strong>en</strong>de variatie coëfficiënt<strong>en</strong><br />
voor de drie pools over de 12 weeks periode zijn<br />
(weergegev<strong>en</strong> als % VC):<br />
<strong>Klinische</strong> studies<br />
Allergie<br />
Pati<strong>en</strong>ts with allergic bronchopulmonary aspergillosis (ABPA)<br />
contain increased conc<strong>en</strong>trations of both A.fumigatus-specific<br />
IgG (IgG-Af) and A.fumigatus-specific IgE (IgE-Af). Because<br />
the conc<strong>en</strong>tration of IgG-Af is more than 100 times higher<br />
than the conc<strong>en</strong>tration of IgE-Af, IgG-Af will compete for the<br />
binding of IgE-Af to Af-antig<strong>en</strong>s as measured by means of<br />
RASTs.<br />
In order to study the effect of IgG-Af in the RASTs for IgE-Af<br />
(M3), I determined IgE-Af in sera from pati<strong>en</strong>ts with ABPA<br />
in differ<strong>en</strong>t ways: in neat serum (a), in diluted serum (b), and<br />
in diluted serum after adsorption of IgG on protein A-<br />
Sepharose (c).<br />
Results for IgE-Af, in U/ml, were as follows.<br />
a: 1.2 – 80 (mean 23)<br />
within run day-to-day totaal<br />
pool A 3,1 2,0 3,7<br />
pool B 1,5 1,9 2,4<br />
pool C 1,7 1,6 2,3<br />
Van e<strong>en</strong> aantal monsters (N=18) werd de resultat<strong>en</strong> verkreg<strong>en</strong><br />
met de ABL 625 vergelek<strong>en</strong> met de op lactaatdehydrog<strong>en</strong>ase<br />
gebaseerde methode van Sigma. Uit e<strong>en</strong> heparine-gelbuis met<br />
bloed werd, na afkoeling op ijswater, met e<strong>en</strong> injectiespuit e<strong>en</strong><br />
monster getrokk<strong>en</strong> <strong>en</strong> in duplo gemet<strong>en</strong> op de ABL 625. Tegelijkertijd<br />
werd de gelbuis koud afgedraaid. Van de plasmafase<br />
werd 0,5 ml overgebracht in 1,0 ml koude perchloorzuur. Uit<br />
het supernatant werd in duplo lactaat bepaald volg<strong>en</strong>s de<br />
Sigma methode. De correlatie volg<strong>en</strong>s Passing-Bablok geeft<br />
de lijn: ABL=0,102 + 0,961*Sigma; r (lineaire regressie) =<br />
0,999.<br />
Conclusie: De lactaat meting op de ABL625 is betrouwbaar <strong>en</strong><br />
de lev<strong>en</strong>sduur van de membran<strong>en</strong> is aanzi<strong>en</strong>lijk langer dan de<br />
gespecificeerde maand. Vergelijking met de bewerkelijke<br />
Sigma methode levert e<strong>en</strong> goede correlatie op.<br />
65. Aspergillus fumigatus – specific IgG and IgE in pati<strong>en</strong>ts with allergic bronchopulmonary aspergillosis<br />
J. BROUWER<br />
Diagnostic C<strong>en</strong>tre SSDZ Delft, The Netherlands<br />
Neurologie <strong>en</strong> psychiatrie<br />
66. Pretherapeutisch g<strong>en</strong>otyper<strong>en</strong> van cytochroom P450 2D6<br />
Veel psychotrope g<strong>en</strong>eesmiddel<strong>en</strong> word<strong>en</strong> gemetaboliseerd<br />
door het cytochroom P450 2D6 (CYP2D6) <strong>en</strong>zym systeem.<br />
Individu<strong>en</strong> met e<strong>en</strong> bepaald CYP2D6 g<strong>en</strong>otype hebb<strong>en</strong> e<strong>en</strong><br />
verhoogde kans op bijwerking<strong>en</strong> bij normdosering, ander<strong>en</strong><br />
b: 4 – 320 (mean 74)<br />
c: 5 – 350 (mean 80).<br />
Conclusions:<br />
- Wh<strong>en</strong> neat serum from pati<strong>en</strong>ts with ABPA is used in the<br />
RAST for IgE-Af (M3), the measured conc<strong>en</strong>tration is<br />
underestimated by a factor 1.4 – 7.5 (mean 3.2).<br />
- Wh<strong>en</strong> IgE-Af is reported in RAST classes (0 to 5 +) the<br />
results obtained with diluted sera differ from the results<br />
obtained with undiluted sera with 0 (n=5), 1 (n=9) or 2<br />
(n=1) class(es). Results in U/ml should only be reported<br />
after analyses of diluted sera.<br />
- IgE-Af can be determined in diluted sera without the need<br />
to remove IgG<br />
M.A.M. BON 1 , F.A.J.T.M van d<strong>en</strong> BERGH 1 , C. NEEF 2 , E. NOORTHOORN 3 , E. ZIJLSTRA 3 , H. KRAAN 3 <strong>en</strong><br />
I. VERMES 1<br />
Klinisch Chemisch Laboratorium 1 , <strong>Klinische</strong> Farmacie 2 , Medisch Spectrum Tw<strong>en</strong>te, Tw<strong>en</strong>ts Psychiatrisch Ziek<strong>en</strong>huis 3 , Enschede<br />
hebb<strong>en</strong> juist e<strong>en</strong> verlaagde gevoeligheid voor het g<strong>en</strong>eesmiddel.<br />
Er zijn drie typ<strong>en</strong> metaboliseerders:<br />
- Ext<strong>en</strong>sive metabolisers (EM): individu<strong>en</strong> met e<strong>en</strong> normale<br />
dosis-respons-curve.<br />
86 Ned Tijdschr Klin Chem 1998, vol. 23, no. 2
- Poor metabolisers (PM): individu<strong>en</strong> met e<strong>en</strong> verl<strong>en</strong>gde<br />
dosis-respons-curve. Het g<strong>en</strong>eesmiddel wordt langzamer<br />
omgezet <strong>en</strong> dus meer kans op bijwerking<strong>en</strong>.<br />
- Ultra-ext<strong>en</strong>sive metabolisers (UEM): te snelle dosis-responscurve.<br />
Het anti-depressivum nortriptyline (NT) wordt alle<strong>en</strong> door het<br />
CYP2D6 <strong>en</strong>zymsysteem gemetaboliseerd. Dit houdt in dat het<br />
e<strong>en</strong> zeer goed te gebruik<strong>en</strong> substraat is voor studies naar f<strong>en</strong>o<strong>en</strong><br />
g<strong>en</strong>otypering. De studie is gericht op het vaststell<strong>en</strong> van de<br />
specificiteit van de g<strong>en</strong>otypering van CYP2D6 als voorspeller<br />
van de relatie tuss<strong>en</strong> bloedspiegel <strong>en</strong> dosering van het g<strong>en</strong>eesmiddel<br />
NT. De veronderstelling is dat als de g<strong>en</strong>otypering de<br />
relatie tuss<strong>en</strong> bov<strong>en</strong>g<strong>en</strong>oemde e<strong>en</strong>duidig voorspelt, de g<strong>en</strong>otypering<br />
hulpmiddel zou moet<strong>en</strong> zijn bij het instell<strong>en</strong> van het<br />
g<strong>en</strong>eesmiddel.<br />
Retrospectief word<strong>en</strong> bij patiënt<strong>en</strong> die NT gebruik<strong>en</strong> het g<strong>en</strong>otype<br />
van CYP2D6 mutatie *3 <strong>en</strong> mutatie *4 bepaald. Hierbij<br />
kunn<strong>en</strong> van elke mutatie drie g<strong>en</strong>otypes word<strong>en</strong> onderscheid<strong>en</strong>:<br />
de wildtype (normaal), heterozygote <strong>en</strong> homozygote<br />
vorm. DNA wordt geïsoleerd uit volbloed (QIAamp blood kit,<br />
Hart- <strong>en</strong> vaatziekt<strong>en</strong><br />
Introduction: Troponin I and -T are new specific markers for<br />
myocardial tissue damage. Rec<strong>en</strong>tly, a new surgical technic<br />
called minimal invasive coronary artery bypass grafting<br />
(MICABG) has be<strong>en</strong> developed. In this type of procedure,<br />
surgery is performed on the beating heart without the use of<br />
the cardiopulmonary bypass (CPB). The aim of this study is to<br />
evaluate the influ<strong>en</strong>ce of CPB on myocardial tissue damage by<br />
comparing troponin I and -T in pati<strong>en</strong>ts treated with MICABG<br />
or conv<strong>en</strong>tional coronary artery bypass grafting.<br />
Pati<strong>en</strong>ts and methods: T<strong>en</strong> pati<strong>en</strong>ts scheduled for cardiac<br />
surgery were included. Five pati<strong>en</strong>ts received conv<strong>en</strong>tional<br />
treatm<strong>en</strong>t using CPB, the other five were treated according to<br />
the MICABG protocol without CPB. Blood specim<strong>en</strong>s were<br />
obtained at 0, 1, 2, 3, 6, 9, 12, 18 and 24 hours after op<strong>en</strong>ing<br />
of the graft. In these sera troponin I and -T were measured.<br />
Troponin I (TnI-Ac) was measured with an Access analyzer<br />
(Beckman Instrum<strong>en</strong>ts, Mijdrecht, The Netherlands) and with<br />
an AxSym analyzer (TnI-Ax) (Abbott, Amstelve<strong>en</strong>, The<br />
Netherlands. Troponin T was determined with an Elecsys 2010<br />
analyzer (Boehringer Mannheim, Almere, The Netherlands).<br />
Troponin I and -T conc<strong>en</strong>trations are expressed as mean<br />
± standard deviation (sd) and tested using Stud<strong>en</strong>t t-test.<br />
P values
Troponin I (TnI-Ac) measurem<strong>en</strong>ts were carried out with an<br />
Access analyzer (Beckman Instrum<strong>en</strong>ts, Mijdrecht, The<br />
Netherlands) and with an AxSym analyzer (TnI-Ax) (Abbott,<br />
Amstelve<strong>en</strong>, The Netherlands). Troponin T (TnT) was measured<br />
with an Elecsys 2010 analyzer (Boehringer Mannheim,<br />
Almere, The Netherlands). Myoglobin was analyzed with a<br />
Behring Nephelometer (Behring Diagnostics, Rijswijk, The<br />
Netherlands) and HBDH activities were measured with a<br />
Mega analyzer (Merck, Amsterdam, The Netherlands).<br />
For statistical analysis ANOVA was used.<br />
Results: Intra-individual: for TnI-Ac, TnI-Ax, TnT no significant<br />
differ<strong>en</strong>ces could be detected betwe<strong>en</strong> the 7 locations in<br />
Introduction: Measurem<strong>en</strong>ts of cardiac marker proteins in<br />
plasma from pati<strong>en</strong>ts with acute myocardial infarction (AMI)<br />
have become important in the evaluation of recanalization<br />
therapy. The validity of this approach has however be<strong>en</strong> questioned,<br />
because it was claimed that coronary reperfusion may<br />
increase the recovery in plasma of cardiac <strong>en</strong>zymes, such as<br />
creatine kinase (CK).<br />
Aim: In the pres<strong>en</strong>t study, possible effects of thrombolytic<br />
therapy on the release of <strong>en</strong>zymatic and non-<strong>en</strong>zymatic marker<br />
proteins were investigated.<br />
Methods: Activities of creatine kinase (CK) and lactate dehydrog<strong>en</strong>ase<br />
(LDH), and conc<strong>en</strong>trations of myoglobin (Mb) and<br />
fatty acid binding protein (FABP) were determined in serial<br />
plasma samples obtained frequ<strong>en</strong>tly (and for at least 72 hours<br />
for CK and LDH or 24 hours for FABP and Mb) after admission<br />
to the hospital in 50 pati<strong>en</strong>ts with confirmed AMI.<br />
Thirtysix pati<strong>en</strong>ts received thrombolytic therapy (1.5 million<br />
units of streptokinase (SK), infused in 40-80 minutes, or a<br />
bolus of 10 million units recombinant tissue-type plasminog<strong>en</strong><br />
activator (tPA)), and 14 pati<strong>en</strong>ts did not. Cumulative release<br />
(Q), i.e. infarct size (mean " SEM), of the differ<strong>en</strong>t cardiac<br />
markers was calculated by using a two compartm<strong>en</strong>t model<br />
for circulating proteins and was expressed in gram-equival<strong>en</strong>ts<br />
of healthy myocardium per liter of plasma (g-eq/l) for all<br />
4 marker proteins. Altered recovery in plasma of marker<br />
proteins was estimated from the release ratios (-CK/LDH,<br />
FABP/LDH, Mb/LDH, CK/Mb, CK/FABP, Mb/FABP).<br />
Results: Hospital delays were 2.8 ± 1.6 (mean ± SD) hours<br />
and 2.7 ± 1.8 hours in treated and untreated pati<strong>en</strong>ts, respectively.<br />
In pati<strong>en</strong>ts treated with thrombolytic therapy, average<br />
infarct size varied betwe<strong>en</strong> 5.5 and 7.2 g-eq/l for the 4 marker<br />
proteins, and in untreated pati<strong>en</strong>ts betwe<strong>en</strong> 4.6 and 6.4 g-eq/l,<br />
with a t<strong>en</strong>d<strong>en</strong>cy to larger infarct sizes for Mb and FABP than<br />
for CK and LDH. Thrombolytic therapy, although signifi-<br />
70. Influ<strong>en</strong>ce of mammary artery as a bypass vessel on the results of sev<strong>en</strong> <strong>bio</strong>chemi-cal assays after coronary<br />
artery bypass surgery<br />
G.A. HARFF 1 , M.J.A. van d<strong>en</strong> BOSCH 1 and J.P.A.M. SCHONBERGER 2<br />
Departm<strong>en</strong>ts of Clinical Laboratories 1 and Cardiopulmonary Surgery 2 , Catharina Hospital, Eindhov<strong>en</strong><br />
The aim of this study is to assess the influ<strong>en</strong>ce of the various<br />
cardiac grafting methods on the results of troponin T, CK-MB<br />
mass and the <strong>en</strong>zyme activities of CK-MB, CK, HBD, LD and<br />
AST after coronary artery bypass graft (CABG) surgery.<br />
There is evid<strong>en</strong>ce that pati<strong>en</strong>ts having received one or two<br />
internal mammary artery grafts have improved long term sur-<br />
the myocardium, it seems that there is a t<strong>en</strong>d<strong>en</strong>cy for lower<br />
values in the atria. Both HBDH and myoglobin are lower in<br />
atrium R and in atrium L compared to the other myocardial<br />
locations.<br />
Inter-individual: for TnI-Ax, TnT, HBDH and myoglobin no<br />
relevant differ<strong>en</strong>ces could be detected; the TnI-Ac cont<strong>en</strong>t was<br />
in one pati<strong>en</strong>t lower than in the other pati<strong>en</strong>ts.<br />
Conclusions: It seems that TnI-Ac, TnI-Ax and TnT are<br />
homog<strong>en</strong>eous distributed in the myocardium, and that HBDH<br />
and myoglobin in the atria are lower than in the v<strong>en</strong>tricles.<br />
A larger study should be carried out to investigate the signifigance<br />
and relevance of the intra- and inter-individual findings.<br />
69. Thrombolytic therapy does not influ<strong>en</strong>ce the ratios of released myocardial marker proteins<br />
K.W.H. WODZIG 1 , J.A. KRAGTEN 2 , W. MODRZEJEWSKI 3 , J. GORSKI 4 , M.P. van DIEIJEN-VISSER 1 , J.F.C. GLATZ 5<br />
and W.Th. HERMENS 5<br />
Departm<strong>en</strong>t of Clinical Chemistry 1 , Academic Hospital Maastricht, Maastricht, Departm<strong>en</strong>t of Cardiology 2 , Hospital De Wever <strong>en</strong><br />
Gregorius, Heerl<strong>en</strong>, The Netherlands, Departm<strong>en</strong>t of Cardiology 3 and Physiology 4 , Medical School of Bialystok, Bialystok, Poland<br />
and Cardiovascular Research Institute Maastricht 5 , University, Maastricht, The Netherlands<br />
cantly accelerating protein release rates, did not influ<strong>en</strong>ce the<br />
release ratios (see table 1).<br />
Table 1. Pati<strong>en</strong>t Characteristics<br />
Thrombolytic No thrombolytic<br />
treatm<strong>en</strong>t treatm<strong>en</strong>t<br />
Number of pati<strong>en</strong>ts 36 14<br />
Age (mean ± SD, years) 57.7+9.2* 66.0+11.0<br />
Thrombolytic treatm<strong>en</strong>t SK / tPA ( 27 / 9 ) no<br />
Treatm<strong>en</strong>t delay or time 2.8+1.6 2.7+1.8<br />
to admission (hours)<br />
Infarct size (g-eq/l) mean + SEM mean + SEM<br />
LDH (Q72) 5.5+0.7 4.8+1.0<br />
CK (Q72) 5.2+0.8 4.6+1.3<br />
FABP (Q24) 7.2+1.0 6.4+1.7<br />
Mb (Q24) 6.5+0.9 6.0+2.0<br />
Ratio of infarct sizes mean + SEM mean + SEM<br />
CK/LDH 0.92+0.05 0.93+0.12<br />
FABP/LDH 1.38+0.12 1.37+0.17<br />
Mb/LDH 1.19+0.09 1.12+0.18<br />
CK/Mb 0.84+0.05 0.84+0.16<br />
CK/FABP 0.75+0.05 0.80+0.15<br />
Mb/FABP 0.92+0.06 0.89+0.08<br />
*: p < 0.01 vs no thrombolytic treatm<strong>en</strong>t<br />
Conclusion: These results indicate that thrombolytic therapy<br />
has no significant effects on the recovery of cardiac marker<br />
proteins in plasma.<br />
vival. However, compared to the use of solely vein grafts, the<br />
use of internal mammary arteries may induce a large surgical<br />
trauma which may cause higher levels of <strong>bio</strong>chemical assays<br />
after surgery.<br />
Sev<strong>en</strong>ty three pati<strong>en</strong>ts undergoing CABG surgery were followed<br />
pre- and post operatively by performing the assays in<br />
88 Ned Tijdschr Klin Chem 1998, vol. 23, no. 2
consideration. Of the 73 pati<strong>en</strong>ts, 17 underw<strong>en</strong>t coronary<br />
artery bypass grafting using autologous saph<strong>en</strong>ous vein grafts<br />
(SVG), 32 pati<strong>en</strong>ts received saph<strong>en</strong>ous vein grafts in addition<br />
to a single internal mammary artery as a bypass vessel (IMA),<br />
whe-reas 24 pati<strong>en</strong>ts received saph<strong>en</strong>ous vein grafts in addition<br />
to bilateral internal mammary arteries (BIMA).<br />
After surgery almost all pati<strong>en</strong>ts showed elevated levels for all<br />
the assays. The two specific assays, troponin T and CK-MB<br />
mass differed much in release pattern: troponin T results were<br />
Interne g<strong>en</strong>eeskunde<br />
71. Faecal leucocyte esterase in inflammatory bowel disease<br />
Several markers have be<strong>en</strong> studied in the disease assessm<strong>en</strong>t<br />
of inflammatory bowel disease (IBD), but they have not<br />
become widely integrated in daily routine practice, because of<br />
complexity and costs.<br />
Our objective was to determine whether measurem<strong>en</strong>t of<br />
faecal leucocyte esterase (FLE) provides a simple, rapid and<br />
inexp<strong>en</strong>sive test for disease assessm<strong>en</strong>t of IBD. FLE was<br />
determined semi-quantitatively in stool extracts of 104<br />
pati<strong>en</strong>ts with Crohn’s disease (CD), 41 pati<strong>en</strong>ts with colitis<br />
ulcerosa (CU) and 35 controls, using Multistix 2 strips<br />
(Bayer). Results were compared with the Crohn’s disease<br />
activity index (CDAI) in CD and Truelove-Witts grading in<br />
CU.<br />
FLE titers were significantly higher in CD <strong>en</strong> CU than in controls.<br />
There was a significant correlation betwe<strong>en</strong> FLE titers<br />
Ned Tijdschr Klin Chem 1998, vol. 23, no. 2<br />
still elevated at 70 h while CK-MB mass results had returned<br />
to almost preoperative levels.<br />
Surprisingly, the median values for troponin T at all five sampling<br />
times after surgery are lower for the pati<strong>en</strong>t groups who<br />
received one or two internal mammary artery(ies) in comparison<br />
to the pati<strong>en</strong>t group who received only saph<strong>en</strong>ous vein<br />
grafts. The median CK values after surgery were considerably<br />
higher for the IMA and the BIMA pati<strong>en</strong>t groups rather than<br />
the SVG pati<strong>en</strong>t group.<br />
A. van der SLUYS VEER, J. BROUWER 1 , I. BIEMOND, G.E. BOHBOUT, H.W. VERSPAGET and C.B.H.W. LAMERS<br />
Dept of Gastro<strong>en</strong>terology and Hepatology, Leid<strong>en</strong> University Medical C<strong>en</strong>tre and Dept of Clinical Chemistry 1 , Diagnostic C<strong>en</strong>tre<br />
SSDZ, Delft<br />
and CDAI (r = 0.34; p < 0.005; n = 86) in pati<strong>en</strong>ts with CD<br />
and with Truelove-Witts grading (r = 0.53; p < 0.0005; n = 41)<br />
in CU.<br />
Wh<strong>en</strong> a CDAI of 150 or more was used as standard for<br />
activity of CD, FLE was elevated in 50 perc<strong>en</strong>t of active<br />
disease. In CU FLE was increased in 65 perc<strong>en</strong>t of grade II<br />
and 87 perc<strong>en</strong>t of grade III compared to 22 perc<strong>en</strong>t of grade I<br />
pati<strong>en</strong>ts.<br />
The PV + and PV – were 88% and 20% in CD, and 92% and<br />
47% in CU.<br />
Interpretation of the results is hampered by the abs<strong>en</strong>ce of a<br />
gold standard for activity of IBD. Theoretically, the results<br />
might be better or worse if such a standard would be available.<br />
The simplicity, the low costs and the wide availability support<br />
the application of the FLE test in clinical practice.<br />
72. Spectrophotometric determination and evaluation of hydrog<strong>en</strong> peroxide in expired breath cond<strong>en</strong>sates<br />
W.B.M. GERRITSEN, D. van LOON and F.J.L.M. HAAS<br />
Departm<strong>en</strong>t of Clinical Chemistry, Sint Antonius Hospital, Nieuwegein, The Netherlands<br />
Well over 90% of respired oxyg<strong>en</strong> undergoes tetraval<strong>en</strong>t<br />
reduction via multiple electron-carrying <strong>en</strong>zymes pres<strong>en</strong>t in<br />
mitochondria, producing water without discharging any<br />
harmful intermediates. Of the toxic reactive intermediates<br />
produced, superoxide, hydrog<strong>en</strong> peroxide and the hydroxyl<br />
radicals are the species most ext<strong>en</strong>sively studied. Hydrog<strong>en</strong><br />
peroxide is pot<strong>en</strong>tially one of the most harmful species of<br />
oxyg<strong>en</strong> metabolism. A clear association betwe<strong>en</strong> lung injury<br />
and hydrog<strong>en</strong> peroxide in expired breath has be<strong>en</strong> demonstrated.<br />
In several types of acute lung disease, especially Adult<br />
Respiratory Distress Syndrome (ARDS) and Chronic Obstructive<br />
Pulmonary Disease (COPD), polymorphonuclear<br />
leucocytes in the alveolar infiltrates release toxic oxyg<strong>en</strong><br />
metabolites. Many investigators studied hydrog<strong>en</strong> peroxide in<br />
expired breath cond<strong>en</strong>sates using differ<strong>en</strong>t techniques to determine<br />
the conc<strong>en</strong>tration of hydrog<strong>en</strong> peroxide.<br />
Thereby we measured hydrog<strong>en</strong> peroxide in expired breath<br />
cond<strong>en</strong>sate from appar<strong>en</strong>tly healthy persons of which 15 were<br />
non-smokers and 15 were smokers (more than 10 cigarettes<br />
per day) and compared this group with elective thoracic<br />
surgery - and COPD pati<strong>en</strong>ts using the spectrophotometric<br />
method described by Gallati and Pracht (1).<br />
Pati<strong>en</strong>ts undergoing elective thoracic surgery showed hydrog<strong>en</strong><br />
peroxide levels near or below the detection limit before<br />
surgery. After surgery an increase of hydrog<strong>en</strong> peroxide was<br />
observed especially in pati<strong>en</strong>ts undergoing a lobectomy.<br />
Pati<strong>en</strong>ts suffering unstable COPD showed an increase of<br />
hydrog<strong>en</strong> peroxide conc<strong>en</strong>tration in their expired breath cond<strong>en</strong>sate<br />
wh<strong>en</strong> compared to the stable COPD pati<strong>en</strong>ts. It is<br />
likely that this result is caused by pulmonary infiltrates. During<br />
treatm<strong>en</strong>t hydrog<strong>en</strong> peroxide levels decrease within 10 days.<br />
We calculated the refer<strong>en</strong>ce intervals in appar<strong>en</strong>tly healthy<br />
persons by dividing this group in smokers and non-smokers.<br />
The hydrog<strong>en</strong> peroxide level in non-smokers was below the<br />
detection limit. The hydrog<strong>en</strong> peroxide level found for<br />
smokers was in the range of stable COPD pati<strong>en</strong>ts.<br />
We showed that the spectrophotometric assay of Gallati and<br />
Pracht is able to distinguish betwe<strong>en</strong> differ<strong>en</strong>t pati<strong>en</strong>t groups<br />
based on the hydrog<strong>en</strong> peroxide conc<strong>en</strong>tration measured in<br />
expired breath cond<strong>en</strong>sate.<br />
1. Gallati H, Pracht I. Peroxidase aus Meerrettich: Kinetische Studi<strong>en</strong><br />
und Optimierung der Peroxidase-Aktivitätsbestimmung mit d<strong>en</strong><br />
Substrat<strong>en</strong> H2O2 und 3,3',5,5'-Tetramethylb<strong>en</strong>zidin. J Clin Chem<br />
Clin Biochem 1985; 23:453-60.<br />
89
73. Oxidative stress after lung resection therapy; a pilot study<br />
E.C. LASES 1 , V.A.M. DUURKENS 2 , W.B.M. GERRITSEN1 and F.J.L.M. HAAS 1<br />
Departm<strong>en</strong>ts of Clinical Chemistry 1 and Pulmonary Diseases 2 , St. Antonius Hospital, Nieuwegein (Utrecht), The Netherlands<br />
The prediction of postoperative morbidity and mortality after<br />
lung resection therapy is still a clinical problem. The parameters<br />
which are used at pres<strong>en</strong>t, like bloodgas analysis, FEV1,<br />
splitfunction tests, and VO2 max measurem<strong>en</strong>t do not correlate<br />
with the developm<strong>en</strong>t of postoperative complications. In this<br />
pilot study, we examined the possible predictive value of the<br />
conc<strong>en</strong>tration of hydrog<strong>en</strong> peroxide (H2O2) and malondialdehyde<br />
(MDA) as a measure of oxidative stress in pati<strong>en</strong>ts<br />
undergoing lobectomy or pneumonectomy. 18 Pati<strong>en</strong>ts who<br />
underw<strong>en</strong>t thoracotomy participated in this study, which<br />
included measurem<strong>en</strong>ts of exhaled H2O2 in breath cond<strong>en</strong>sate<br />
and MDA levels in 24-h urine, expressed as ratio of the<br />
74. Type 2 diabetes in Sudan related to socio-economic class<br />
Preval<strong>en</strong>ce of diabetes is low or abs<strong>en</strong>t in several African<br />
populations, but progressive modernisation has be<strong>en</strong> found to<br />
be associated with an increased preval<strong>en</strong>ce of non-insulin<br />
dep<strong>en</strong>d<strong>en</strong>t diabetes mellitus (type 2). In Sudan most pati<strong>en</strong>ts<br />
are poorly controlled and exhibit a high preval<strong>en</strong>ce of acute<br />
and chronic complications, chronic r<strong>en</strong>al failure is pres<strong>en</strong>t in<br />
almost one third of the pati<strong>en</strong>ts (Elmahadi, 1991).<br />
For the pres<strong>en</strong>t pilot study forty Sudanese type 2 diabetes<br />
pati<strong>en</strong>ts, considered to be under proper medical care, good<br />
metabolic control and under differ<strong>en</strong>t therapeutic regim<strong>en</strong>,<br />
were randomly included. Their mean age was 52 ± 8.9 (mean<br />
± SD) years, 14 females and 26 males with mean duration of<br />
diabetes of 8.4 ± 6.0 (mean ± SD) years. In Sudan regular<br />
control was performed by measuring, fasting blood glucose<br />
(FBG), dipstick scre<strong>en</strong>ing for protein in urine and cholesterol.<br />
Other control parameters are not available.<br />
After transportation of the samples, FBG, fructosamine, glycated<br />
haemoglobin (HbA1c), serum creatinine, total protein in<br />
urine and micro albumin/creatinine ratio were measured in the<br />
Laboratory of Clinical Chemistry in Maastricht. Lipid profile<br />
was assessed by measuring cholesterol, HDL and LDL-cholesterol,<br />
LDL/HDL ratio and cholesterol/HDL-cholesterol ratio,<br />
apo-A, apo-B and apo-B/apo-A ratio.<br />
urinary creatinine. Our results show increased H2O2 and MDA<br />
levels in pati<strong>en</strong>ts, who underw<strong>en</strong>t lobectomy, compared with<br />
pati<strong>en</strong>ts, who underw<strong>en</strong>t pneumonectomy. One pati<strong>en</strong>t, who<br />
developed Postpneumonectomy Pulmonary Edema (PPE) 6<br />
days after pneumonectomy, developed a significant increase in<br />
the levels of H2O2 and MDA in comparison to other pati<strong>en</strong>ts<br />
with pneumonectomy. A significant correlation was found<br />
betwe<strong>en</strong> the levels of H2O2 and MDA in this group of pati<strong>en</strong>ts.<br />
The pres<strong>en</strong>t data suggest a strong relationship betwe<strong>en</strong> a major<br />
complication like PPE and the ph<strong>en</strong>om<strong>en</strong>on of oxidative stress<br />
expressed by exhaled H2O2 and urinary MDA.<br />
M.M. ISMAIL 1 , M.E. IDRIS 2 , E.M.A EL MAHDI 3 , O. BEKERS 4 , B.H.R. WOLFFENBUTTEL 5 and<br />
M.P. van DIEIJEN-VISSER 4<br />
Clinical Biochemistry, Ahfad University 1 , Clinical Biochemistry 2 , Medicine 3 University of Khartoum, Sudan; Clinical Chemistry 4 ,<br />
Internal Medicine 5 , Academic Hospital, Maastricht<br />
Table 1. Glycaemic control, r<strong>en</strong>al function and lipid profile in NIDDM, related to socio-economic class<br />
Aim of this pilot study was to relate parameters of glycaemic<br />
control like FBG, HbA1c, fructosamine, kidney-related parameters<br />
and lipid profile to socio-economic status of the<br />
pati<strong>en</strong>ts and to age, sex and duration of diabetes.<br />
For neither of the parameters a relation was found betwe<strong>en</strong><br />
socio-economic class and diabetic control or betwe<strong>en</strong> socioeconomic<br />
status and pres<strong>en</strong>ce of nephropathy (Table 1).<br />
The lipid parameters were within or below (especially cholesterol,<br />
LDL-cholesterol and apo-B) the normal refer<strong>en</strong>ce ranges<br />
for Western societies.<br />
Conclusions:<br />
- Pati<strong>en</strong>ts were more poorly regulated as expected, caused by<br />
lack of the required control parameters and proper followup.<br />
- Preval<strong>en</strong>ce of r<strong>en</strong>al insuffici<strong>en</strong>cy is extremely high in this<br />
population (39 of the 40 pati<strong>en</strong>ts).<br />
- In spite of the poor control, lipids are within normal or<br />
ev<strong>en</strong> low compared to type 2 diabetes pati<strong>en</strong>ts in Western<br />
Societies. This is not so for the cholesterol/HDL-cholesterol<br />
ratio.<br />
- In this pilot study glycaemic control seems not related to<br />
socio-economic status, but further study is required.<br />
Parameters Refer<strong>en</strong>cevalue Social Class Social Class Social Class<br />
High (n=11) Medium (n=8) Low (n=21)<br />
Mean SD Mean SD Mean SD<br />
HbA1c (%) 3.49 - 9.0 8.82 1.86 11.20 3.50 9.79 2.35<br />
Fructosamine 0.62 - 1.22 1.62 0.36 1.87 0.72 1.72 0.37<br />
FBG (mmol/l) 3.10 - 6.7 11.70 2.88 13.00 5.70 10.74 3.12<br />
Micro albumin/creat. 2.5 2.53 1.37 7.14 4.95 3.46 3.36<br />
Total protein, urine negative 0.25 0.42 0.29 0.20 0.21 0.22<br />
S-Creatinine (mmol/l) 53 - 97 73.70 54.94 73.14 21.16 72.90 44.06<br />
Cholesterol (mmol/l) 4.1 - 6.4 4.36 0.97 3.41* 0.89 4.10 1.08<br />
Chol-HDL (mmol/l) 0.6 - 1.9 0.83 0.25 0.65 0.48 0.75 0.21<br />
Chol-LDL (mmol/l) 3.0- 5.2 2.86 0.68 2.31 0.53 2.78 0.95<br />
LDL/HDL 4.44 1.85 3.97** 2.93 3.85 1.27<br />
Cholesterol/HDL
75. Vals-positieve CDTect-uitslag<strong>en</strong> bij patiënt<strong>en</strong> met lage ferritine waard<strong>en</strong><br />
J. van PELT <strong>en</strong> H. AZIMI<br />
KCHL, Ziek<strong>en</strong>huiz<strong>en</strong> Noord-Limburg, V<strong>en</strong>lo<br />
Het voornaamste voordeel van CDTect (P&U) voor de detectie<br />
van chronisch alcohol-misbruik ligt in de hoge specificiteit.<br />
In de literatuur wordt algeme<strong>en</strong> uitgegaan van ongeveer 95%.<br />
Voor de 5% vals-positiev<strong>en</strong> word<strong>en</strong> e<strong>en</strong> aantal oorzak<strong>en</strong> aangegev<strong>en</strong><br />
als primaire biliaire cirrose, D-variant van transferrine<br />
<strong>en</strong> (dragerschap?) van het Koolhydraat Deficiënt Glycoproteïne<br />
Syndroom.<br />
Wij onderzocht<strong>en</strong> e<strong>en</strong> groep patiënt<strong>en</strong> met chronische anemie<br />
(n = 99) t<strong>en</strong>einde te bepal<strong>en</strong> of e<strong>en</strong> toeg<strong>en</strong>om<strong>en</strong> transferrine<br />
synthese gevolg<strong>en</strong> heeft voor de CDTect hoeveelheid. De anemie<br />
patiënt<strong>en</strong> hadd<strong>en</strong> langer dan drie maand<strong>en</strong> e<strong>en</strong> Hb < 7,0<br />
mmol/l. De ijzer <strong>en</strong> ferritine conc<strong>en</strong>traties varieerd<strong>en</strong> <strong>en</strong>orm<br />
door al dan niet ijzersubstitutie.<br />
Er bleek e<strong>en</strong> positieve correlatie tuss<strong>en</strong> CDTect <strong>en</strong> transferrine<br />
(r = 0,66) <strong>en</strong> negatieve correlaties van respectievelijk CDTect<br />
(r = - 0,70) <strong>en</strong> transferrine (r = - 0,71) met de logaritme van de<br />
ferritine conc<strong>en</strong>tratie (range 8 - 14904 µg/l). In het subnormale<br />
gebied van de ferritine conc<strong>en</strong>tratie (< 25 µg/l) werd e<strong>en</strong><br />
toeg<strong>en</strong>om<strong>en</strong> aantal uitslag<strong>en</strong> bov<strong>en</strong> de refer<strong>en</strong>tiewaardes gevond<strong>en</strong><br />
(mann<strong>en</strong>:< 20 U/l; vrouw<strong>en</strong>: < 26 U/l). Vervolg<strong>en</strong>s<br />
werd van e<strong>en</strong> groep willekeurige patiënt<strong>en</strong> met lage ferritine<br />
76. De intracellulaire cytokin<strong>en</strong>produktie in lymphocyt<strong>en</strong> bij behandeling van HIV+<br />
Cytokin<strong>en</strong> zijn polypeptid<strong>en</strong> die door leukocyt<strong>en</strong> geproduceerd<br />
word<strong>en</strong> <strong>en</strong> funger<strong>en</strong> als autonoom signaal bij cel-cel<br />
communicatie, door specifieke receptor<strong>en</strong> te activer<strong>en</strong>. Cytokin<strong>en</strong><br />
spel<strong>en</strong> e<strong>en</strong> belangrijke rol bij o.a. het immuniteitsverloop<br />
tijd<strong>en</strong>s HIV-infectie <strong>en</strong> AIDS.<br />
Bij e<strong>en</strong> voortschrijd<strong>en</strong>de HIV-infectie vermindert het aantal<br />
CD4+ cell<strong>en</strong> <strong>en</strong> het immuunapparaat verandert. Bij de behandeling<br />
van HIV+ <strong>en</strong> AIDS met e<strong>en</strong> combinatietherapie (e<strong>en</strong><br />
virus-specifieke proteaseremmer <strong>en</strong> e<strong>en</strong> reverse transcriptase<br />
remmer) vermindert de viral load (= hoeveelheid HIV-RNA<br />
copiën per ml bloed) <strong>en</strong> is e<strong>en</strong> duidelijk immunologisch herstel<br />
te zi<strong>en</strong> (stijging van CD4+). Over de duur van dit herstel<br />
<strong>en</strong> de kwaliteit is nog niet veel bek<strong>en</strong>d.<br />
De CD4+ populatie kan onderverdeeld word<strong>en</strong> in Th0, Th1 <strong>en</strong><br />
Th2, door te kijk<strong>en</strong> naar de cytokin<strong>en</strong>productie. De dominante<br />
Ned Tijdschr Klin Chem 1998, vol. 23, no. 2<br />
conc<strong>en</strong>traties ev<strong>en</strong>e<strong>en</strong>s de CDTect hoeveelheid bepaald (n =<br />
21). Ook in deze groep kwam e<strong>en</strong> toeg<strong>en</strong>om<strong>en</strong> aantal uitslag<strong>en</strong><br />
bov<strong>en</strong> de gr<strong>en</strong>swaardes voor. In totaal hadd<strong>en</strong> bij e<strong>en</strong> ferritine<br />
conc<strong>en</strong>tratie < 25 µg/l, 5 van de 11 mann<strong>en</strong> e<strong>en</strong> CDTect van<br />
20 U/l <strong>en</strong> 8 van de 18 vrouw<strong>en</strong> e<strong>en</strong> CDTect van 26 U/l. Ge<strong>en</strong><br />
van deze patiënt<strong>en</strong> bleek retrospectief bek<strong>en</strong>d te zijn als chronische<br />
alcoholmisbruiker. Aangezi<strong>en</strong> de verhouding CDTect<br />
t<strong>en</strong> opzichte van transferrine constant is over de gehele ferritine<br />
range, kan geconcludeerd word<strong>en</strong> dat e<strong>en</strong> grotere transferrine<br />
synthese, bijvoorbeeld door ijzergebrek, e<strong>en</strong> grotere<br />
koolhydraat-deficiënte transferrine hoeveelheid met zich mee<br />
br<strong>en</strong>gt. Rec<strong>en</strong>telijk vond<strong>en</strong> wij ook e<strong>en</strong> afhankelijkheid van de<br />
CDTect hoeveelheid met de mate van bloedverlies <strong>en</strong> met de<br />
m<strong>en</strong>opausale status van peri-m<strong>en</strong>opausale vrouw<strong>en</strong>.<br />
In conclusie, e<strong>en</strong> status met e<strong>en</strong> toeg<strong>en</strong>om<strong>en</strong> ijzerbehoefte <strong>en</strong><br />
lage ferritine conc<strong>en</strong>traties veroorzaakt verhoogde transferrine<br />
synthese met daaraan gepaard gaand grotere Koolhydraat<br />
Deficiënt Transferrine hoeveelhed<strong>en</strong>. Bij onverklaard hoge<br />
CDTect uitslag<strong>en</strong> moet daarom ook gedacht word<strong>en</strong> aan ijzerdeficiëntie<br />
of chronisch bloedverlies.<br />
A.M.T. van LEEUWEN 1 , Chr.H.H. t<strong>en</strong> NAPEL 2 , F.M.F.G. OLTHUIS 1 <strong>en</strong> C.G. FIGDOR 3<br />
Klinisch Chemisch Laboratorium 1 <strong>en</strong> Interne G<strong>en</strong>eeskunde, Medisch Spectrum Tw<strong>en</strong>te, Enschede 2 , Tumor Immunologie Universiteit<br />
Nijmeg<strong>en</strong> 3<br />
Th1 populatie stimuleert voornamelijk immuunfuncties <strong>en</strong><br />
produceert gIFN, IL2 aTNF. De Th2 populatie stimuleert de<br />
humorale functie <strong>en</strong> produceert IL4 <strong>en</strong> IL10.<br />
Mogelijkerwijs kan de bepaling van Th1 <strong>en</strong> Th2 meer inzicht<br />
gev<strong>en</strong> in het herstel van de CD4+ populatie <strong>en</strong> bij de beoordeling<br />
van het verloop van e<strong>en</strong> HIV-infektie <strong>en</strong> het effect van<br />
e<strong>en</strong> retro-virale behandeling.<br />
Inmiddels zijn van e<strong>en</strong> aantal vrijwilligers: gezond, HIV+ <strong>en</strong><br />
AIDS de intracellulaire cytokin<strong>en</strong>productie gemet<strong>en</strong>. De hoeveelhed<strong>en</strong><br />
intracellulaire cytokin<strong>en</strong>productie na stimulatie is<br />
erg variabel. Er zijn ge<strong>en</strong> significante verschill<strong>en</strong> gevond<strong>en</strong><br />
tuss<strong>en</strong> gezond <strong>en</strong> HIV+ <strong>en</strong> AIDS. Bij de geselekteerde patiënt<strong>en</strong><br />
word<strong>en</strong> vier meting<strong>en</strong> gedaan vóór behandeling <strong>en</strong> na aanvang<br />
van de behandeling zal de cytokin<strong>en</strong>productie 16 wek<strong>en</strong><br />
gevolgd word<strong>en</strong>.<br />
77. Eosinofilie bij int<strong>en</strong>sive care patiënt<strong>en</strong> als maat voor e<strong>en</strong> relative bijnierschors insuffici<strong>en</strong>tie<br />
A. BEISHUIZEN, I. VERMES, K. WU <strong>en</strong> B.S. HYLKEMA<br />
Medisch Spectrum Tw<strong>en</strong>te, Enschede<br />
Het voorkom<strong>en</strong> van e<strong>en</strong> relatieve bijnierschorsinsuffici<strong>en</strong>tie<br />
bij ernstig zieke pati<strong>en</strong>t<strong>en</strong> is e<strong>en</strong> nieuw concept. Helaas beschikk<strong>en</strong><br />
wij niet over e<strong>en</strong> betrouwbare meetmethode om de<br />
bijnierschorsfunctie bij deze pati<strong>en</strong>t<strong>en</strong> betrouwbaar te beoordel<strong>en</strong>.<br />
De basale cortisolspiegel geeft bij deze pati<strong>en</strong>t<strong>en</strong> ge<strong>en</strong><br />
uitsluitsel aangezi<strong>en</strong> deze, als gevolg van de stress, bijna altijd<br />
verhoogd wordt gevond<strong>en</strong>. De standaard ACTH test (250 µg)<br />
heeft ge<strong>en</strong> diagnostische waarde omdat de hypofysebijnieras<br />
bij int<strong>en</strong>sive care (IC) pati<strong>en</strong>t<strong>en</strong> altijd al maximaal is gestimuleerd.<br />
De s<strong>en</strong>sitieve ACTH test (1 µg) is bij IC pati<strong>en</strong>t<strong>en</strong><br />
moeilijk standaardiseerbaar vanwege de grote variatie van de<br />
basale waard<strong>en</strong>. Om deze red<strong>en</strong> hebb<strong>en</strong> wij de waarde van het<br />
met<strong>en</strong> van het aantal eosinofiele granulocyt<strong>en</strong> in het perifere<br />
bloed, bek<strong>en</strong>d als de "proef van Thorn", bij IC pati<strong>en</strong>t<strong>en</strong> opnieuw<br />
geëvalueerd.<br />
Bij 261 IC pati<strong>en</strong>t<strong>en</strong> werd<strong>en</strong> de uitslag<strong>en</strong> vergelek<strong>en</strong> van de au-<br />
tomatische celtelling<strong>en</strong> <strong>en</strong> differ<strong>en</strong>tiatie (H1Bayer/Technicon).<br />
In 21 gevall<strong>en</strong> werd e<strong>en</strong> aantal eosinofiel<strong>en</strong> van >3% gevond<strong>en</strong>.<br />
Bij deze groep werd tijd<strong>en</strong>s het verblijf op de IC dagelijks het<br />
aantal eosinofil<strong>en</strong> <strong>en</strong> het basale cortisolgehalte bepaald terwijl<br />
e<strong>en</strong>malig de ACTH test werd verricht. Vijf pati<strong>en</strong>t<strong>en</strong> toond<strong>en</strong><br />
klinisch aanwijzing<strong>en</strong> voor bijnierschorsinsuffici<strong>en</strong>tie. Alle<br />
vijf toond<strong>en</strong> eosinofilie <strong>en</strong> reageerd<strong>en</strong> gunstig op behandeling<br />
met glucocorticosteroïd<strong>en</strong>. Bij 19 van de 21 pati<strong>en</strong>t<strong>en</strong> bestond<br />
e<strong>en</strong> duidelijke relatie tuss<strong>en</strong> het aantal eosinofil<strong>en</strong> <strong>en</strong> het klinisch<br />
beloop.<br />
E<strong>en</strong> hoog of stijg<strong>en</strong>d aantal eosinofiel<strong>en</strong> bij ernstig zieke<br />
pati<strong>en</strong>t<strong>en</strong> is e<strong>en</strong> alarmsignaal voor e<strong>en</strong> fal<strong>en</strong>de bijnierschorsfunctie.<br />
De moderne celtelapparatuur heeft e<strong>en</strong> nieuwe dim<strong>en</strong>sie<br />
gegev<strong>en</strong> aan de betek<strong>en</strong>is van het aantal eosinofiel<strong>en</strong> in relatie<br />
tot de bijnierschorsfunctie, zoals reeds 50 jaar geled<strong>en</strong> door<br />
Thorn (1948) werd beschrev<strong>en</strong>.<br />
91
78. Chylothorax of TPV-lekkage, e<strong>en</strong> analytische casus<br />
A.WOLTHUIS 1 , R.B.M. LANDEWE 2 , P.H.M.H. THEUNISSEN 3 <strong>en</strong> L.W.J.J.M. WESTERHUIS 1<br />
Afdeling klinische <strong>chemie</strong> 1 , afdeling reumatologie 2 <strong>en</strong> afdeling klinische pathologie 3 , Het Atrium Medisch C<strong>en</strong>trum, Heerl<strong>en</strong> (voorhe<strong>en</strong><br />
de Weverziek<strong>en</strong>huis)<br />
De Casus: E<strong>en</strong> 83 jarige vrouw werd aangebod<strong>en</strong> voor obductie.<br />
Haar ziektegeschied<strong>en</strong>is vermeldt mammacarcinoom, erosieve<br />
reumafactor positieve reumatoïde artritis (RA), status na<br />
Billroth II, maagresectie, onverklaarde cholestatische leverfunctiestoorniss<strong>en</strong><br />
<strong>en</strong> koorts. Zij had e<strong>en</strong> v<strong>en</strong>a subclavia catheter<br />
links, die overig<strong>en</strong>s bij obductie niet meer in situ was.<br />
Middels deze lijn ontving zij totale par<strong>en</strong>terale voeding (TPV).<br />
De klinische diagnose: Pericarditis met effusie bij RA, chronische<br />
idiopathische decomp<strong>en</strong>satio cordis (DC) <strong>en</strong> cholestatische<br />
leverafwijking<strong>en</strong> eci. Directe doodsoorzaak: Respiratoire<br />
insuffici<strong>en</strong>tie bij DC.<br />
Tijd<strong>en</strong>s de obductie werd er e<strong>en</strong> globale pericarditis gevond<strong>en</strong>,<br />
deels adhesief <strong>en</strong> deels exsudatief, zeer waarschijnlijk in het<br />
kader van RA. Verder werd in de rechter pleuraholte 1,5 <strong>en</strong> in<br />
de linker pleuraholte 0,2 liter melkachtige vloeistof gevond<strong>en</strong>.<br />
Differ<strong>en</strong>tiaal diagnostisch betreft het hier ofwel e<strong>en</strong> chylothorax<br />
ofwel lekkage van de TPV. De differ<strong>en</strong>tiatie wordt gemaakt<br />
op basis van de chemische constitutie: e<strong>en</strong> 10 x hogere<br />
triglyceride conc<strong>en</strong>tratie tov de waard<strong>en</strong> in serum <strong>en</strong> de aantoonbaarheid<br />
van chylomicron<strong>en</strong> in het lipogram wijz<strong>en</strong> op<br />
e<strong>en</strong> chylothorax (1,2). Intrapulmonaal war<strong>en</strong> ge<strong>en</strong> afwijking<strong>en</strong><br />
herk<strong>en</strong>baar. Het overlijd<strong>en</strong> is zeer waarschijnlijk toe te schrijv<strong>en</strong><br />
aan de cardiale pathologie.<br />
79. Evaluation of ß-cell function at the time of clinical diagnosis of type 2 diabetes mellitus<br />
R.N.M. WEIJERS 1 , H.M.J. GOLDSCHMIDT 3 and J.SILBERBUSCH 2<br />
Departm<strong>en</strong>ts of Clinical Chemistry and Hematology 1 , and Internal Medicine 2 , Onze Lieve Vrouwe Gasthuis, Amsterdam; Departm<strong>en</strong>t<br />
of Clinical Chemistry and Hematology 3 , St. Elisabeth Hospital, Tilburg<br />
The objective was to evaluate the secretory capacity of pancreatic<br />
ß-cells at the time of clinical diagnosis of type 2 diabetes<br />
mellitus. We examined a well-characterized group of<br />
106 newly diagnosed pati<strong>en</strong>ts who underw<strong>en</strong>t a provocation<br />
test with glucagon at diagnosis. The pati<strong>en</strong>ts, who started<br />
treatm<strong>en</strong>t at diagnosis with diet alone (group I; n = 13), with<br />
oral antidiabetic drugs (group II; n = 64), or with insulin<br />
(group III: n = 29), were referred betwe<strong>en</strong> January 1993 and<br />
December 1996. Fasting serum C-peptide (SCP) levels were<br />
markedly higher in pati<strong>en</strong>ts receiving diet therapy alone than<br />
in those receiving oral hypoglycemic ag<strong>en</strong>t therapy (1.6 ± 0.7<br />
vs. 1.0 ± 0.4 nmol L -1 , p < 0.0005). In contrast, fasting SCP<br />
levels were markedly lower in pati<strong>en</strong>ts receiving insulin<br />
therapy than in those receiving oral hypoglycemic ag<strong>en</strong>t<br />
therapy (0.5 ± 0.2 vs. 1.0 ± 0.4 nmol L -1 , p < 0.0001). Linear<br />
regression analysis showed a significant inverse correlation<br />
among the three treatm<strong>en</strong>t groups betwe<strong>en</strong> their fasting SCP<br />
and concomitant glucose levels (r = -0.999; p < 0.0001).<br />
Bivariate statistical analysis of both parameters resulted in<br />
90% isod<strong>en</strong>sity ellipses for the diet only and insulin treatm<strong>en</strong>t<br />
group that showed only minimal overlapping whereas the<br />
ellipse for pati<strong>en</strong>ts using oral hypoglycemic ag<strong>en</strong>ts takes up a<br />
middle position (see figuur 1). The response on glucagon<br />
expressed as the ratio of SCP measured 6 min after glucagon<br />
injection over SCP measured immediately before injection<br />
was not statistically differ<strong>en</strong>t among the three treatm<strong>en</strong>tgroups.<br />
This indicates that the secretory capacity of pancreatic<br />
ß-cells <strong>en</strong>ormously differs betwe<strong>en</strong> individuals at diagnosis of<br />
Resultat<strong>en</strong>: Triglycerid<strong>en</strong>: 20,85 mmol/l (0,80-2,00); lipogram:<br />
100% chylomicron<strong>en</strong><br />
Conclusie: Deze resultat<strong>en</strong> zoud<strong>en</strong> kunn<strong>en</strong> pass<strong>en</strong> bij chylothorax.<br />
Nadere analyse echter toonde oa. e<strong>en</strong> glucose van<br />
127,3 mmol/l (ref waarde < 7,0 mmol/l) <strong>en</strong> e<strong>en</strong> kalium van<br />
11,4 (ref. waarde 3,5-5,0 mmol/l): extreme waard<strong>en</strong> die niet<br />
pass<strong>en</strong> bij de <strong>bio</strong>logische compositie van lymfe (chylus).<br />
Gezi<strong>en</strong> de conc<strong>en</strong>tratie van glucose <strong>en</strong> kalium in de TPV, respectievelijk<br />
944 mmol/l <strong>en</strong> 31 mmol/l, <strong>en</strong> het feit dat er zonder<br />
twijfel post-mortem weefsel equilibratie heeft plaats gevond<strong>en</strong><br />
past deze chemische analyse bij de conclusie: TPV lekkage<br />
door "fausse route".<br />
Discussie: Deze casus laat zi<strong>en</strong> dat de diagnose chylothorax<br />
op basis van de beschrev<strong>en</strong> analys<strong>en</strong> in (uitzonderlijke) gevall<strong>en</strong><br />
tot verkeerde resultat<strong>en</strong> kan leid<strong>en</strong>. Bij het onderscheid<br />
chylothorax versus TPV zou derhalve e<strong>en</strong> glucose <strong>en</strong> kalium<br />
bepaling e<strong>en</strong> duidelijker beeld kunn<strong>en</strong> gev<strong>en</strong>. Zeker als deze<br />
waard<strong>en</strong> geïnterpreteerd word<strong>en</strong> in het licht van de TPV<br />
sam<strong>en</strong>stelling.<br />
1. Keijzer MH de <strong>en</strong> Doelman CJA. Tijdschr <strong>NVKC</strong> 1993; 18: 317-<br />
321.<br />
2. Hillerdal G. Eur Respir J 1997; 10: 1157-1162.<br />
type 2 diabetes, and that the treatm<strong>en</strong>t policy at diagnosis can<br />
be facilitated by the outcome of the tandem assay of a fasting<br />
glucose and a C-peptide.<br />
92 Ned Tijdschr Klin Chem 1998, vol. 23, no. 2
80. The preval<strong>en</strong>ce of type 2 diabetes and gestational diabetes mellitus in an inner city multi-ethnic population<br />
R.N.M. WEIJERS 1 , D.J. BEKEDAM 2 <strong>en</strong> H. OOSTING 3<br />
Departm<strong>en</strong>ts of Clinical Chemistry and Hematology 1 , and Obstetrics and Gynecology 2 , Onze Lieve Vrouwe Gasthuis, Amsterdam.<br />
Departm<strong>en</strong>t of Clinical Epidemiology and Biostatistics 3 , Academic Medical C<strong>en</strong>tre, University of Amsterdam<br />
"Zeeburg", a multiethnic town borough in the Amsterdam-East<br />
region, has one of the city's highest rates of immigrants. In the<br />
total population of 19,825 Surinam (mainly Creole), Turkish,<br />
Moroccan, and Dutch adults the preval<strong>en</strong>ce of known type 2<br />
diabetes in 1994 and of gestational diabetes mellitus (GDM)<br />
betwe<strong>en</strong> January 1992 and January 1997 was investigated.<br />
Based on World Health Organization (WHO) criteria of 1985,<br />
the age-standardized preval<strong>en</strong>ce of type 2 diabetes was similar<br />
in m<strong>en</strong> (6.4%, 95% confid<strong>en</strong>ce interval [CI] 5.6-7.2) and<br />
wom<strong>en</strong> (6.4, CI 5.8-7.0) for all ethnic groups combined. However,<br />
the age- and sex-standardized preval<strong>en</strong>ce of type 2 diabetes<br />
was significantly greater in the non-Dutch inhabitants<br />
than in the Dutch inhabitants (17.3% [CI 12.9-21.6] in<br />
Surinam inhabitants, 10.9% [CI 9.7-12.2] in Turkish inhabi-<br />
81. Serum eosinophil cationic protein in active and quiesc<strong>en</strong>t ulcerative colitis<br />
Background: In the pathog<strong>en</strong>esis of ulcerative colitis (UC)<br />
many proinflammatory cytokines activate eosinophils, thereby<br />
releasing eosinophil cationic protein (ECP). ECP is a pivotal<br />
cytotoxic mediator, causing mucosal damage. Data of serum<br />
ECP (sECP) conc<strong>en</strong>tration in the course of UC are sparse.<br />
Aim: To measure sECP conc<strong>en</strong>tration in the course of UC<br />
using a previously described standardized analytic method.<br />
Methods: In 6 pati<strong>en</strong>ts with active UC, 5 pati<strong>en</strong>ts with quiesc<strong>en</strong>t<br />
UC (established by clinical and <strong>en</strong>doscopic findings), 8 IBSsubjects<br />
(Manning criteria positive, lactose tolerant) and 21<br />
appar<strong>en</strong>tly healthy controls, sECP and eosinophil count were<br />
measured at baseline and at 12 weeks. In pati<strong>en</strong>ts with active<br />
UC, samples were also drawn at 2, 4, and 8 weeks. The<br />
preanalytic phase of ECP determination was standardized by<br />
spontaneous clotting of blood for two hours at 37°C. After<br />
incubation samples were c<strong>en</strong>trifuged during 10 minutes at<br />
1350g.<br />
Ned Tijdschr Klin Chem 1998, vol. 23, no. 2<br />
tants, 12.4% [CI 9.7-15.0] in Moroccan inhabitants, and 3.6%<br />
[CI 3.2-3.9] in Dutch inhabitants. The odds ratios for type 2<br />
diabetes for the separate immigrant groups relative to the<br />
Dutch group were 5.88 (CI 4.54-7.69) for Surinam inhabitants,<br />
4.00 (CI 2.86-5.55) for Turkish inhabitants, and 4.17 (CI 3.03-<br />
5.55) for Moroccan inhabitants. GDM was pres<strong>en</strong>t in 2.59% of<br />
wom<strong>en</strong> of non-Dutch origin compared with 0.62% of wom<strong>en</strong><br />
of Dutch origin. A significant positive association was found<br />
betwe<strong>en</strong> the non-Dutch origin and the occurr<strong>en</strong>ce of GDM<br />
(χ 2 = 6.7; p < 0.01). The study highlights a high preval<strong>en</strong>ce of<br />
known type 2 diabetes and GDM in the immigrant inhabitants<br />
and emphasizes that appropriate interv<strong>en</strong>tions are necessarily<br />
with implications for health targets and capitation based<br />
budgets.<br />
C.J. PRONK-ADMIRAAL 1 , R.K. LINSKENS 2 , A.A. van BODEGRAVEN 2 , H.A.R.E. TUYNMAN 2 and P.C.M. BARTELS 1<br />
Departm<strong>en</strong>ts of Clinical Chemistry 1 and Gastro<strong>en</strong>terology 2 , Medical C<strong>en</strong>ter Alkmaar, The Netherlands<br />
Results: At baseline, mean sECP was significantly higher in<br />
active UC (110.3 µg/l) compared with both quiesc<strong>en</strong>t UC<br />
(33.7 µg/l), IBS-subjects (23.9 µg/l) and appar<strong>en</strong>tly healthy<br />
controls (43.5 µg/l). In both active and quiesc<strong>en</strong>t UC also the<br />
eosinophil count is significantly raised wh<strong>en</strong> compared with<br />
IBS-subjects and appar<strong>en</strong>tly healthy controls. However, there<br />
is no statistically significant differ<strong>en</strong>ce of eosinophil count<br />
betwe<strong>en</strong> active and quiesc<strong>en</strong>t UC pati<strong>en</strong>ts. During reconvalesc<strong>en</strong>ce<br />
of UC, sECP significantly decreased to 22.8 µg/l after<br />
2 weeks.<br />
Conclusions: With this standardized method of sECP determination<br />
and the measurem<strong>en</strong>t of eosinophil count, we found<br />
elevated levels in all pati<strong>en</strong>ts with UC wh<strong>en</strong> compared with<br />
IBS-subjects and appar<strong>en</strong>tly healthy controls. Measuring the<br />
sECP helps to distinguish active from quiesc<strong>en</strong>t UC pati<strong>en</strong>ts.<br />
sECP is correlated with disease activity. ECP may play a significant<br />
role in the pathophysiology of UC.<br />
82. Plasma glutamine in ernstig zieke int<strong>en</strong>sive care patiënt<strong>en</strong>: correlatie met mortaliteit <strong>en</strong> verlies tijd<strong>en</strong>s hoogvolume<br />
hemofiltratie<br />
M. TRESKES 1 , M.G.D. ROOD 1 <strong>en</strong> H.M. OUDEMANS-van STRAATEN 2<br />
Hematologisch <strong>en</strong> Klinisch Chemisch Laboratorium 1 <strong>en</strong> afdeling Int<strong>en</strong>sive Care 2 , Onze Lieve Vrouwe Gasthuis, Amsterdam<br />
Glutamine is e<strong>en</strong> ess<strong>en</strong>tieel aminozuur dat in vrij hoge conc<strong>en</strong>tratie<br />
in plasma voorkomt <strong>en</strong> e<strong>en</strong> belangrijke rol speelt bij de<br />
functie van o.a. darmmucosa <strong>en</strong> immuniteit. Katabole process<strong>en</strong><br />
bij ernstig zieke patiënt<strong>en</strong> hebb<strong>en</strong> e<strong>en</strong> grote invloed op de<br />
glutamine homeostase. E<strong>en</strong> verhoogd gebruik moet gecomp<strong>en</strong>seerd<br />
word<strong>en</strong> door o.a. verhoogde glutamine levering uit<br />
skeletspierweefsel. Ernstige depletie van glutamine wordt<br />
weerspiegeld in e<strong>en</strong> verlaagde conc<strong>en</strong>tratie in plasma(1).<br />
In ernstig zieke Int<strong>en</strong>sive Care patiënt<strong>en</strong> is gekek<strong>en</strong> naar de<br />
plasma glutamineconc<strong>en</strong>tratie, het effect van hoog-volume<br />
hemofiltratie <strong>en</strong> de relatie met de voorspelde mortaliteit o.b.v.<br />
klinische scores <strong>en</strong> de waarg<strong>en</strong>om<strong>en</strong> mortaliteit.<br />
Plasma <strong>en</strong> ultrafiltraat werd direct na afname voorbehandeld<br />
<strong>en</strong> ingevror<strong>en</strong> bij -20°C. Langdurige opslag (> 1 maand) vond<br />
plaats bij -70°C. Glutamine <strong>en</strong> glutaminezuur werd<strong>en</strong> in e<strong>en</strong><br />
2-staps colorimetrische reactie bepaald. (Boehringer Mannheim<br />
NL).<br />
De gemiddelde conc<strong>en</strong>tratie van glutamine in plasma bedroeg<br />
0,50 mmol/l (SD 0,16 mmol/l). Volg<strong>en</strong>s verwachting passeert<br />
glutamine het hemofiltratiefilter. De gemiddelde "sieving<br />
coëfficiënt" bedroeg 1,01 (n=44). Het mediane verlies aan<br />
glutamine tijd<strong>en</strong>s de gehele hemofiltratie behandeling bedroeg<br />
9,6 gram glutamine (spreiding 1,4 - 60 gram).<br />
Plasma glutamine conc<strong>en</strong>traties binn<strong>en</strong> 24 uur na opname correleerd<strong>en</strong><br />
zwak met de diverse mortaliteitscores (APACHE II,<br />
SAPS II MPM 0 & MPM 24). De gemiddelde plasma glutamine<br />
conc<strong>en</strong>tratie binn<strong>en</strong> 24 uur na opname lag<strong>en</strong> gemiddeld<br />
lager in patiënt<strong>en</strong> die op de ICU overled<strong>en</strong> dan in patiënt<strong>en</strong> die<br />
overleefd<strong>en</strong> (0,44 vs 0,52 mmol/l, p=0,08).<br />
Deze data zijn e<strong>en</strong> indicatie dat lage glutamine conc<strong>en</strong>traties<br />
in plasma mogelijk geassocieerd zijn met e<strong>en</strong> verhoogde kans<br />
op mortaliteit. Indi<strong>en</strong> dit verband causaal is, zou suppletie van<br />
glutamine in deze patiënt<strong>en</strong> zinvol zijn.<br />
1. Van der Hulst RRWJ. Glutamine, an ess<strong>en</strong>tial nutri<strong>en</strong>t for the gut.<br />
Thesis 1996, Universitaire Pers Maastricht, ISBN 90-900-9518-7.<br />
93
83. Heriditaire Hemochromatose als oorzaak van Diabetes Mellitus type II<br />
L.D. DIKKESCHEI 1 , A. PEPPING 1 , J. KOLK 1 , W. de VISSER 2 <strong>en</strong> H. BILO 3<br />
Laboratorium 1 <strong>en</strong> Interne Afdeling 3 Ziek<strong>en</strong>huis De Weez<strong>en</strong>land<strong>en</strong>, Zwolle <strong>en</strong> Huisarts<strong>en</strong> Maatschap Urk 2<br />
Introductie: Hereditaire hemochromatose (HH) is e<strong>en</strong> primaire<br />
erfelijke ijzeraccumulatie die geassocieerd is met de overerving<br />
van de mutatie Cys282Tyr in het HLA-H g<strong>en</strong>. In<br />
homozygote vorm wordt de ziekte gek<strong>en</strong>merkt door afwijking<strong>en</strong><br />
in de serum ijzer parameters (e<strong>en</strong> hoge ijzerverzading<br />
(>50%), hoge serum ijzer conc<strong>en</strong>tratie) <strong>en</strong> afwijking<strong>en</strong> in de<br />
functie van organ<strong>en</strong> waarin ijzerstapeling heeft plaats gevond<strong>en</strong>.<br />
Meest frequ<strong>en</strong>t aangedane organ<strong>en</strong> zijn lever, pancreas,<br />
hartspier <strong>en</strong> testikels.<br />
De therapie is erop gericht de ijzerstapeling te voorkom<strong>en</strong> door<br />
jonge leeftijd te start<strong>en</strong> met aderlating<strong>en</strong>, waardoor orgaanfunctieverlies<br />
kan word<strong>en</strong> voorkom<strong>en</strong>.<br />
Gelet op de frequ<strong>en</strong>tie van de mutatie wordt de ziekte ondergediagnostiseerd,<br />
mogelijk doordat het secundaire ziektebeeld<br />
(levercirrose, hepatitis, diabetes mellitus, cardiomyopathie,<br />
mannelijke infertiliteit) op de voorgrond staat waardoor beoordeling<br />
van de ijzerstatus niet plaatsvindt.<br />
Indi<strong>en</strong> Diabetes Mellitus type II (DM II) door HH kan word<strong>en</strong><br />
veroorzaakt di<strong>en</strong>t de homozygote mutatie met e<strong>en</strong> hogere<br />
frequ<strong>en</strong>tie in deze pati<strong>en</strong>t<strong>en</strong>populatie voor te kom<strong>en</strong>. Hoewel<br />
heterozygot<strong>en</strong> zeld<strong>en</strong> e<strong>en</strong> afwijk<strong>en</strong>de serum ijzerstatus hebb<strong>en</strong><br />
is desondanks ijzerstapeling niet uitgeslot<strong>en</strong>.<br />
Doel van het onderzoek: Toets<strong>en</strong> of de preval<strong>en</strong>tie van de<br />
84. Synthese <strong>en</strong> detectie van AGE-achtige verbinding<strong>en</strong><br />
Glucose <strong>en</strong> andere reducer<strong>en</strong>de suikers reager<strong>en</strong> met eiwitt<strong>en</strong><br />
via e<strong>en</strong> non-<strong>en</strong>zymatische irreversibele reactie. De carbonyl<br />
groep van de suiker bindt aan e<strong>en</strong> vrije amine groep aanwezig<br />
in het eiwit. Het betreft e<strong>en</strong> langzaam verlop<strong>en</strong>de reactie die<br />
leidt tot het ontstaan van Advanced Glycosylation Endproduct<strong>en</strong><br />
(AGE). Deze product<strong>en</strong> ontstaan vooral uit langlev<strong>en</strong>de<br />
macro-molecul<strong>en</strong> <strong>en</strong> blijv<strong>en</strong> hieraan irreversibel gebond<strong>en</strong>.<br />
Crosslinking met andere amine groep<strong>en</strong> kan optred<strong>en</strong>,<br />
hetge<strong>en</strong> leidt tot stijfheid van de macrostructur<strong>en</strong> waarin de<br />
macro-molecul<strong>en</strong> voorkom<strong>en</strong> (vaatwand, netvlies, membran<strong>en</strong>).<br />
De vorming van AGE product<strong>en</strong> uit macromolecul<strong>en</strong> is de<br />
oorzaak van de lange termijn complicaties bij diabetes mellitus<br />
<strong>en</strong> spel<strong>en</strong> waarschijnlijk ook e<strong>en</strong> grote rol bij de fysiologische<br />
veroudering.<br />
De detectie van deze AGE’s zorgt nog voor de nodige problem<strong>en</strong>,<br />
vooral omdat AGE’s zeer heteroge<strong>en</strong> van sam<strong>en</strong>stelling<br />
Cys282Tyr mutatie bij DM II hoger is dan bij e<strong>en</strong> controle groep.<br />
Methode: Bij 100 diabet<strong>en</strong> (DM II)(50 via huisarts<strong>en</strong>, 50 via<br />
internist<strong>en</strong> verkreg<strong>en</strong>) <strong>en</strong> 50 controle person<strong>en</strong> wordt na amplificatie<br />
(PCR) van e<strong>en</strong> deel van het HH g<strong>en</strong> de mutatie na<br />
digestie met RsaI al dan niet aangetoond op basis van RFLP.<br />
Resultat<strong>en</strong>:<br />
Wild type Heterozygoot Homozygoot N<br />
DM (eerstelijn) 45 4 1 50<br />
DM (poli) 47 6 0 50<br />
Controle groep 42 8 0 50<br />
De homozygoot is met sequ<strong>en</strong>tie analyse bewez<strong>en</strong>, maar heeft<br />
ge<strong>en</strong> afwijk<strong>en</strong>de ijzerstatus.<br />
Conclusie: De Cys282Tyr mutatie heeft zeker ge<strong>en</strong> hogere<br />
preval<strong>en</strong>tie in de DM type II groep <strong>en</strong> is dus zeld<strong>en</strong> de g<strong>en</strong>etische<br />
oorzaak van DM Type II. De <strong>en</strong>ige homozygote mutatie<br />
in deze”risico”-groep gaat gepaard met e<strong>en</strong> normaal ijzermetabolisme<br />
waardoor HH als oorzaak van DM type II, zeer onwaarschijnlijk<br />
is.<br />
C.J.A.L. MENTINK 1 , P.P.C.A. MENHEERE 1 <strong>en</strong> B.H.R. WOLFFENBUTTEL 2<br />
Klinisch Chemisch Laboratorium 1 <strong>en</strong> afdeling Interne G<strong>en</strong>eeskunde 2 , Academisch Ziek<strong>en</strong>huis Maastricht<br />
zijn. Karakteristiek in de vorming van AGE product<strong>en</strong> is de<br />
vorming van dicarbonyl bevatt<strong>en</strong>de verbinding<strong>en</strong>. Ons onderzoek<br />
is gericht op het aanton<strong>en</strong> van de dicarbonyl groep middels<br />
e<strong>en</strong> competitieve (radio)immunoassay. Om de problem<strong>en</strong><br />
in de calibratie van e<strong>en</strong> degelijke assay te kunn<strong>en</strong> omzeil<strong>en</strong> is<br />
in vitro e<strong>en</strong> e<strong>en</strong>voudige dicarbonyl verbinding gemaakt die<br />
gebruikt kan word<strong>en</strong> als standaard <strong>en</strong> als label in toekomstige<br />
AGE verbinding<strong>en</strong>.<br />
E<strong>en</strong> simpele verbinding met e<strong>en</strong> dicarbonyl binding is het<br />
amide gevormd uit 2-oxo-propaan-zuur <strong>en</strong> Nα-t-BOC-L-lysine<br />
volg<strong>en</strong>s het mechanisme in figuur 1.<br />
Ter controle van de zuiverheid van het product zijn e<strong>en</strong> 1 H-<br />
NMR <strong>en</strong> e<strong>en</strong> IR-spectrum gemaakt. Uit deze spectra blijkt dat<br />
er e<strong>en</strong> amide gevormd is <strong>en</strong> dat de dicarbonyl verbinding aanwezig<br />
is. Deze methode is veelbelov<strong>en</strong>d voor de opzet van e<strong>en</strong><br />
competitieve assay van AGE’s.<br />
2-oxo-propaanzuur t-BOC-L-lysine amide dicyclohexylureum<br />
Figuur 1. Reactiemechanisme bereiding dicarbonyl-verbinding<br />
85. Immunochemische detectie van AGE-albumine<br />
C.G. SCHALKWIJK 1 , N. LIGTVOET 1 , H. TWAALFHOVEN 1 , R.B.H. SCHUTGENS 1 , C.D.A. STEHOUWER 2 , <strong>en</strong><br />
V.W.M. van HINSBERGH 3<br />
C<strong>en</strong>traal Chemisch Laboratorium 1 <strong>en</strong> Interne G<strong>en</strong>eeskunde 2 , Academisch Ziek<strong>en</strong>huis Vrije Universiteit Amsterdam <strong>en</strong> Gaubius<br />
Laboratorium 3 TNO-PG<br />
Patiënt<strong>en</strong> met diabetes mellitus hebb<strong>en</strong> e<strong>en</strong> verhoogd risico<br />
voor het optred<strong>en</strong> van vasculaire complicaties. Het pathofysiologisch<br />
mechanisme dat leidt tot het slecht functioner<strong>en</strong> van de<br />
vaatwand is niet precies bek<strong>en</strong>d. Er zijn sterke aanwijzing<strong>en</strong><br />
dat niet-<strong>en</strong>zymatische geglycolyseerde eiwitt<strong>en</strong> (AGEs) hierbij<br />
e<strong>en</strong> belangrijke rol spel<strong>en</strong>. Deze AGEs word<strong>en</strong> in to<strong>en</strong>em<strong>en</strong>de<br />
mate gevormd bij diabetes patiënt<strong>en</strong>. Er zijn slechts e<strong>en</strong><br />
beperkt aantal techniek<strong>en</strong> beschrev<strong>en</strong> om AGE te detecter<strong>en</strong>.<br />
94 Ned Tijdschr Klin Chem 1998, vol. 23, no. 2
T<strong>en</strong>einde met behulp van antilicham<strong>en</strong> AGEs te kunn<strong>en</strong> detecter<strong>en</strong>,<br />
werd<strong>en</strong> polyclonale antilicham<strong>en</strong> teg<strong>en</strong> AGE-albumine<br />
opgewekt. De antilicham<strong>en</strong> werd<strong>en</strong> gekarakteriseerd met als<br />
doel het herk<strong>en</strong>ningsepitoop op AGEs te kunn<strong>en</strong> vaststell<strong>en</strong>.<br />
Bek<strong>en</strong>de AGEs zoals p<strong>en</strong>tosinine <strong>en</strong> carboxymethyllysine,<br />
maar ook belangrijke intermediar<strong>en</strong> als methylglyoxal- <strong>en</strong> 3deoxyglucosone-gemodificeerde<br />
eiwitt<strong>en</strong> word<strong>en</strong> niet herk<strong>en</strong>d<br />
door de antilicham<strong>en</strong>. Het epitoop is vooralsnog niet bek<strong>en</strong>d.<br />
Met deze AGE-antilicham<strong>en</strong> werd e<strong>en</strong> competatieve Elisa opgezet.<br />
In e<strong>en</strong> groep van insuline-afhankelijke diabet<strong>en</strong> (n=55)<br />
werd e<strong>en</strong> verhoging aangetoond van e<strong>en</strong> factor 2 van AGEalbumine<br />
t.o.v. e<strong>en</strong> controle groep (n=60) (39.2±10.0 U/ml vs<br />
20.9 ± 4.0 U/ml, p
88. Phytanic acid α-oxidation in peroxisomal disorders: studies in cultured human fibroblasts<br />
N.M. VERHOEVEN 1 , D.S.M. SCHOR 1 , C.R. ROE 2 , R.J.A. WANDERS 3 and C. JAKOBS 1<br />
Departm<strong>en</strong>t of Clinical Chemistry 1 , Metabolic Unit, Free University Hospital, Amsterdam, Institute for Metabolic Disease 2 , Baylor<br />
University Medical C<strong>en</strong>ter, Dallas, USA, Departm<strong>en</strong>ts of Clinical Chemistry and Pediatrics 3 , Academic Medical C<strong>en</strong>tre, Amsterdam,<br />
The Netherlands<br />
Phytanic acid is a branched-chain fatty acid in the human diet<br />
that, under normal circumstances, is rapidly degraded. The<br />
mechanism of this degradation remained unknown for a long<br />
time. Rec<strong>en</strong>tly, however, it was discovered that phytanic acid<br />
is first activated to phytanoyl-CoA, after which 2-hydroxyphytanoyl-CoA<br />
is formed. 2-Hydroxyphytanoyl-CoA is converted<br />
into pristanal, a process by which formyl-CoA is released.<br />
Pristanal is converted into pristanic acid, a fatty acid that can<br />
be degraded by normal β-oxidation.<br />
In several g<strong>en</strong>etic peroxisomal disorders, phytanic acid degradation<br />
is impaired. This results in accumulation of phytanic<br />
acid in blood and tissues. We studied α-oxidation of phytanic<br />
acid in fibroblasts from controls and pati<strong>en</strong>ts affected with classical<br />
Refsum disease, rhizomelic chondrodysplasia punctata,<br />
g<strong>en</strong>eralized peroxisomal defects and peroxisomal bifunctional<br />
protein defici<strong>en</strong>cy.<br />
Human cultured fibroblasts were incubated with phytanic<br />
acid, after which medium and cells were collected separately.<br />
89. Human dihydroxyacetonephosphate acyltransferase (DHAPAT): cloning of the DHAPAT cDNA and molecular<br />
basis of rhizomelic chondrodysplasia punctata type 2<br />
R. OFMAN 1 , E.H. HETTEMA 1,2 , E. HOGENHOUT 1 , A.O. MUIJSERS 2 and R.J.A. WANDERS 1,3<br />
University of Amsterdam, Academic Medical C<strong>en</strong>tre, Departm<strong>en</strong>ts of Clinical Chemistry 1 , Biochemistry 2 and Pediatrics, Emma<br />
Childr<strong>en</strong>’s Hospital 3 , Amsterdam, The Netherlands<br />
Rhizomelic chondrodysplasia punctata (RCDP) belongs to the<br />
group of peroxisomal disorders and is clinically characterized<br />
by a disproportionately short stature, cataract, m<strong>en</strong>tal retardation<br />
a.o. Biochemically, 3 distinct forms can be distinguished.<br />
In RCDP type 1, four peroxisomal abnormalities involving<br />
defici<strong>en</strong>cies of:<br />
1. dihydroxyacetonephosphate acyltransferase (DHAPAT)<br />
2. alkyldihydroxyacetonephosphate synthase (alkyl DHAP<br />
synthase)<br />
3. phytanoyl-CoA hydroxylase<br />
4. peroxisomal 41 kDa thiolase I have be<strong>en</strong> described.<br />
We rec<strong>en</strong>tly id<strong>en</strong>tified the primary defect in RCDP type 1 at<br />
the level of the PEX7-g<strong>en</strong>e coding for the PTS2 receptor<br />
involving in peroxisome <strong>bio</strong>g<strong>en</strong>esis (Motley et al. Nature<br />
2-Hydroxyphytanic acid and pristanic acid were measured in<br />
the medium by stable isotope dilution gas chromatography<br />
mass spectrometry.<br />
In controls, 2-hydroxyphytanic acid and pristanic acid could<br />
be detected in the medium after incubation with phytanic acid,<br />
proving that the α-oxidation of phytanic acid via 2-hydroxyphytanoyl-CoA<br />
to pristanic acid was active and intermediates<br />
were excreted into the medium.<br />
In medium from cells with an α-oxidation defect (obtained from<br />
pati<strong>en</strong>ts with Refsum disease, rhizomelic chondrodysplasia<br />
punctata and g<strong>en</strong>eralized peroxisomal defects) 2-hydroxyphytanic<br />
acid and pristanic acid were low or not detectable,<br />
showing that in these disorders the hydroxylation of phytanoyl-<br />
CoA to 2-hydroxyphytanoyl-CoA is defici<strong>en</strong>t.<br />
In medium from cells with a peroxisomal β-oxidation defect,<br />
2-hydroxyphytanic acid and pristanic acid were formed in<br />
amounts comparable to those in the controls.<br />
G<strong>en</strong>etics 1997; 15: 377-380). RCDP types 2 and 3 are due to<br />
isolated defici<strong>en</strong>cies of DHAPAT and alkylDHAP synthase,<br />
respectively.<br />
We have purified DHAPAT from human plac<strong>en</strong>ta, performed<br />
N-terminal aminoacid sequ<strong>en</strong>cing and used this information to<br />
search for EST-clones. This led to the id<strong>en</strong>tification of a fulll<strong>en</strong>ght<br />
cDNA which was found to <strong>en</strong>code DHAPAT after<br />
expression in yeast. In all RCDP type 2 pati<strong>en</strong>ts we found<br />
mutations in the DHAPAT cDNAs. In conclusion, we have<br />
resolved the molecular basis of RCDP type 2 which is of c<strong>en</strong>tral<br />
importance for carrier detection and pr<strong>en</strong>atal diagnosis.<br />
Construction of a mouse DHAPAT knock-out is underway to<br />
study the in vivo function of etherphospholipids and pot<strong>en</strong>tial<br />
therapeutic measures.<br />
90. Cholesterol <strong>bio</strong>synthesis in man, peroxisomes and peroxisomal disorders: differ<strong>en</strong>tial defici<strong>en</strong>cy of mevalonate<br />
kinase and phosphomevalonate kinase in Zellweger syndrome and rhizomelic chondrodysplasia punctata<br />
R.J.A. WANDERS 1,2 and G.J. ROMEIJN 1<br />
University of Amsterdam, Academic Medical C<strong>en</strong>tre, Departm<strong>en</strong>ts of Clinical Chemistry 1 and Pediatrics, Emma Childr<strong>en</strong>’s<br />
Hospital 2 , Amsterdam, The Netherlands<br />
Biosynthesis of cholesterol is a vital function of virtually all<br />
kinds of cells and involves the complicated interaction<br />
betwe<strong>en</strong> a large variety of <strong>en</strong>zymes in differ<strong>en</strong>t subcellular<br />
compartm<strong>en</strong>ts. Synthesis starts with the cond<strong>en</strong>sation of 2<br />
acetyl-CoA molecules followed by addition of another one,<br />
subsequ<strong>en</strong>tly producing 3-hydroxy-3-methylglutaryl-CoA<br />
(HMG-CoA) which is converted into mevalonate by HMG-<br />
CoA reductase. Two subsequ<strong>en</strong>t phosphorylations catalyzed<br />
by mevalonate kinase (MK) and phosphomevalonate kinase<br />
(PMK) produce mevalonatepyrophosphate. There are reports<br />
in literature suggesting the involvem<strong>en</strong>t of peroxisomes in<br />
cholesterol synthesis. We have now measured the activity of<br />
MK and PMK in livers from Zellweger pati<strong>en</strong>ts in which<br />
peroxisome <strong>bio</strong>g<strong>en</strong>esis is fully defective and pati<strong>en</strong>ts affected<br />
by rhizomelic chondrodysplasia punctata (RCDP) type I<br />
resulting from a defective PTS2-receptor. MK and PMK were<br />
both found to be defici<strong>en</strong>t in liver from Zellweger pati<strong>en</strong>ts<br />
whereas in RCDP type I there was defici<strong>en</strong>t activity of MK<br />
but not PMK, suggesting that MK belongs to the group of<br />
peroxisomal proteins with a peroxisome-targeting-signal 2<br />
(PTS2). Inspection of the aminoacid sequ<strong>en</strong>ce indeed shows<br />
the pres<strong>en</strong>ce of such a signal.<br />
Tak<strong>en</strong> together, our data provide convincing indep<strong>en</strong>d<strong>en</strong>t<br />
evid<strong>en</strong>ce for a crucial role of peroxisomes in cholesterol<br />
synthesis. This is now under detailed study.<br />
96 Ned Tijdschr Klin Chem 1998, vol. 23, no. 2
91. Snelle diagnostiek: basis voor e<strong>en</strong> goede afloop bij e<strong>en</strong> patiëntje met MTHFR deficiëntie<br />
N.G.G.M. ABELING 1 , A.H. van GENNIP 1 , H. BLOM 2 , R.A. WEVERS 2 , P. VREKEN 1 , H.L.G. van TINTEREN 3 <strong>en</strong><br />
H.D. BAKKER 1<br />
Laboratorium G<strong>en</strong>etische Metabole Ziekt<strong>en</strong>, Afdeling <strong>Klinische</strong> Chemie <strong>en</strong> Divisie Emma Kinderziek<strong>en</strong>huis 1 , AMC, Universiteit van<br />
Amsterdam, Amsterdam; Laboratorium Kinderg<strong>en</strong>eeskunde & Neurologie 2 , Academisch Ziek<strong>en</strong>huis Nijmeg<strong>en</strong> <strong>en</strong> Afd. Kinderg<strong>en</strong>eeskunde<br />
3 , Ziek<strong>en</strong>huis Hilversum<br />
B.K., e<strong>en</strong> meisje van consanguine Turkse ouders, werd na e<strong>en</strong><br />
premature geboorte in de tweede lev<strong>en</strong>sweek opg<strong>en</strong>om<strong>en</strong> met<br />
brak<strong>en</strong>, voedselweigering, recidiver<strong>en</strong>de bradycardie <strong>en</strong> icterus.<br />
Gedacht werd aan sepsis, maar dit kon niet word<strong>en</strong> bevestigd,<br />
waardoor de verd<strong>en</strong>king op e<strong>en</strong> stofwisselingsziekte rees.<br />
In de hiervoor ingezond<strong>en</strong> urine werd bij de aminozuur-analyse<br />
e<strong>en</strong> fors verhoogde excretie van (vrij) homocystine gemet<strong>en</strong><br />
(73 µmol/mmol kreat.; ref.
93. Phytanoyl-CoA hydroxylase (PhyH): <strong>en</strong>zyme purification, id<strong>en</strong>tification of the PhyH cDNA and the molecular<br />
basis of classical Refsum diseases<br />
G.A. JANSEN 1 , S. FERDINANDUSSE 1 , R. OFMAN 1 , L. IJLST 1 , T.O. MUIJSERS 2 , O.H. SKJELDAL 3 , O. STOKKE 3 ,<br />
C. JAKOBS 4 , G.T.N. BESLEY 5 , J.E. WRAITH 5 and R.J.A. WANDERS 1,6<br />
University of Amsterdam, Academic Medical C<strong>en</strong>tre, Departm<strong>en</strong>t of Clinical Chemistry 1 , Biochemistry 2 and Pediatrics 6 , Amsterdam,<br />
The Netherlands and Rikshospitalet, Oslo, Norway 3 , Free University of Amsterdam 4 , Manchester Childr<strong>en</strong>’s Hospital, Manchester,<br />
United Kingdom 5<br />
Phytanic acid (3, 7, 11, 15-tetramethylhexadecanoic acid) is a<br />
branched-chain fatty acid which is solely derived from dietary<br />
sources. The methylgroup at the 3-position prohibits immediate<br />
β-oxidation, requiring removal of the terminal carboxylgroup<br />
by α-oxidation. The mechanism of α-oxidation has long<br />
remained obscure but rec<strong>en</strong>t studies have led to the id<strong>en</strong>tification<br />
of phytanoyl-CoAhydroxylase, a remarkable type of<br />
<strong>en</strong>zyme catalyzing the 2-ketoglutarate, Fe 2+ and ascorbate<br />
dep<strong>en</strong>d<strong>en</strong>t hydroxylation of phytanoyl-CoA to 2-hydroxyphytanoyl-CoA.<br />
The <strong>en</strong>zyme turned out to be located in peroxisomes<br />
and defici<strong>en</strong>t in 3 differ<strong>en</strong>t types of peroxisomal<br />
disorders:<br />
1. Zellweger syndrome<br />
2. Rhizomelic chondrodysplasia punctata<br />
3. Classical Refsum disease.<br />
We have purified the <strong>en</strong>zyme from rat liver peroxisomes to<br />
homog<strong>en</strong>eity and performed N-terminal sequ<strong>en</strong>cing which led<br />
the way to the putative PhyH cDNA. Expression in the yeast<br />
S. cerevisiae indeed proved the id<strong>en</strong>tity of the PhyH cDNA.<br />
The cDNA appeared to code for a protein with a PTS2sequ<strong>en</strong>ce<br />
explaining the defici<strong>en</strong>cy in RCDP. Mutation<br />
analysis in classical Refsum pati<strong>en</strong>ts revealed a series of differ<strong>en</strong>t<br />
mutations in all pati<strong>en</strong>ts thus id<strong>en</strong>tifying the molecular<br />
basis of Refsum disease. We have also id<strong>en</strong>tified the murine<br />
PhyH cDNA, resolved part of the g<strong>en</strong>e structure which will<br />
form the basis for the construction of a mouse model.<br />
94. Mitochondrial fatty acid β-oxidation disorders: resolution of the molecular basis of hepatic CPT I defici<strong>en</strong>cy<br />
in a pati<strong>en</strong>t<br />
L. IJLST 1 , H. MANDEL 3 , W. OOSTHEIM 1 , J.P.N. RUITER 1 and R.J.A. WANDERS 1,2<br />
Academic Medical C<strong>en</strong>tre, Univ. of Amsterdam, Dept. of Clinical Chemistry 1 and Paediatrics 2 , Amsterdam, The Netherlands;<br />
Rambam Medical C<strong>en</strong>tre, Dept. of Pediatrics 3 , Haifa, Israel<br />
The mitochondrial ß-oxidation of long-chain fatty acids is the<br />
major source of <strong>en</strong>ergy production in man. Prior to its catabolism<br />
long-chain fatty acids are activated to its CoA ester and<br />
transported across the mitochondrial membrane. Three differ<strong>en</strong>t<br />
g<strong>en</strong>e products are involved in this carnitine dep<strong>en</strong>d<strong>en</strong>t<br />
transport shuttle: carnitine palmitoyl-CoA transferase I (CPT<br />
I), carnitine acyl-carnitine carrier (CAC) and carnitine palmitoyl-CoA<br />
transferase II (CPT II). The first <strong>en</strong>zyme (CPT I)<br />
converts the fatty acid-CoA ester to its car-nitine ester which<br />
is th<strong>en</strong> transported across the mitochondrial inner-membrane<br />
by CAC. Once inside the mitochondrial lum<strong>en</strong> CPT II reconverts<br />
the carnitine ester back to the CoA ester which can th<strong>en</strong><br />
serve as a substrate for the ß-oxidation spiral.<br />
At least 10 pati<strong>en</strong>ts with CPT I defici<strong>en</strong>cy have be<strong>en</strong> described<br />
pres<strong>en</strong>ting with coma, seizures, hepatomegaly and hypoketotic<br />
hypoglycaemia, usually associated with fasting after diarrhoea<br />
or a viral infection.<br />
Two differ<strong>en</strong>t isoforms of CPT I are id<strong>en</strong>tified: a hepatic form<br />
(CPT IA) and a muscle form (CPT IB) both <strong>en</strong>coded by differ<strong>en</strong>t<br />
g<strong>en</strong>es located on chromosome 11q and 22q respectively<br />
(1). Since the cloning of the human CPT IA g<strong>en</strong>e (hepatic<br />
form) in 1995 (2) no mutations are described sofar in pati<strong>en</strong>ts.<br />
The hepatic isoform is expressed in differ<strong>en</strong>t tissues including<br />
fibroblasts. The pati<strong>en</strong>t pres<strong>en</strong>ted here showed no CPT I<br />
activity (
Gynecologie <strong>en</strong> Obstetrie<br />
96. Elevated serum IL-8, IL-6 and TNF-α in wom<strong>en</strong> with preeclampsia<br />
F.V. VELZING-AARTS 1 , F.P.L. van der DIJS 2 and A.J. DUITS 3,4<br />
C<strong>en</strong>tral Laboratory for Clinical Chemistry, University Hospital Groning<strong>en</strong> 1 , Departm<strong>en</strong>t Clinical Chemistry Public Health Laboratory<br />
Curaçao 2 , Clinical Laboratory St Elisabeth Hospital Curaçao 3 and Red Cross Bloodbank Curaçao 4<br />
Endothelial damage plays a major role in the pathog<strong>en</strong>esis of<br />
preeclampsia. The mechanisms leading to this damage remain<br />
to be elucidated. Rec<strong>en</strong>t data suggest an important role of<br />
cytokines in this process; high levels of interleukin-6 (IL-6)<br />
and tumor necrosis factor-α (TNF-α) have be<strong>en</strong> reported.<br />
However, due to the complex and pleiotropic nature of the<br />
immune system a well matched group of control pati<strong>en</strong>ts is<br />
required to critically analyze the role of cytokines in<br />
preeclampsia. We conducted a study in which 14 preeclamptic<br />
wom<strong>en</strong> were matched for gestational age, parity, maternal age<br />
and socio-economical status to 14 healthy pregnant wom<strong>en</strong>.<br />
Preeclampsia was defined as a diastolic blood pressure of ≥90<br />
mm Hg in combination with proteinuria of ≥0.3 g/l. Control<br />
wom<strong>en</strong> were normot<strong>en</strong>sive and nonproteinuric at the time of<br />
blood sampling. Mean serum levels of IL-8, IL-6 and TNF-α<br />
Ned Tijdschr Klin Chem 1998, vol. 23, no. 2<br />
in both groups were determined using an Enzyme Linked<br />
Immuno Sorbant Assay technique. Betwe<strong>en</strong> group differ<strong>en</strong>ces<br />
of serum cytokine levels were analyzed using a two-tailed<br />
Wilcoxon matched pairs signed rank test at p
99. Umbilical vessels in preeclamptic pregnancies have low cont<strong>en</strong>ts of both ω3 and ω6 long chain polyunsaturated<br />
fatty acids<br />
F.V. VELZING-AARTS 1 , F.R.M. van der KLIS 2 , F.P.L. van der DIJS 2 and F.A.J. MUSKIET 1<br />
C<strong>en</strong>tral Laboratory for Clinical Chemistry, University Hospital Groning<strong>en</strong> 1 and Public Health Laboratory, Curaçao 2<br />
We determined the fatty acid compositions of maternal and<br />
umbilical platelets (PLT), and of the umbilical arteries (UA)<br />
and veins (UV) of 27 preeclamptic pregnancies and 24<br />
normot<strong>en</strong>sive controls, mostly of Afro-Caribbean desc<strong>en</strong>t.<br />
Betwe<strong>en</strong>-group differ<strong>en</strong>ces were analyzed with the Kruskal-<br />
Wallis test or with analysis of covariance with gestational age<br />
as covariate. PLT of preeclamptic wom<strong>en</strong> contained lower<br />
20:5ω3, and a higher 20:4ω6/20:5ω3 ratio. Linear discriminant<br />
analysis revealed higher 20:4ω6. Major differ<strong>en</strong>ces were<br />
found in UV and especially UA fatty acid compositions.<br />
UA and UV of preeclamptic pregnancies contained lower<br />
100. Laboratorium diagnostiek van ovariële reserve<br />
Het to<strong>en</strong>em<strong>en</strong>d gebruik van geassisteerde voortplantingstechniek<strong>en</strong><br />
roept de vraag op om adequate diagnostiek van<br />
ovariele capaciteit. E<strong>en</strong> ideale test voor het vaststell<strong>en</strong> van de<br />
ovariele capaciteit is non-invasief, analytisch betrouwbaar, geschikt<br />
voor routine diagnostiek <strong>en</strong> goedkoop. De gebruikelijke<br />
bepaling van FSH in serum op de derde cyclusdag hebb<strong>en</strong> wij<br />
gedaan naast seriële serumbepaling<strong>en</strong> van FSH, bepaling van<br />
FSH in urine, IGF-I <strong>en</strong> IGFBP-3 bepaling<strong>en</strong> in folliculair<br />
vocht <strong>en</strong> bepaling van apoptose in granulosa cell<strong>en</strong>.<br />
Bij 40 perim<strong>en</strong>opauzale vrouw<strong>en</strong> hebb<strong>en</strong> wij e<strong>en</strong> seriële<br />
meting van serum FSH op dezelfde dag vergelek<strong>en</strong> met FSH<br />
in e<strong>en</strong> ocht<strong>en</strong>durine, e<strong>en</strong> willekeurig urinemonster <strong>en</strong> e<strong>en</strong><br />
24-uurs urinemonster. De bepaling<strong>en</strong> zijn gedaan in ongeextraheerde<br />
urinemonsters met e<strong>en</strong> AxSYM random access<br />
immunoassay analyzer (Abbott Laboratories).<br />
De correlatie tuss<strong>en</strong> FSH in geextraheerde <strong>en</strong> ongeextraheerd<br />
urinemonster was goed. Volg<strong>en</strong>s onze resultat<strong>en</strong> is de optimale<br />
bewaarconditie op 4°C zonder additiva. De correlatiecoëffici<strong>en</strong>t<br />
tuss<strong>en</strong> de gemiddelde serum FSH-waard<strong>en</strong> van de seriële<br />
meting <strong>en</strong> de FSH in urine is 0,904 in ocht<strong>en</strong>durine, 0,915 in<br />
e<strong>en</strong> willekeurig urinemonster <strong>en</strong> 0,857 in 24-uurs urine.<br />
long chain polyunsaturated fatty acids of the ω3-series<br />
(LCPUFAω3), LCPUF-Aω6 and 20:3ω6. UA had lower<br />
20:4ω6, higher 20:3ω9 and 20:3ω9/20:4ω6. We conclude that<br />
the low LCPUFAω3 and LCPUFAω6 levels in umbilical<br />
vessels of preeclamptic wom<strong>en</strong> with adequate ω6 status may<br />
indicate insuffici<strong>en</strong>t LCPUFA transplac<strong>en</strong>tal transfer. The low<br />
20:4ω6, high 20:3ω9 and high 20:3ω9/20:-4ω6 ratio in UA<br />
may unfavor-ably affect local prostacyclin production and<br />
cause other 20:3ω9 related adverse effects. Low 20:3ω6 in UV<br />
and UA, and low 20:5ω3 in maternal PLT, may contribute to<br />
the dominance of 20:4ω6 derived eicosanoids.<br />
G.J.E. OOSTERHUIS 1 , C.B. LAMBALK 2 , H.W.B. MICHGELSEN 1 , J. SCHOEMAKER 2 <strong>en</strong> I. VERMES 1<br />
Medisch Spectrum Tw<strong>en</strong>te, Enschede 1 <strong>en</strong> Academisch Ziek<strong>en</strong>huis Vrije Universiteit, afdeling Gynaecologie <strong>en</strong> Obstetrie, Amsterdam 2<br />
Wij bepaald<strong>en</strong> IGF-I <strong>en</strong> IGFBP-3 in folliculair vocht na ovariele<br />
hyperstimulatie in e<strong>en</strong> IVF-programma. IGF-I in folliculair<br />
vocht was significant gecorreleert met het aantal follikels,<br />
e<strong>en</strong> maat voor de respons op de behandeling. IGFBP-3 was<br />
niet gecorreleerd met de klinische <strong>en</strong> <strong>bio</strong>chemische variabel<strong>en</strong><br />
van de ovariumfunctie.<br />
Ook hebb<strong>en</strong> wij apoptose gemet<strong>en</strong> met behulp van de TUNEL<br />
techniek op de flowcytometer in granulosacell<strong>en</strong>, geisoleerd<br />
uit folliculair vocht na e<strong>en</strong> IVF-punctie. In e<strong>en</strong> groep pati<strong>en</strong>t<strong>en</strong><br />
met normale basale FSH, significant meer granulosacell<strong>en</strong><br />
war<strong>en</strong> apoptotisch bij vrouw<strong>en</strong> die niet zwanger werd<strong>en</strong> tijd<strong>en</strong>s<br />
de behandeling in vergelijking met vrouw<strong>en</strong> die wel<br />
zwanger zijn geword<strong>en</strong> (p=0,021).<br />
Hoewel nieuwe techniek<strong>en</strong> als IGF-I in folliculair vocht <strong>en</strong><br />
apoptosemeting<strong>en</strong> in granulosacell<strong>en</strong> veel informatie verschaff<strong>en</strong><br />
betreff<strong>en</strong>de de folliculog<strong>en</strong>ese, FSH op de derde cyclusdag<br />
blijft de goud<strong>en</strong> standaard. Volg<strong>en</strong>s onze resultat<strong>en</strong> met urinair<br />
FSH is het bepal<strong>en</strong> van FSH in ongeextraheerde monsters<br />
voor de routine laboratoriumdiagnostiek het meest geschikt<br />
als maat voor ovariele reserve.<br />
101. Lipoprotein(a) conc<strong>en</strong>trations in pati<strong>en</strong>ts with a history of severe preeclampsia; a case control study<br />
A. van d<strong>en</strong> ENDE, M.G. van PAMPUS 1 , M.M.W. KOOPMAN, H. WOLF 1 , H.R. BULLER and M.H. PRINS 2 .<br />
Dept. of Haemostasis, Thrombosis, Atherosclerosis and Inflammation; Dept. of Gynaecology and Obstetrics 1 ; Dept. of Clinical<br />
Epidemiology and Biostatistics 2 ; Academic Medical C<strong>en</strong>ter, Amsterdam, The Netherlands<br />
Objective: High conc<strong>en</strong>tration of lipoprotein(a), Lp(a), is associated<br />
with atherosclerotic disease. Atheroma may develop in<br />
spiral arteries that have be<strong>en</strong> invaded by <strong>en</strong>dovascular trophoblast<br />
in both preeclamptic and normal pregnancies, although in<br />
preeclampsia it is much more common, especially in the<br />
decidual segm<strong>en</strong>ts. We hypothesised that a high conc<strong>en</strong>tration<br />
of Lp(a) is associated with the developm<strong>en</strong>t of preeclampsia.<br />
In cases of spontaneous abortion the mechanism of physiological<br />
changes in spiral arteries is oft<strong>en</strong> defective and seems<br />
to be associated with a reduction in trophoblast invasion. We<br />
therefore also investigated whether high conc<strong>en</strong>trations of<br />
Lp(a) are also associated with spontaneous abortion.<br />
Study design: Sev<strong>en</strong>ty-six pati<strong>en</strong>ts with a history of severe<br />
preeclampsia and sixty-sev<strong>en</strong> age-matched controls with a<br />
history of normal pregnancies only were investigated for<br />
raised Lp(a) levels at least 10 weeks postpartum in the second<br />
half of a normal m<strong>en</strong>strual cycle. None of the controls or<br />
pati<strong>en</strong>ts were pregnant or using oral contraceptives. Lp(a) ><br />
420 mg/l was defined as "abnormal" corresponding to the 90th<br />
perc<strong>en</strong>tile of the Lp(a) distribution of our control group.<br />
Results: There was no significant differ<strong>en</strong>ce betwe<strong>en</strong> the<br />
preval<strong>en</strong>ce of abnormal levels of Lp(a) in the pati<strong>en</strong>t group<br />
(21%) and in the control group (10.4%). Sev<strong>en</strong> pati<strong>en</strong>ts had<br />
at least one spontaneous abortion, 5 of these had abnormal<br />
conc<strong>en</strong>trations of Lp(a). Two pati<strong>en</strong>ts experi<strong>en</strong>ced recurr<strong>en</strong>t<br />
abortion and both had abnormal Lp(a) levels.<br />
Conclusions: A history of severe preeclampsia alone is not<br />
associated with high Lp(a) conc<strong>en</strong>trations. A history of severe<br />
preeclampsia and spontaneous abortion, however, is significantly<br />
associated with elevated Lp(a). (Whether spontaneous<br />
abortion or recurr<strong>en</strong>t abortion and high conc<strong>en</strong>tration of Lp(a)<br />
are causal, has yet to be demonstrated.)<br />
100 Ned Tijdschr Klin Chem 1998, vol. 23, no. 2
102. Scre<strong>en</strong>ing op irregulaire antistoff<strong>en</strong> bij zwanger<strong>en</strong> in de 12de week: resultat<strong>en</strong> van 1,5 jaar onderzoek<br />
E. van VOORST tot VOORST, M. FOKKERT, J. KOLKMAN-de VROOMEN, S. KOEKKOEK-MEIJER <strong>en</strong> M. WES-<br />
TERVOORDE<br />
Laboratorium Ziek<strong>en</strong>huis De Weez<strong>en</strong>land<strong>en</strong>, Zwolle<br />
Inleiding: Naar aanleiding van de aanbeveling van het College<br />
voor de Bloedtransfusie (januari 1994) om vrouw<strong>en</strong> jonger<br />
dan 45 jaar, uitsluit<strong>en</strong>d erytrocyt<strong>en</strong> toe te di<strong>en</strong><strong>en</strong> die compatibel<br />
zijn m.b.t. de antig<strong>en</strong><strong>en</strong> c, E <strong>en</strong> K, wordt door ons<br />
laboratorium sinds <strong>en</strong>ige tijd ook de scre<strong>en</strong>ing op irregulaire<br />
antistoff<strong>en</strong> (IRRA’s) gedaan bij zwanger<strong>en</strong> in de twaalfde<br />
week van hun zwangerschap in het bloed dat afg<strong>en</strong>om<strong>en</strong> wordt<br />
voor de bloedgroep- <strong>en</strong> rhesus(D) antige<strong>en</strong>bepaling.<br />
Resultat<strong>en</strong>: De resultat<strong>en</strong> van 18 maand<strong>en</strong> (augustus 1996 tot <strong>en</strong><br />
met januari 1998) onderzoek word<strong>en</strong> hieronder weergegev<strong>en</strong>.<br />
Totaal aantal IRRA’s: 1348, waarvan 25 positief (1,85%)<br />
Van deze 25:<br />
- 4 niet van belang voor zwangerschap of transfusie<br />
- 12 niet van belang voor zwangerschap (wel voor het vind<strong>en</strong><br />
van compatibel bloed)<br />
- 9 van belang voor zwangerschap: 1x anti-D, 1x anti-C, 2x<br />
anti-Cw, 1x anti-c, 1x anti-E, 2x anti-K, 1x anti-S<br />
Verzoek om het betreff<strong>en</strong>de antige<strong>en</strong> bij de vader te onderzoek<strong>en</strong><br />
werd tot nu toe 4x gehonoreerd: 2x negatief (1x Cw, 1x K), 1x<br />
heterozygoot (Ss) <strong>en</strong> 1x homozygoot (cc). Het tweede kind van<br />
de moeder met de anti-D is ev<strong>en</strong>als het eerste rhesus(D) positief.<br />
Kwaliteitsbewaking, data handeling, refer<strong>en</strong>tiewaard<strong>en</strong> <strong>en</strong> statistiek<br />
103. Bevordering van kwaliteitsbewustzijn in de laboratoriumorganisatie<br />
P.C.M. BARTELS <strong>en</strong> M. SCHOORL<br />
Laboratorium voor <strong>Klinische</strong> Chemie, Hematologie & Immunologie, Medisch C<strong>en</strong>trum Alkmaar<br />
Sinds het behal<strong>en</strong> van het CCKL test certificaat is inmiddels<br />
2 1 /2 jaar verstrek<strong>en</strong>. De uitreiking van het certificaat was e<strong>en</strong><br />
belangrijke mijlpaal ter afsluiting van e<strong>en</strong> periode van ruim<br />
2 jaar waarin het acc<strong>en</strong>t van kwaliteitsd<strong>en</strong>k<strong>en</strong> hoofdzakelijk<br />
gericht was op het e<strong>en</strong>duidig beschrijv<strong>en</strong> van criteria <strong>en</strong> richtlijn<strong>en</strong><br />
voor process<strong>en</strong> <strong>en</strong> procedures. Van meet af aan is aan de<br />
beïnvloeding van m<strong>en</strong>taliteit <strong>en</strong> attitude van de individuele<br />
medewerker echter ev<strong>en</strong>zeer ruimschoots aandacht besteed.<br />
Instructies <strong>en</strong> richtlijn<strong>en</strong> kom<strong>en</strong> immers pas optimaal tot hun<br />
recht bij intrinsiek gemotiveerde medwerkers. Na accreditatie<br />
is het daarom zaak om de individuele medewerker frequ<strong>en</strong>t te<br />
stimuler<strong>en</strong> <strong>en</strong> uit te nodig<strong>en</strong> om te participer<strong>en</strong> in verbetercycli.<br />
Verscheid<strong>en</strong>e instrum<strong>en</strong>t<strong>en</strong> kunn<strong>en</strong> hiervoor word<strong>en</strong> toege-<br />
104. Systematische reviews van diagnostische trials<br />
W.P. OOSTERHUIS 1 <strong>en</strong> S. SANDBERG 2<br />
Ziek<strong>en</strong>huis de Heel, Zaandam 1 <strong>en</strong> Haukeland University Hospital, Berg<strong>en</strong>, Noorweg<strong>en</strong> 2<br />
Rec<strong>en</strong>t heeft de IFCC e<strong>en</strong> nieuwe commissie ingesteld die<br />
zich bezighoudt met systematisch literatuuronderzoek: de<br />
'Committee on Systematic Reviewing in Laboratory Medicine'<br />
(commissie-SRLM). Het uitvoer<strong>en</strong> van e<strong>en</strong> systematisch<br />
review van diagnostische tests kan word<strong>en</strong> beschouwd als e<strong>en</strong><br />
nieuwe wet<strong>en</strong>schappelijke discipline. Deze k<strong>en</strong>t zijn eig<strong>en</strong><br />
method<strong>en</strong>: vooral wat betreft het valider<strong>en</strong> van de originele<br />
(primaire) studies, maar ook de statistische methodes die toegepast<br />
word<strong>en</strong> om de gegev<strong>en</strong>s te analyser<strong>en</strong> <strong>en</strong> sam<strong>en</strong> te<br />
vatt<strong>en</strong>. E<strong>en</strong> werkgroep binn<strong>en</strong> de Cochrane Collaboration<br />
heeft aanbeveling<strong>en</strong> gedaan hoe e<strong>en</strong> systematisch review moet<br />
Ned Tijdschr Klin Chem 1998, vol. 23, no. 2<br />
Constatering:<br />
- Er di<strong>en</strong>t nader onderzoek te word<strong>en</strong> verricht betreff<strong>en</strong>de de<br />
antig<strong>en</strong><strong>en</strong> op de erytrocyt<strong>en</strong> van 4 vaders (ofwel van de<br />
babies). Tev<strong>en</strong>s is het gew<strong>en</strong>st het verloop van de zwangerschap<br />
na te gaan, te volg<strong>en</strong> <strong>en</strong> /of te bewak<strong>en</strong> (zeker bij de<br />
klinisch belangrijke antistoff<strong>en</strong>).<br />
- Tot nu toe zijn er minst<strong>en</strong>s 3 antistoff<strong>en</strong> (anti-c, anti-D <strong>en</strong><br />
anti-S) gevond<strong>en</strong> (aantal kan 7 word<strong>en</strong>), die hemolytische<br />
ziekte van de pasgebor<strong>en</strong>e kunn<strong>en</strong> veroorzak<strong>en</strong> (2,2 (5,2)<br />
pro mille).<br />
- In minst<strong>en</strong>s 1 geval (anti-K, vader K-antige<strong>en</strong> negatief) is<br />
in het verled<strong>en</strong> niet-compatibel bloed getransfundeerd,<br />
echter niet schadelijk voor deze zwangerschap.<br />
- Er zijn 1 anti-D <strong>en</strong> 5 andere rhesus-antistoff<strong>en</strong> in deze<br />
populatie van 1348 zwanger<strong>en</strong> gevond<strong>en</strong>.<br />
Conclusie: De in ons ziek<strong>en</strong>huis geld<strong>en</strong>de aanbeveling lijkt<br />
e<strong>en</strong> juiste: alle zwangere vrouw<strong>en</strong> di<strong>en</strong><strong>en</strong> tijd<strong>en</strong>s hun zwangerschap<br />
(12de week, tegelijk met bloedgroep / rhesus én 7-8ste<br />
maand) onderzocht te word<strong>en</strong> op irregulaire antistoff<strong>en</strong> teg<strong>en</strong><br />
erytrocyt<strong>en</strong> antig<strong>en</strong><strong>en</strong>.<br />
past. Met behulp van interne audits word<strong>en</strong> sterkere <strong>en</strong><br />
zwakkere schakels van het kwaliteitssysteem geïnv<strong>en</strong>tariseerd.<br />
Externe audits hebb<strong>en</strong> bov<strong>en</strong>di<strong>en</strong> als voordeel dat 'vreemde<br />
og<strong>en</strong> dwing<strong>en</strong>'. Implem<strong>en</strong>tatie van e<strong>en</strong> systeem voor integrale<br />
kwaliteitszorg biedt aanknopingspunt<strong>en</strong> voor aanpassing van<br />
de bedrijfscultuur. E<strong>en</strong> belangrijke compon<strong>en</strong>t van het opleiding-<br />
<strong>en</strong> nascholingsplan behelst beinvloeding van m<strong>en</strong>taliteit<br />
<strong>en</strong> attitude. Consequ<strong>en</strong>te melding van ideeën, klacht<strong>en</strong> <strong>en</strong> onvolkom<strong>en</strong>hed<strong>en</strong><br />
is ess<strong>en</strong>tieel om de doelmatigheid van het<br />
kwaliteitssysteem te optimaliser<strong>en</strong>. Het patroon van klacht<strong>en</strong><br />
wordt nader geëvalueerd naar omvang <strong>en</strong> verscheid<strong>en</strong>heid.<br />
Door toepassing van b<strong>en</strong>ch marking kunn<strong>en</strong> organisaties elkaar<br />
systematisch feed back gev<strong>en</strong> <strong>en</strong> stimuler<strong>en</strong> bij het bewerkstellig<strong>en</strong><br />
van creatieve oplossing<strong>en</strong> voor weerbarstige knelpunt<strong>en</strong>.<br />
word<strong>en</strong> uitgevoerd (Cochrane Methods Working Group on<br />
Systematic Review of Scre<strong>en</strong>ing and Diagnostic Tests). Deze<br />
richtlijn<strong>en</strong> staan op internet (http:// som.flinders.edu.au/<br />
FUSA/ cochrane/ cochrane/ crgs.htm)<br />
De IFCC ondersteunt systematische onderzoek van diagnostische<br />
trials <strong>en</strong> beschouwt het als de basis van de rationele toepassing<br />
van laboratoriumdiagnostiek. De nieuw gevormde<br />
commissie-SRLM, onderdeel van de Managem<strong>en</strong>t and Education<br />
divisie van de IFCC, heeft de taak gekreg<strong>en</strong> dit onderzoek<br />
binn<strong>en</strong> het vakgebied te stimuler<strong>en</strong>.<br />
De commissie is zelf begonn<strong>en</strong> met e<strong>en</strong> review van de litera-<br />
101
tuur betreff<strong>en</strong>de de diagnostische waarde van test<strong>en</strong> op het gebied<br />
van vitamine B12-deficiëntie. De National Health Service<br />
Research C<strong>en</strong>tre for Reviews and Dissemination in the UK<br />
(http:// www.york.ac.uk/ inst/ crd/ search.htm) gev<strong>en</strong> voorbeeld<strong>en</strong><br />
van gestructureerde zoekstrategieën voor Medline. De<br />
verzamelde literatuur wordt op kwaliteit getoetst door toepassing<br />
van validatieregels waaraan de onderzoeksresultat<strong>en</strong><br />
moet<strong>en</strong> voldo<strong>en</strong>. De resultat<strong>en</strong> word<strong>en</strong> gecodeerd <strong>en</strong> sam<strong>en</strong>gevat,<br />
waar mogelijk resulter<strong>en</strong>d in e<strong>en</strong> soort ROC-curve (de<br />
Summary Receiver Operating Characteristic, SROC-curve).<br />
105. Medisch onderbouwde analytische nauwkeurigheid voor HbA1c bepaling<br />
K. MIEDEMA, E. LENTERS, R. KEMNA <strong>en</strong> T. de HAAN<br />
Laboratorium Ziek<strong>en</strong>huis De Weez<strong>en</strong>land<strong>en</strong>, Zwolle<br />
HbA1c is algeme<strong>en</strong> geaccepteerd als de parameter ter controle<br />
van de glycemische instelling bij patiënt<strong>en</strong> met diabetes mellitus.<br />
De HbA1c bepaling di<strong>en</strong>t gemiddeld 2-4 maal per jaar bij<br />
elke diabetespati<strong>en</strong>t te word<strong>en</strong> uitgevoerd. Standaardisatie van<br />
deze bepaling was e<strong>en</strong> probleem, echter de introductie van<br />
SKZL-kalibrator<strong>en</strong> hebb<strong>en</strong> harmonisatie op de DCCT-getall<strong>en</strong><br />
mogelijk gemaakt, waardoor de klinische bruikbaarheid van<br />
de resultat<strong>en</strong> sterk is verbeterd.<br />
Echter, zowel e<strong>en</strong> te grote bias als e<strong>en</strong> te grote imprecisie kan<br />
dramatische invloed hebb<strong>en</strong> op de medische significantie van<br />
de resultat<strong>en</strong>. Met de publicatie van de DCCT-resultat<strong>en</strong> <strong>en</strong> de<br />
to<strong>en</strong>em<strong>en</strong>de internationale standaardisatie is e<strong>en</strong> zeer kleine<br />
analytische imprecisie nodig om de patiënt in het eig<strong>en</strong> laboratorium<br />
te volg<strong>en</strong>. Immers, de significantie van twee ope<strong>en</strong>volg<strong>en</strong>de<br />
HbA1c resultat<strong>en</strong> wordt in grote mate bepaald door<br />
de analytische imprecisie van de gebruikte bepaling.<br />
T<strong>en</strong>einde de klinische significantie te berek<strong>en</strong><strong>en</strong> zijn in e<strong>en</strong><br />
drietal populaties de individuele, <strong>bio</strong>logische VC’s berek<strong>en</strong>d<br />
van het HbA1c. De lange-termijn VC bij niet-diabet<strong>en</strong> (labpersoneel,<br />
8-10 jaar follow-up) was 3,0%, de mediumtermijn<br />
VC bij diabetespati<strong>en</strong>t<strong>en</strong> (stabiel ingesteld, gemiddeld HbA1c<br />
De correlatie <strong>en</strong> aanvull<strong>en</strong>de waarde van verschill<strong>en</strong>de test<strong>en</strong><br />
vormt e<strong>en</strong> onderwerp dat speciale aandacht vraagt.<br />
De ervaring die door de commissie SRLM hiermee opdoet, zal<br />
onder andere word<strong>en</strong> gebruikt in workshops. De Cochrane<br />
Collaboration accepteert nog ge<strong>en</strong> review van diagnostisch<br />
onderzoek in de Cochrane database, hoewel daar to<strong>en</strong>em<strong>en</strong>d<br />
vraag naar is.<br />
Sandberg S, Oosterhuis WP, Freedman D, Kawai F. Systematic reviewing<br />
in laboratory medicine. JIFCC 1997; 9: 154-5.<br />
8%, periode 1-3 jaar) is ook 3,0%, terwijl de korte-termijn VC<br />
(diabet<strong>en</strong> <strong>en</strong> niet-diabet<strong>en</strong>, 10-14 dag<strong>en</strong> follow-up) afhankelijk<br />
van het HbA1c nivo 2-3% bedraagt.<br />
Uitgaande van de stelregel dat de analytische VC kleiner moet<br />
zijn dan de helft van de individuele VC, di<strong>en</strong>t als doelstelling<br />
voor de analytische nauwkeurigheid van de HbA1c-bepaling<br />
e<strong>en</strong> VC van