2021 Wyoming Nursing Summit & Convention

2021 WYOMING NURSING SUMMIT & CONVENTION 

2021 annual report


TABLE OF CONTENTS 

WNA Annual Meeting Information and Reports 

Board of Directors ............................................................ 3 

Annual Meeting Agenda. ...................................................... 5 

Annual Meeting Rules. ........................................................ 7 

2020 Annual Meeting Minutes. ................................................. 13 

Strategic Plan. .............................................................. 23 

Legislative Agenda. .......................................................... 24 

Financial Summary. .......................................................... 25 

Balance Sheets. ............................................................. 27 

Approved Budget. ........................................................... 31 

President’s Report. ........................................................... 33 

Executive Director’s Report. .................................................... 34 

Membership Report. ......................................................... 36 

Lobbyist Report. ............................................................ 37 

Region Reports. ............................................................. 39 

2021 Leadership Elections. .................................................... 41 

Appendix 

WNA Bylaws ............................................................... 43 

Published for the Wyoming Nurses Association by: 

Arthur L. Davis Publishing Agency 

P.O. Box 216 | Cedar Falls, Iowa 50613 

(319) 277-2414 

1


3

PROFESSIONALS 

helping PROFESSIONALS 

You worked hard for your license and 

your career depends on it 

Licensing Trouble? Suspension? Seeking Reinstatement? 

We will aggressively fight for 

your livelihood 

wrnlawfirm.com 

Woodhouse Roden Nethercott, LLC 

Attorneys at Law 

(307) 432-9399 | 1912 Capitol Avenue Ste.500 | Cheyenne, WY 82001 

4


“The Membership Voice” 

WNA Annual Meeting 

Friday, October 29, 2021 

11:15 am – 12:30 pm 

I. Call to Order- Marianne Madariaga, President 

1. Roll Call of Board of Directors 

2. Roll Call Region Membership Representation 

3. Declaration of Quorum 

4. Review and Approval the Agenda 

5. Approval of September 25, 2020 meeting minutes 

II. 

III. 

IV. 

WNA Financial Road Map – Veronica Taylor, Treasurer 

President’s Update on WNA 2021 Strategic Initiatives – Marianne Madariaga, President 

WNA Operational Update – Tobi Lyon, Executive Director 

V. Membership Open Forum 

VI. 

VII. 

Recognition of Outgoing Board Members and Executive Director, Tobi Lyon – Marianne Madariaga, 

President 

Tellers Report – Kathryn Luzmoor, Nominations Chair 

VIII. Adjournment – Marianne Madariaga, President 

5

• Completely online 

• No out-of-state tuition 

• Finish in as little as 2 semesters 

• Part-time and full-time enrollment available 

• Admission available twice each fall, spring and summer semesters 

• DSU has low costs for the students 

• Ranked as the 12th most affordable and 16th best 

quality RN-BSN online program in the nation 

For more information and to apply, visit https://dxl.dixie.edu/rn-bsn/ 

Program questions, call 435.879.4519 or email dru.bottoms@dixie.edu 

It’s never too early to start 

planning for your first job 

as a professional nurse! 

Cheyenne Regional Medical Center has a 

comprehensive Nurse Residency Program that is 

designed to ease your transition from the world of 

academia to the professional nurse role. 

Nursing Students and Newly-graduated 

Registered Nurses are encouraged to inquire. 

Cheyenne Regional is an equal opportunity employer. 

LEARN MORE! 

(307) 996-4731 

lyndsey.smith@crmcwy.org 

cheyenneregional.org 

6

Rule 1: 

Rule 2: 

Rule 3: 

Rule 4: 

Rule 5: 

Rule 6: 

Rule 7: 

Rule 8: 

Rule 9: 


WNA ANNUAL MEETING 

Meeting Rules 

Registered members must wear their name badges during the business session. All membership 

in good standing may vote. 

In making a motion or speaking to a question, a delegate shall move to the floor microphone, 

address the Chair, await recognition of the Chair, and give the delegate’s name and region. 

The correct form to use in making a motion is “I move that...” 

All motions and amendments should be written and signed by the maker of the motion or 

amendment and then given to the Chair. 

A member may not speak against her/his own motion, but may vote against it. 

No member shall speak more than once, or longer than three minutes, on the same question 

until all have spoken who wish to express and opinion. 

All reports and supplements to reports shall be written and shall not be read. 

Only currently paid members of the Association are entitled to vote in elections. 

The Association staff shall report the number of members registered after the opening 

ceremonies. Supplementary reports may be given later as the Chair may direct. 

Rule 10: A member should raise her/his hand to indicate she/he cannot hear. 

Rule 11: The member will act only on the resolves of a resolution. Questions of clarification will be 

handled according to parliamentary procedure. 

Rule 12: All sessions of the Annual Business Meeting shall be open to the public unless the Chair 

declares an executive question. 

Parliamentary Information 

Robert’s Rules of Order, Newly Revised is the parliamentary authority that shall govern WNA Business 

Meeting. The chair, as the presiding officer, rules on all matters relative to parliamentary law and 

procedures. The Parliamentarian serves only in an advisory capacity to the presiding officer and 

members. 

Member participation in the business session is governed by the standing rules. 

The motions that follow are defined in terms of action a delegate may desire to propose. Rules 

governing these motions are listed in Table 1. 

A main motion introduces a subject to the Business Meeting for consideration and is stated: “I move 

that....” 

An amendment (primary) is a motion to modify the working of a motion. The motion to amend may be 

made in one of the following forms, determined by the action desired: “I move to amend by....” 

• striking (word(s), phrase, paragraph).” 

• inserting (word(s), phrase, paragraph).” 

7

EEAAALTT 

PC IIAAATTRIIC CAAAREE 

PAAATTIIEENNNTT-CEENNNTTEEREE 

MAAANNNLOVEE BRAAAIINNN + BO 

Ouuuuuuurrrrrrrr gggggooooooooaaaaaaaallllllll aaaaaaaatttttttt Maaaaaaaannnnnnnnlllllllloooooooovvvvvveeeeeeee rrrrrrrraaaaaaaaiiiiiiiinnnnnnnn + oooooooodddddyyyy 

eeeeeeeeaaaaaaaalllllllltttttttthhhhhhhh iiiiiiiissssssss ttttttttoooooooo pppppppaaaaaaaarrrrrrrrttttttttnnnnnnnneeeeeeeerrrrrrrr wwiiiiiiiitttttttthhhhhhhh ooooooootttttttthhhhhhhheeeeeeeerrrrrrrr 

hhhhhhhheeeeeeeeaaaaaaaalllllllltttttttthhhhhhhhccccccccaaaaaaaarrrrrrrreeeeeeee ppppppprrrrrrrroooooooovvvvvviiiiiiiidddddeeeeeeeerrrrrrrrssssssss ttttttttoooooooo dddddeeeeeeeelllllllliiiiiiiivvvvvveeeeeeeerrrrrrrr eeeeeeeeffffffffffiiiiiiiicccccccciiiiiiiieeeeeeeennnnnnnntttttttt,, hhhhhhhhiiiiiiiiggggghhhhhhhh--quuuuuuuaaaaaaaalllllllliiiiiiiittttttttyyyy pppppppssssssssyyyycccccccchhhhhhhhiiiiiiiiaaaaaaaattttttttrrrrrrrriiiiiiiicccccccc ccccccccaaaaaaaarrrrrrrreeeeeeee. 

TThhhhhhhhrrrrrrrroooooooouuuuuuuggggghhhhhhhh ccccccccuuuuuuuttttttttttttttttiiiiiiiinnnnnnnnggggg--eeeeeeeedddddgggggeeeeeeee ttttttttrrrrrrrreeeeeeeeaaaaaaaattttttttmmmmmmmeeeeeeeennnnnnnnttttttttssssssss iiiiiiiinnnnnnnncccccccclllllllluuuuuuudddddiiiiiiiinnnnnnnnggggg keeeeeeeettttttttaaaaaaaammmmmmmiiiiiiiinnnnnnnneeeeeeee,, eeeeeeeesssssssskeeeeeeeettttttttaaaaaaaammmmmmmiiiiiiiinnnnnnnneeeeeeee 

(SSppppppprrrrrrrraaaaaaaavvvvvvaaaaaaaattttttttoooooooo)),, aaaaaaaannnnnnnnddddd TTrrrrrrrraaaaaaaannnnnnnnssssssssccccccccrrrrrrrraaaaaaaannnnnnnniiiiiiiiaaaaaaaallllllll Maaaaaaaagggggnnnnnnnneeeeeeeettttttttiiiiiiiicccccccc SSttttttttiiiiiiiimmmmmmmuuuuuuullllllllaaaaaaaattttttttiiiiiiiioooooooonnnnnnnn (rrrrrrrrTTMSS)) -- ccccccccoooooooovvvvvveeeeeeeerrrrrrrreeeeeeeeddddd bbyyyy 

mmmmmmmoooooooosssssssstttttttt iiiiiiiinnnnnnnnssssssssuuuuuuurrrrrrrraaaaaaaannnnnnnncccccccceeeeeeee ppppppprrrrrrrroooooooovvvvvviiiiiiiidddddeeeeeeeerrrrrrrrssssssss -- wweeeeeeee ccccccccaaaaaaaannnnnnnn ppppppprrrrrrrroooooooovvvvvviiiiiiiidddddeeeeeeee nnnnnnnneeeeeeeeww hhhhhhhhoooooooopppppppeeeeeeee fffffoooooooorrrrrrrr yyyyoooooooouuuuuuurrrrrrrr pppppppaaaaaaaattttttttiiiiiiiieeeeeeeennnnnnnnttttttttssssssss . 

Ouuuuuuurrrrrrrr tttttttteeeeeeeeaaaaaaaammmmmmm fffffooooooooccccccccuuuuuuusssssssseeeeeeeessssssss oooooooonnnnnnnn ttttttttrrrrrrrreeeeeeeeaaaaaaaattttttttiiiiiiiinnnnnnnnggggg tttttttthhhhhhhheeeeeeee wwhhhhhhhhoooooooolllllllleeeeeeee bboooooooodddddyyyy ttttttttoooooooo iiiiiiiimmmmmmmppppppprrrrrrrroooooooovvvvvveeeeeeee oooooooovvvvvveeeeeeeerrrrrrrraaaaaaaallllllllllllllll bbrrrrrrrraaaaaaaaiiiiiiiinnnnnnnn hhhhhhhheeeeeeeeaaaaaaaalllllllltttttttthhhhhhhh wwiiiiiiiitttttttthhhhhhhh tttttttthhhhhhhheeeeeeee uuuuuuusssssssseeeeeeee oooooooofffff lllllllliiiiiiiifffffeeeeeeeessssssssttttttttyyyylllllllleeeeeeee 

cccccccchhhhhhhhaaaaaaaannnnnnnngggggeeeeeeeessssssss,, ssssssssuuuuuuupppppppppppppplllllllleeeeeeeemmmmmmmeeeeeeeennnnnnnnttttttttssssssss,, aaaaaaaannnnnnnnddddd ppppppprrrrrrrreeeeeeeessssssssccccccccrrrrrrrriiiiiiiipppppppttttttttiiiiiiiioooooooonnnnnnnn mmmmmmmeeeeeeeedddddiiiiiiiiccccccccaaaaaaaattttttttiiiiiiiioooooooonnnnnnnnssssssss wwhhhhhhhheeeeeeeennnnnnnn nnnnnnnneeeeeeeeeeeeeeeedddddeeeeeeeeddddd . eeeeeeee eeeeeeee3ppppppplllllllloooooooorrrrrrrreeeeeeee gggggeeeeeeeennnnnnnneeeeeeeettttttttiiiiiiiicccccccc fffffaaaaaaaaccccccccttttttttoooooooorrrrrrrrssssssss wwhhhhhhhhiiiiiiiicccccccchhhhhhhh 

mmmmmmmaaaaaaaayyyy ccccccccaaaaaaaauuuuuuusssssssseeeeeeee bbrrrrrrrraaaaaaaaiiiiiiiinnnnnnnn dddddiiiiiiiisssssssseeeeeeeeaaaaaaaasssssssseeeeeeeessssssss aaaaaaaannnnnnnnddddd wwoooooooorrrrrrrrk wwiiiiiiiitttttttthhhhhhhh pppppppaaaaaaaattttttttiiiiiiiieeeeeeeennnnnnnnttttttttssssssss oooooooonnnnnnnn ppppppprrrrrrrreeeeeeeevvvvvveeeeeeeennnnnnnnttttttttiiiiiiiioooooooonnnnnnnn aaaaaaaannnnnnnnddddd ttttttttrrrrrrrreeeeeeeeaaaaaaaattttttttmmmmmmmeeeeeeeennnnnnnntttttttt pppppppllllllllaaaaaaaannnnnnnnssssssss tttttttthhhhhhhhrrrrrrrroooooooouuuuuuuggggghhhhhhhh TTeeeeeeeelllllllleeeeeeeehhhhhhhheeeeeeeeaaaaaaaalllllllltttttttthhhhhhhh 

oooooooorrrrrrrr iiiiiiiinnnnnnnn--pppppppeeeeeeeerrrrrrrrssssssssoooooooonnnnnnnn aaaaaaaappppppppppppppooooooooiiiiiiiinnnnnnnnttttttttmmmmmmmeeeeeeeennnnnnnnttttttttssssssss. 

Coooonnnnttttttaaaacctttttt uuss ttttttoooo leeeeeaaaarrnnnn hooooww wweeeee ccaaaannnn meeeeeeeeeetttttt yoooouurr paaaattttttieeeeennnnttttttss ' pssycchiaaaattttttrricc nnnneeeeeeeeeess . 

mmmmmmmaaaaaaaannnnnnnnlllllllloooooooovvvvvveeeeeeeehhhhhhhheeeeeeeeaaaaaaaalllllllltttttttthhhhhhhh.ccccccccoooooooommmmmmm (600005)) 3488--88000000000000 ooooooooffffffffffiiiiiiiicccccccceeeeeeee@mmmmmmmaaaaaaaannnnnnnnlllllllloooooooovvvvvveeeeeeeegggggrrrrrrrroooooooouuuuuuuppppppp.ccccccccoooooooommmmmmm


• adding (word(s), phrase, or paragraph at the end of the motion).” 

• substituting (paragraph or entire text of a resolution or main motion and inserting another that is 

germane). 

An amendment to an amendment is a motion to modify the wording of the proposed amendment 

and is made as follows: “I move to amend the amendment by....” The same forms for making an 

amendment are applicable for making a secondary amendment. 

The motion to commit or refer is generally used to send a pending motion (also called “the question”) 

to a small group of selected persons - a committee, board, or cabinet, for example - so that the question 

may be studied and put in better condition for the assembly to consider. The motion is stated: “I move 

to commit the question to..........for further study.” 

The motion to close a debate (previous question), if seconded and approved by a two-thirds vote, stops 

discussion on the pending question and is stated: “I move the previous question.” 

A division of the assembly may be called by any member if the chair’s decision on a voice vote is in 

question. The member proceeds to the microphone and states: “I call for a division of the house.” 

The chair then takes a standing or roll call vote. 

A division of the question may be called when a pending motion relates to a single subject but contains 

several parts, each capable of standing as a complete proposition. The parts can be separated, and 

each considered and voted on as a distinct question. The motion is stated: “I move to divide the 

question........as follows....” 

The motion to reconsider enables a majority of the assembly to bring back for further consideration a 

motion that has already been voted. The purpose of reconsidering a vote is to permit correction of hasty, 

ill-advised, or erroneous action, or to consider added information or a situation that has changed since 

the vote was taken. (Note exception on the Table -Rules Governing Motions) 

Parliamentary inquiry is a question directed to the presiding officer to obtain information on 

parliamentary law or the rules of the organization as relevant to the business at hand. A member 

addresses the chair and states: “I rise to a (point) of parliamentary inquiry.” 

Point of information is a request, directed to the chair or through the chair to another officer or 

member for information relevant to the business at hand. The request is not related to parliamentary 

procedure. The member addresses the chair and states: “I rise to a point of information.” 

The motion to appeal the decision of the chair is made at the time the chair makes a ruling. If it is 

made by a member and seconded by another member, the question is taken from the chair and vested 

in the voting body for a WNA decision. The motion is stated: “I move to appeal the decision of the 

chair.” 

Before a member can make a motion or address the assembly on any question, it is necessary that he or 

she obtain the floor through recognition by the presiding officer. The member must: 

9

UUWWYYOO.EEEDUU/HHEEEALTHHIEEERWWYYOO 

Come make a difference and 

Join our Family. 

We are hiring! 

RNs, Med Aides 

and CNAs 

Contact our HR Director 

for more information: 

hrdirector@northfieldvilla.com 

Please apply at 

workforcenow.adp.com 

10


• rise and proceed to the microphone. 

• address the chair by saying, “Madam Chair” 

• await recognition 

• give name and region 

• state immediately the reason for rising 

Rules Governing Motions 

Interrupt 

Speaker 

Recognized 

by Chair 

Requires a 

Second 

Debated 

Vote 

Main motion NO YES YES YES Majority 

Amendment NO YES YES YES Majority 

Amendment to amendment NO YES YES YES Majority 

Limit Debate NO YES YES NO Two-thirds 

Close debate (previous quest.) NO YES YES NO Two-thirds 

Divide the Question NO YES YES NO Majority 

Reconsider NO YES YES YES Majority* 

Point of parliamentary inquiry YES NO NO NO Chair Decides 

Point of Information YES NO NO NO Chair Decides 

*Majority vote except when the motion being reconsidered required a two-thirds vote for its passage; then the 

motion to reconsider requires a two-thirds vote. 

11

Visit 

NursingALD.com today! 

NOW HIRING 

For questions about careers with 

Ivinson, please contact us at 

recruitment@ivinsonhospital.org 

health elevated. 

Search job listings 

in all 50 states, and filter by location 

and credentials. 

Browse our online database 

of articles and content. 

Find events 

for nursing professionals in your area. 

Your always-on resource for nursing 

jobs, research, and events. 

12

WNA Annual Meeting 


WNA ANNUAL MEETING MINUTES 

September 25, 2020 

Noon – 1:00 pm 

Held via Zoom 

September 25, 2020 

Noon – 1:00 pm 

Held via Zoom 

12:00 Call to Order 

President Luzmoor called the meeting to 

order at 12:00 PM 

Notes: 

Housekeeping guidance related to interacting 

and voting during the virtual meeting 

Kathy Luzmoor 

President 

Roll Call: 

Kathy Luzmoor 

Present: 

President: Kathy Luzmoor 

President Elect: Marianne Madariaga 

Vice President: David Bodily 

Treasurer: Suzey Delger 

Immediate Past President: Dee Gilson 

Northwest Region: Linette Johnson 

Northeast Region: Lacey Johnson 

Southwest Region: Carla Lee 

Southeast: Shawn Wyse 

Central Region: Aubrey Bremer 

Wyoming Center Liaison: Mary Behrens 

Executive Director: Tobi Lyon 

EXCUSED: Secretary: Ann Marie Clevenger 

Region Count 

Northwest - 3 

Northeast - 7 

Southwest - 7 

13

Executive Director: Tobi Lyon 

EXCUSED: 2021 WYOMING Secretary: NURSING SUMMIT Ann Marie & CONVENTION Clevenger 

Region Count 

Northwest - 3 

Northeast - 7 

Southwest - 7 

Southeast - 3 

Central - 6 

Quorum Declared 

October 3, 2019 Annual Meeting Minutes 

(pages 11-14 of the annual book.) 

Kathy Luzmoor, 

President 

Additions to the agenda: 

None 

Approval of the agenda: 

Move to approve the agenda: Suzy Delger 

Seconded by Marianne Madariaga 

Agenda approved 

14


12:10 WNA Financial Report 

Suzey Delger 

August Financial Statements – Pages 17-22 

of the annual book. 

Discussion: 

Delger discussed the July 1, 2019 – June 30, 

2020 financial summary. 

• Operating Revenues: 

o 

o 

o 

Membership Dues: With our growth 

in membership, we ended the fiscal 

year being ahead of budget by 

$10,804.70 

Convention: The 2019 convention 

had a net profit of $13,800.83 

Nurses Day at the Legislature: the 

2020 NDL had a net profit of 

$2281.35 2019 had a net loss of 

$11.28, and 2018 had a net profit of 

$3281.10 

• Operating Expenses: see page 17 annual 

book 

o 

Highlight – Bank and Credit Card 

Fees were not budgeted or 

anticipated. This was due to the 

need to move to a new credit card 

processor in order to increase 

security. 

• Net Profit: 

o 

2019/2021- $10,837.00. WNA 

projected to have a net loss of $270 

Approval of Financial Statement: 

Motion to approve- Carla Lee 

Seconded by Sue Howard 

Discussion: None 

Financial Statement approved 

15


12:15 WNA Presidents Update WNA Strategic 

Plan 

Luzmooor provided an update and progress 

on the WNA Strategic Plan overview from 

November to date. (page 15 of the annual 

book): 

• Current strategic plan will continue 

• Policy 

o WNA pushed out information via 

social media and newsletters 

asking nurses to reach out to 

legislators regarding concerns such 

as lack of PPE for healthcare 

providers during the pandemic. 

o On a national level, ANA had 

$342,000 emails going to legislators 

advocating. 

• Healthy Nurse 

o ANA/WNA resources related to 

education and support around 

stress reduction and health 

• WNA/NGAGE offered Networks of support 

sessions as an opportunity to support 

nurses during the pandemic. So far 4 

sessions have been offered with more 

scheduled. To date, the recent school 

nurses’ session had the highest turnout 

with 13 participants. The next session will 

be will be with long term care nurses 

• Membership cultivation 

Luzmoor 

o Membership has increased by 20% 

over the last 2 years with a current 

membership of over 500. 

16


12:20 WNA Operational and Membership Highlights 

Tobi Lyon 

Tobi Lyon shared a PPT presentation 

highlighting an overview of NGAGE, which is 

an association management company. The 

NGAGE team has grown from a team of 2 to 

over 20. NGAGE’s growth has allowed for 

increased services and supports for WNA. 

Highlights over the last year – 

• Legislative Days: Governor and over 

400 attendees. Tobi shared 

remembrances of how this event has 

grown and how this growth reflects 

efforts of WNA membership and 

NGAGE staff. 

• Celebrating Nurses Month & Year of 

the Nurse- several events: 

o During ANA Membership 

Assembly, NGAGE showcased 

highlights of initiatives that 

support WNA 

o Thank you nurses billboards 

o Weekly WNA member nurse 

spotlights 

o Special nurse buff gift delivery 

to current WNA members and 

new members since April 

o Inspirational quotes and social 

media posts 

o Social media tagging 

#YEAROFTHENURSE 

o Governor Gordon issued 

17


12:30 2020 Bylaw Amendments (page 41-42 in the 

annual book) 

Luzmoor 

President Luzmoor presented the proposed 

Bylaw amendments related to membership 

categories. That change has resulted in a 

need to “clean up” the language describing a 

nurse. 

Amendment #1 – To allow retired nurses to 

maintain their membership and keep in 

alignment with the changes that the Wyoming 

State Board of Nursing adopted in the 

licensing of an active nurse. 

Discussion: 

• Faith Jones – asked for a clarification 

that retired nurses can join – yes. 

Luzmoor reviewed the membership 

guidelines. 

Motion to approve the bylaw amendments 

– A. Le Pard 

Seconded – S. Delger 

Amendments approved 

18


12:40 Membership Comment and Open Forum 

Veronica Taylor – topic of WNLI (WY Nursing 

Leadership Institute). Veronica was contacted 

by a past participant of WNLI asking for help 

with her graduate project. The student would 

like to revisit and revise WNLI. They have 

formed a small advisory board, which has met 

3 times. They hope to start in Jan or Feb. 

They plan on 2 face-face sessions and 2 

virtual sessions per month. They hope that 

WNA will support the effort and possibly assist 

with getting information out. 

Luzmoor 

President 

Toni Decklever (lobbyist) – Reminded 

membership about legislative topics. The 

legislative session will be a longer session 

this year. At this point it is not known if the 

session will be in person or virtual. 

Legislator Days- Nurses at the Legislator in 

January will be virtual due to COVID-19 

impacts. More information will be coming. 

Our WNA Legislative committee will develop 

our legislative agenda. The WNA wesite had 

legislative updates. Reach out to Toni if you 

have questions regarding legislation. VOTE! 

Faith Jones – ANA PAC has a good site on 

ANA, Nurses Vote. ANA no longer endorses 

candidates but is focused on getting nurses 

out to vote. Multiple resources available to 

encourage voting. Nursesvote.org 

19


12:45 Recognition of Outgoing Board Member 

President Luzmoor thanked outgoing board 

members for their service. Plaques have been 

ordered and will be shipped to individuals. 

Suzey Delger 

Treasurer 

2018-2020 

Luzmoor 

President 

Dee Gilson 

Immediate Past President 

2016-2018 

20


12:48 Tellers Report – Dee Gilson, Nominations 

Chair 

Luzmoor encouraged all members to reach 

out to members across the State to step up to 

serve. 

Central Region – no candidates completed 

the Consent to Serve for either Vice-President 

or Secretary. There was a write in candidate 

for each position. The Officers for the Central 

region will contact the write-in candidates to 

see if they would be interested in serving. The 

Region officers do have the authority to 

appoint the candidates if they are interested in 

serving. 

Southeast Region – No candidates completed 

the Consent to Serve for either the Vice- 

President or Secretary. Five write-in 

candidates were received for Vice-President 

and for Secretary with 1 vote apiece for each 

office. SE Officers will contact each write-in 

candidate regarding their interest to service. If 

interested a special election will be 

conducted. 

SW Region Vice President – Heidi Frandsen 

SW Region Secretary – Patty O’Lexy 

NE Region Vice – President – Tommi 

Ritterbusch 

NE Secretary – 3 Write -in candidates. The 

NE Officers will contact each write-in 

candidate to see if they are interested in 

serving. A special election will be scheduled. 

NW Region Vice President – Paula Kihn 

NW Region Secretary – Tina King 

21 

WNA Board President elect -Lacey Johnson


12:52 Kathy Luzmoor will pass the gavel to 

incoming president Marianne Madariaga 

Dee Gilson 

Nominations Chair 

12:55 Announcements and Adjournment 

President Madariaga opened the floor for 

announcements- None 

President Madariaga adjourned the meeting 

22


STRATEGIC 

PLAN 2021 

Mission: To promote the profession of nursing, provide a 

unified voice for nurses, and advocate for a healthier Wyoming. 

Vision: Wyoming Nurses Association will collaboratively lead to advance nursing practice through 

the distribution of resources, influence and advocacy for the promotion of healthcare in Wyoming. 

POLICY HEALTHY NURSE MEMBERSHIP CULTIVATION PROFESSION OF NURSING 

Goal: 

We serve as the voice of 

nursing on important issues 

and policies that impact 

the nursing community. 

We are at the table with 

local, state, and federal 

officials advocating for the 

profession. 

Goal: 

We will continue to lead efforts 

that foster a safe, ethical 

environment that supports the 

health and wellness of nurses in 

all settings. 

Goal: 

Grow, develop and diversify 

membership. 

Goal: 

Advance the nursing 

profession to be a leader 

in WY healthcare. 

#1 Strategy: Legislative 

Committee to meet on a 

regular basis during entire 

year. 

#2 Strategy: Legislative 

Committee to develop a 

process for creating, updating, 

and reviewing our legislative 

agenda. Present at annual 

Nurses Day at the Legislature 

Conference. 

#3 Strategy: Lead in 

legislation and health policy 

by recommending positions 

on current legislative issues 

to the Board while keeping 

members informed on 

legislative affairs. 

#1 Strategy: Promote a work 

environment that encourages 

a healthy and safe workplace 

through educational 

opportunities. 

#2 Strategy: Identify and 

promote strategies to 

support nurses’ mental health 

including continue to offer 

the WNA networks of support 

program into 2021. Access at 

mid-year point. 

#3 Strategy: Promote 

wellness programs within the 

community. 

#1 Strategy: Create a 

Membership Engagement 

and Development Committee 

that is chaired by the Vice 

President. 

#2 Strategy: Committee will 

consist of region leadership 

and will meet on a quarterly 

basis to address the following 

• Membership Retention 

• Diversify WNA’s 

demographics 

• Outreach to newer nurses 

• Increase Membership 

Numbers 

• Member Engagement 

• Expand Member Benefits 

#1 Strategy: WNA and regions 

will continue to promote public 

health needs through 2021. 

#2 Strategy: WNA and regions 

will work with community 

partners to share opportunities 

to promote nursing with WNA 

membership. 

#3 Strategy: WNA to include 

ANA staff in an event in 2021 

or 2022 to focus on nurses as 

healthcare leaders. 

#4 Strategy: Promote the 

influence of the professional 

nurse. 

23


Legislative Agenda 

Nursing practice and healthcare topics are discussed at the state and national levels. Membership in the Wyoming 

Nurses Association gives nurses a voice in places where important decisions are made. The WNA Board of Directors 

and lobbyist use the agenda statements for reference when promoting the WNA position. 

Access /Affordability 

• Improved access for early detection and prevention 

• Promote a health care system which includes patient accountability and 

utilization of efficient care models 

• Health promotion coverage (physical and mental health, dental, vision, etc.) 

for healthy and chronically ill adults and children to improve quality of life 

and reduce high end treatment costs 

• Expansion of wellness benefits from private insurance and work places 

• Coverage for those who fall between being able to afford private health 

insurance and qualify for Medicaid, Medicare – i.e. “gap insurance” 

• Healthcare billing transparency (hospitals, physicians, residential care etc.) 

Professional Practice 

• All Registered Nurses should have the ability to practice to the full extent of 

their education and preparation 

• Bachelor’s preparation after graduation from ADN program 

• Support the utilization of Advanced Practice Nurses as primary care 

providers 

• Monitor proposed changes to WY Nurse Practice Act and 

Rules and Regulations 

• Promote safe workplaces for nurses and other health care workers 

Current Health Care Issues 

• Monitor health care issues and promote nursing roles in potential solutions 

• Support legislation that protects the public 

24


FINANCIAL/BUDGET 

Fiscal Year July 1, 2020, through June 30, 2021 

Written Financial Summary 

Operating Revenues: 

Membership Dues: With our membership growth, WNA ended the fiscal year ahead of budget by 

$2,723.24. The association budgeted to average $3,833.33 in monthly membership revenue, and WNA 

averaged $4,072.77 

Convention: The 2020 virtual convention had a net profit of $3,580.01. The 2019 convention which 

was in person had a net profit of $13,800.83 

Nurses Day at the Legislature (NDL): The 2021 virtual NDL had a net profit of $6,818.19 and had 

only budgeted to make a profit of $3,800. The 2020 NDL had a net profit of $2,281.35. 2019 had a net 

loss of $11.28, and 2018 had a net profit of $3,286.10. 

Print Publications: WNA profited an additional $1,000 more than budgeted due to moving to a digital 

format. 

Personal Benefits Program: ANA’s royalties have increased significantly related to this program, 

resulting in $850.00 of unplanned revenue. In the past two fiscal years, WNA received less than $100 

each year. Thus, we removed the line item from the budget. 

Online Education: We did not budget for this but did a joint webinar with other ANA states that 

featured a 50/50 split with Bonnie Clipper, and the association netted a profit of $238.50. 

Operating Expenses: 

We ended the fiscal year over budget in the following areas. 

Postage: Over budget by $441.46 due to mailing membership recognition materials to award nominees 

and rising shipping costs related to additional membership outreach. 

Printing and Copying: Over budget by $204.53 as part of the same recognition campaign, and we 

needed additional WNA logoed envelopes. 

Publications and Dues: Over budget by $138.50 due to buying additional mailing lists for our 

publications, resulting in additional revenue. 

25


Donations: WNA gave $500 to the Wyoming Center planned for in the 2019/2020 budget, but WCN 

did not request it until the 2020/2021 fiscal year. 

Miscellaneous Expense: The expense in this line item contains the costs associated with promoting 

RNConnect. WNA will receive a $5,000 grant from the American Nurses Foundation by being selected to 

participate in the program. WNA will not receive the $5,000 until October 2021, so it won’t be recorded 

in this fiscal year. 

Travel and Meetings: Under budget overall by $3,610.07 due to no travel in 2021 because of the 

pandemic. 

Net Profit: 

We ended the 2020/2021 year with a net profit of $13,219.53. WNA had projected to have a net profit 

of $1,506.00 for the fiscal year. 

Financial History 

In 2011/2012, a net profit of $6,000. 

In 2012/2013, a net profit of $6,000. 

In 2013/2014, a net profit of $8,784 

In 2014/2015, a net loss of $1,139 


In 2016/2017, a net loss of $6,307 


In 2018/2019, a net loss of $3,340 


26


1:29 PM Wyoming Nurses Association 

07/14/21 Balance Sheet 

Accrual Basis As of June 30, 2021 

Jun 30, 21 

ASSETS 

Current Assets 

Checking/Savings 

Mainstay Investments 77,565.73 

US Bank Checking 41,185.85 

US Bank Continuing Education 1,598.85 

US Bank Education Loan Fund 2,671.27 

Total Checking/Savings 123,021.70 

Total Current Assets 123,021.70 

TOTAL ASSETS 123,021.70 

LIABILITIES & EQUITY 

Equity 

Opening Balance Equity 111,116.43 

Retained Earnings -19,929.39 

Net Income 31,834.66 

Total Equity 123,021.70 

TOTAL LIABILITIES & EQUITY 123,021.70 

2:05 PM 

06/08/21 

Accrual Basis 

Wyoming Nurses Association 

Region Balance Sheet 

As of May 31, 2021 

May 31, 21 

REGION ASSETS 

Current Region Assets 

Region Accounts 

Central 6,465.63 

Northeast 11,315.23 

Northwest 2,176.69 

Southeast 13,538.73 

Southwest 3,136.48 

Total Region Account Balance 36,632.76 

Total Current Region Assets 36,632.76 

TOTAL REGION ASSETS 36,632.76 

27


28


29


30


31


32


PRESIDENT’S REPORT 

Welcome to the Annual Convention and Summit! We are finally gathered together 

again in Casper after a long hiatus from face to face contact. Wyoming Nurses 

Association quickly and flawlessly kept up with the momentum of our trying times 

through Covid-19. 

Marianne Madariaga, 

MSN, RN 

Ngage responded to our needs by developing monthly support groups online. 

Although they we attended in small numbers, they were profoundly important to 

those in attendance. We were able to share our deepest concerns and get a feel for 

what was going around us in the state. Many people were busy truly working the 

“trenches” and our thoughts and prayers were with them each step of the way. 

The solidarity was and still is what makes us a unique organization. It is comforting 

to know we have each other’s backs, then and now. 

We have seen spikes and dips in our membership over the past year. This has been a nationwide trend. 

As one friend pointed out, even though the nurse in the family was still earning an income, many 

spouses suffered loss of income throughout the pandemic. It has taken many months for households 

to recover the loss and for some, business altogether was lost. We celebrate and acknowledge the 

numerous sacrifices that have been made as we faced this crisis together. Words of gratitude are not 

enough to express our deepest apperception for the dedication to humanity and the care of others. 

What would the world be without nurses! 

It is with great sadness that Tobi Lyon Moore will be leaving us as Executive Director this fall. She has 

built our organization through blood, sweat, and tears (and a few voo-doo dolls) for over twenty years. 

We would not be where we are today if it were not for her. Please take time to express your gratitude to 

her. Ngage will continue to be our management corporation, with the professional and knowledgeable 

lead of Andrea Starmer. Please welcome her with open arms and we know she has the strength and 

fortitude to bring us forward. 

I would like to thank the Executive Board for their hard work over the past year. They have proven their 

tenacity and leadership beyond measures. I would also like to thank the Region Board members for your 

dedication. Your backbone has proven to be invaluable to our organization. May we all continue to lead 

with foresight, enthusiasm, belief, and responsibility. 

33


EXECUTIVE DIRECTOR’S REPORT 

Tobi Lyon, 

MBA, CAE 

“Legacy is not leaving something for people. It’s leaving something in people.” 

– Peter Strople 

Whether I am reflecting on the last year or the last 18 years, it is not myself I am 

thinking of as I step down from WNA’s Executive Director position… but each of 

YOU. I’m confident that WNA is poised for this transition, and my time has come 

to hand the reins over to a new leader. The legacy that WNA has created for me 

makes saying goodbye so surreally bittersweet. I could not have predicted the 

circumstances that have unfolded and the subsequent burnout and nurse staffing 

shortages, nor am I surprised by the resiliency and sacrifice our nurses have made 

to combat a global and unrelenting pandemic. 

Something incredible that has always been true, but specifically in 2021, is the 

solidarity of WNA. When I started in December of 2003, we were operating with a revenue of $33,276, 

the reserve savings account had $48,670, and the membership was at 226. Thanks to the board’s 

strategic vision and thought leadership, today, WNA’s operating revenue is more than four times that 

amount, and our total membership is 441. Though we have seen some fluctuation, together, we have 

grown WNA’s membership by 195%. We accomplished a 405% increase in the operating revenue and 

have increased our reserves by 278%, with WNA having over $135,000 in savings. In a time when our 

nurses and their families face the loss of loved ones, patients, and income, this is again an unsurprising 

but genuinely remarkable feat. I feel it speaks to the dedication that the Wyoming nurses have for 

the vital role WNA plays in the voice of nursing. Thank you to each of YOU for the role and impact in 

getting WNA to this milestone. I know by me handing WNA over, and it will grow even more under the 

direction of a new Executive Director. 

In addition to retaining and growing membership, our primary initiative has been advocating for and 

supporting our nurses. In our 2021 Strategic Plan, we cited goals around policy, diversity, leadership 

in the profession, and the prioritization of the health and wellness of nurses. While the legislative 

committee pushed our strategic agenda, and as we cultivated membership and promoted public health 

needs at the regional level: perhaps the most crucial focus we had was on the mental health and 

wellbeing of our nurses. Certain that our affirmations could only do so much, WNA used the nationwide 

focus on nursing to tell your stories and promote your plight – both through messaging and in the 

media. 

Everyone knows the hardship the pandemic has placed on our country’s nurses. What many don’t know 

is how deep that hardship has hit. A survey conducted by the American Nurses Foundation (available on 

the ANA website) reported that 40% of nurses indicated they have considered leaving their employer, 

citing that work affects their health and wellbeing, staffing issues, stressful work environment, and 

concerns about keeping their own family safe. 

34


The study also reported that of the nurses surveyed, 51% reported being exhausted, 43% reported 

being overwhelmed, 23% were depressed, 22% were angry, and a mere 21% were optimistic about 

the future. While these results are devastating to actualize, the statistics on how nurses handle the 

pandemic’s stress and strain are even more impactful. Only 24% reported having sought professional 

mental health support, and of the nurses that did not, 52% said they hadn’t needed mental health 

support, 36% believe they should be able to manage it themselves, and 30% cite a lack of time. 

Apart from the impactful statistics in the survey, one of the biggest takeaways for me was that some 

nurses reported not knowing where to access support or indicating that they felt Employee Assistance 

Programs were not readily available to them. Because nursing support programs exist, WNA is working 

to identify and implement new ways to communicate this information immediately. We joined with 

ANF and the Arizona Nurses Association to provide resources to nurses as part of the RNConnect 

Program. This program was a texting service that provided valuable reminders and resources to nurses 

to help build resilience and find added strength. We continue to look for accessible ways to support the 

wellbeing of nurses so that they know they do not stand alone. 

Sadly, seeking out and accepting mental health support is not always easy for nurses. Some are 

concerned that if they did seek professional mental health support, they could potentially face licensure 

issues, retribution by the employer, and stigma from co-workers. These roadblocks to mental healthcare 

must be removed, and WNA has shifted its prioritization to this. 

Combine the nursing shortage with the pandemic-weary workforce, and you’ve got a critical industry 

facing a distressing crisis. It is more important than ever that nurses lean on each other and the 

institutions which serve them. I am confident that with ANA and WNA programming, faith in each 

other, the prioritization of self-care, and vaccine efficacy, yours will ultimately be a legacy of endurance 

and fortitude, and I am committed to serving and supporting you differently. I could not be surer of my 

predecessor, and I think the solidarity we have secured will evolve WNA. 

A sincere THANK YOU to every board president and member that I worked with around the board 

table. You have played a critical role in developing my servant leadership skills and boarding my 

perspective. I owe a great deal of my success to your expertise and gusto. I mirrored the passion 

you have for nursing in my career as an association executive. And to each of WNA’s members who 

have realized the vision of our organization: may your dedication to us and the communities you 

serve to continue to serve you in return. Together, we will outlast this pandemic. Thank you for the 

opportunity to serve WNA – it has been an honor, and YOU have created a legacy in my life. 

35


MEMBERSHIP REPORT 

36


2021 LEGISLATIVE REPORT 

Toni Decklever, 

MA, RN - Lobbyist 

January 12th marked the first day of the 2021 General session for the Wyoming State 

Legislature. A total of 421 bills were filed with the Legislative Service Office. 264 were 

House Bills and 157 were Senate Files. There were also 20 resolutions filed. 

The following are bills that WNA followed that became law. 

Local Health Officer – Education requirements – This amended current statue 

to read: Any full-time or part-time health officer shall have a degree of doctor of 

medicine or be an advanced practice registered nurse. This position shall assist the 

state department of health in carrying out the provisions of all health and sanitary 

laws and regulation of the state. 

Public Health Amendments – This amends how certain public health orders 

may be issued. The act applies to each public health order that restricts individuals’ movements or their 

ability to engage in an activity, that applies to individuals not under an isolation or quarantine order, 

and that is designed to prevent or limit the transmission of a contagious or possibly contagious disease. 

These orders, whether issued by the State Health Officer or a local health officer, are limited to ten (10) 

days. Subsequent orders, including order extensions, for the same or substantially same purpose may be 

issued as follows: 

o For orders of the State Health Officer, the Governor may issue subsequent orders not to exceed 

sixty (60) days; 

o For orders of local health officers, locally elected governing bodies can issue subsequent orders. 

• For certain orders issued by local health officers, the act requires forty-eight (48) hours’ notice 

to the public and an opportunity to comment. 

• This act also amends provisions governing the appointment and oversight of the State Health 

Officer. The act requires the Governor to appoint the State Health Officer. The act provides 

that either the Governor or the Director of the Department of Health may remove the State 

Health Officer. The act removes the option of the Director of the Department of Health to also 

serve as the State Health Officer. 

Wyoming Investment in Nursing – This bill asked for 264,459.00 to be appropriated to the 

Community College Commission for the WyIN program. The funding would be used to support the 

faculty salary portion of this program for 2021 and would come out of the Covid Relief fund. 

At the end of the session, each committee is given a priority list of issues and topics that will be 

researched during the 2021 interim. Priorities for the Labor Health Committee are as follows: 

Priority #: 1 Aging. 

The Committee will examine services and options to address the challenges facing the growing aging 

population in Wyoming. Among other issues, the Committee intends to consider long-term care costs, 

options for keeping seniors in their homes, availability of beds in care facilities, reimbursement rate rebasing 

and potential updates to the nursing home administrator practice act, W.S. 33-22-101 through -110. 

37


Priority #: 2 Workforce and Licensing. 

The Committee will evaluate workforce needs and educational programs for the behavioral health 

and long-term care workforces, healthcare provider qualifications transparency, pharmacy services and 

providers and examine workers’ compensation coverage. The Committee will also review youth labor 

and work-based learning opportunities and evaluate the legality of employer vaccination requirements. 

Priority #: 3 Mental Health and Substance Abuse. 

The Committee will review 2021 HB0038 (Community behavioral health-priority populations) and the 

funding and structure of community behavioral health services, receive an update on the state suicide 

hotline and consider pursuing mental health waiver. 

Priority #: 4 Costs of Healthcare and Insurance. 

The Committee will follow up on recommendations from the Governor’s health care task force and on 

the employee group insurance bundling study, evaluate pharmacy benefit manager payment structures 

and other ways to address high healthcare costs. 

Priority #: 5 Review of Safety New Programs. 

The Committee will review the funding changes in Department of Health, Department of Family 

Services, and other agencies’ safety net programs to evaluate the cumulative effects of these changes, 

including potential impacts on maintenance of effort requirements. 

Priority #: 6 Responses to Federal Actions, COVID-19 Issues, 

Court Decisions, Past Legislation and Reports from State Agencies. 

The Committee will consider and review relevant court decisions and state responses to federal actions 

specific to the Committee’s subject matter jurisdiction, issues related to the COVID-19 pandemic and the 

state’s response and review recently adopted state legislation, and receive required reports from state 

agencies. 

Interim committee meetings are open to the public and the schedule is posted on the wyoleg.gov 

website. The availability for the public to testify through Zoom has allowed many to speak on a topic 

without having to travel. 

Our legislators work all year long looking at solutions and strategies for the betterment of the state. 

This year it will be centered around the budget which is dismal at best. Unpopular decisions are not 

uncommon, but the goal is to hopefully make decisions that will benefit the majority, rather than the 

minority. Even during these trying times, it is important to stay connected with the people that make 

decisions. 

Legislator contact information is at www.wyoleg.gov. 

38


REGION REPORTS 

Northwest Region Board 

President: Linette Johnson 

Vice President: Paula Kihn 

Treasurer: Christina Brewer 

Secretary - Tina King 

Northwest Region Report 

The Northwest (NW) Region membership has fluctuated this year. July of 2020 showed 88 members and 

over the course of the last 12 months we reached a high of 94 members. That high has now decreased 

to 85 members. Recognizing there are many reasons for the fluctuation, especially in the challenging 

time of COVID-19, the NW Region board joins the WNA board in continuing to explore ways to identify 

and meet the needs of the membership. 

We welcome suggestions for ways to support WY nurses. 

Scholarships: 

2020 Scholarships: 

In 2020, the Northwest Region offered three scholarships! The scholarship eligibility was expanded 

to include applicants from across Wyoming. After extending the application deadline, we received 

qualified applicants in each category. 

• Pre-licensure scholarship ($500.00)- Sharron Hodges 

• Continuing education scholarship ($250.00) - Raedel Kellogg 

• WNA Membership -Hiedi Christensen 

2021 Scholarships: 

For 2021 the NW Region is excited to announce an opportunity for a single larger nursing scholarship! 

This $1000 scholarship will support a WY student either in a pre-licensure nursing program or a RN- 

BSN program. The NW Region board also wants to thank the WY chapter of Sigma Alpha Pi for helping 

sponsor the Joyful Movement Move-a-thon fundraiser. The fundraiser not only supports the scholarship, 

but by emphasizing “Joyful Movement” the activity celebrates the Year of the Nurse and and the 

importance of “self-care” for all nurses. 

Thank you to those who participated in our Joyful Movement Move-a-Thon. And thank you to our NW 

Region membership; your dues help our region fund the scholarship! 

Watch for more information in WNA communications and www.wyonurse.org regarding the application 

process. If anyone is interested in serving on the scholarship selection committee, please contact Linette 

Johnson, johnson.linette@gmail.com. 

39


Southwest Region Report 

Southwest Region Nurses, like all other nurses, spent this past year working hard to navigate around the 

pandemic. Regardless of the area of nursing, we are tired. Hopefully this summer provided you all time 

to get outdoors and enjoy the sun. 

The highlight for SW Region was the Nurses Day event that was held in Rock Springs at a coffee shop in 

May. It felt good to gather and recognize many of the excellent nurses in our region. As we are ramping 

up for another winter of Covid-19, SW Region board would like to remind you to practice self-care. Burn 

out is prevalent. Take time to take care of yourself and remind yourself the reason why you were called 

to be a nurse. 

40


LEADERSHIP ELECTIONS 

2021 WNA BOARD CANDIDATES 

VICE PRESIDENT 

ABBY BREMER, MSN, RN 

Quality/Regulatory Consultant at Banner Health 

SECRETARY 

MANDI E LEW, DNP, CNM, APRN 

Rock Springs Community Health Center 

2021 WNA REGION CANDIDATES 

NORTHWEST PRESIDENT 

LINETTE JOHNSON, RN, MSN 

Retired 

CENTRAL PRESIDENT 

DAVID CURRIE, MSN, RN 

Director of Nursing at Eastern Wyoming College 

41


SOUTHWEST PRESIDENT 

MAKAYLA WYNN, MSN, RN 

Director of Nursing at Best Home Health and Hospice 

BRENNA KIRSCH, DNP, APRN, FNP-BC 

Family Nurse Practitioner 

Castle Rock Medical Center 

SOUTHWEST TREASURER 

MAKAYLA WYNN, MSN, RN 

Director of Nursing at Best Home Health and Hospice 

BRENNA KIRSCH, DNP, APRN, FNP-BC 

Family Nurse Practitioner 

Castle Rock Medical Center 

JULIE LEAVITT, MSN, RN 

Assistant Professor of Nursing 

Western Wyoming Community College 

42


Wyoming 

Nurses 

Association 

Bylaws 

Amended September 2020 

43


Table of Contents 

ARTICLE I: NAME, PURPOSES, AND FUNCTIONS .................................................... 2 

ARTICLE II: MEMBERSHIP ............................................................................................. 3 

ARTICLE III: CONSTITUENT NURSES ASSOCIATIONS .......................................... 7 

ARTICLE IV: WNA GOVERNANCE ................................................................................ 9 

ARTICLE V: WNA MEETINGS ....................................................................................... 13 

ARTICLE VI: COMMITTEES.......................................................................................... 14 

ARTICLE VII: ORGANIZATIONAL AFFILIATE MEMBERS .................................. 17 

ARTICLE VIII: NOMINATIONS AND ELECTIONS .................................................... 17 

ARTICLE IX: RELATIONSHIP WITH THE AMERICAN NURSES ASSOCIATION19 

ARTICLE X: AMENDMENTS .......................................................................................... 19 

ARTICLE XI: WYOMING NURSE .................................................................................. 20 

ARTICLE XII: PARLIAMENTARY AUTHORITY ...................................................... 20 

1 | Page 

44


WYOMING NURSES ASSOCIATION BYLAWS 

AMENDED October 2020 

ARTICLE I: NAME, PURPOSES, AND FUNCTIONS 

SECTION 1: NAME 

The name of this Association shall be the Wyoming Nurses Association hereinafter referred to as WNA. 

SECTION 2: PURPOSES 

The purposes of WNA shall be: 

A. To foster high standards of nursing, promote the professional and educational advancement of 

nurses, and to promote the welfare of nurses to the end that all people may have better health 

care. 

B. Unrestricted by consideration of age, color, creed, disability, gender, health status, lifestyle, 

nationality, religion, or sexual orientation. 

SECTION 3: FUNCTIONS 

The functions of WNA shall be to: 

A. Promote through appropriate means the standards of nursing practice, nursing education, and 

nursing services established by the American Nurses Association hereinafter referred to as ANA. 

B. Ensure adherence to the Code of Ethics for Nurses established by ANA. 

C. Support systematic study, evaluation, and research in nursing and disseminate information 

relative to research. 

D. Promote and protect the economic and general welfare of nurses. 

E. Promote and provide for the continuing professional development of nurses. 

F. Represent and serve as their spokesperson with professional and community groups and the 

public. 

G. Provide for representation to the ANA Membership Assembly. 

H. Promote relationships and collaboration with the Student Nurses Association. 

I. Stimulate and promote research in nursing, disseminate research findings, and encourage the use 

of new knowledge as a basis for nursing. 

J. Provide services to constituent Region nurses associations, hereinafter referred to as RNAs. 

K. Maintain communication with members through official publications. 

L. Assume an active role as a consumer advocate. 

M. Initiate and influence legislation, governmental programs, and state and national health policy. 

N. Ensure an archive for the collection and preservation of documents and other materials which 

have contributed to and continue to contribute to the historical and cultural development of 

nursing in the state. 

O. Promote and participate in surveys of nurse manpower resources in the state. 

P. Cooperate with other state nursing associations in activities, which concern both organizations. 

Q. Protect and promote advancement of human rights related to health care and nursing 

2 | Page 

45


ARTICLE II: MEMBERSHIP 

SECTION 1: COMPOSITION 

A. Individual members of WNA shall be persons accepted as members in accordance with 

qualifications and other requirements described in WNA Bylaws. Membership shall be 

unrestricted by consideration of age, color, disability, gender, health status, lifestyle, nationality, 

race religion, or sexual orientation. 

B. Membership Options: Members have the option to belong to WNA Only, ANA Only, or hold 

both WNA/ANA dual membership. These options are as follows: 

a. WNA/ANA Premier Membership 

i. An individual nurse who meets the qualifications under Article II; 

Membership Section 2: Qualifications. 

b. WNA/ANA Associate Membership 

i. An individual nurse who qualifies for one of the following categories may 

elect to pay 50% of the dues per the WNA dues policy: 

1. Under 62 years of age and not employed. 

2. Enrolled full-time in an accredited nursing education program. 

3. New graduate from pre-licensure nursing education program for first 

two years of membership. 

c. WNA/ANA Special Membership 

i. An individual nurse who qualifies for one of the following categories may 

elect to pay 25% of the dues per the WNA dues polic: 

1. 62 years of age or over and not employed. 

2. Totally disabled. 

d. WNA/ANA Standard Membership 

i. An individual nurse who meets the qualifications under Article II; 

Membership Section 2: Qualifications. 

e. WNA Only Members 

i. An individual nurse who lives or works in Wyoming may join WNA at the 

state level only. The annual dues for an WNA Only member shall be 

established by the WNA membership assembly and includes an 

administrative fee to ANA based on a contract between WNA and ANA. The 

WNA Only member shall not be entitled to representation at the ANA 

Membership Assembly or other benefits of ANA membership 

f. ANA Only Members 

i. These members will pay only ANA membership dues. They are eligible for 

ANA only membership benefits. 

3 | Page 

46


C. Any registered nurse holding membership in another state may hold dual membership in 

WNA, paying only WNA dues. 

PROVISO: The following categories of membership are not available to individuals joining 

after October 1, 2019. WNA/ANA Associate Membership, ANA/ANA Special Membership, 

WNA Only Members, ANA Only Members. 

SECTION 2: QUALIFICATIONS 

A. A member is one: 

a. Who has been granted a license to practice as a registered nurse in the State of 

Wyoming, or is licensed in another state, District of Columbia, or territories of the 

United States, or who has retired and/or no longer chooses to practice, but whose 

license was in good standing with his/her licensing board at the time the nurse 

made the decision not to maintain an active license, and who does not have a 

license under suspension or revocation in any state. WNA may include in its 

membership the impaired nurse, in recovery, who has surrendered a license to 

practice; and 

b. who is otherwise entitled by law to practice, and 

c. who held a license, and 

d. whose application for membership in WNA has been accepted, and 

e. whose dues are current, and whose membership is not under revocation. 

B. Members shall be unrestricted by consideration of age, color, creed, disability, gender, health 

status, lifestyle, nationality, ethnic origin or sexual orientation. 

SECTION 3: RIGHTS 

A. WNA/ANA members shall have the right to: 

a. Receive a WNA/ANA membership card, all official publications of the American Nurses’ 

Association, the Wyoming Nurse, and e-mail news from the WNA office. 

b. Access to all information on WNA’s and ANA’s website – member only included. 

c. Be a candidate for WNA/ANA elective or appointed positions in accordance with 

qualifications set forth in the WNA and ANA Bylaws. 

d. Be a candidate for President, President Elect, Vice President, Secretary and Treasurer of 

WNA. 

e. Advocacy and a voice for the profession on both state and federal levels. 

f. Education and professional development and valuable personal benefits such as: 

i. Continuing education opportunities at regional, state and national levels. 

ii. Discounts to WNA sponsored continuing education programs. 

iii. Reduced rates for on-line continuing nursing education. 

iv. Committee and leadership opportunities. 

4 | Page 

47


v. Reduced-cost professional liability programs. 

vi. Other retirement savings and insurance benefits. 

vii. Unlimited access to the Nurse Consultant. 

g. Submit proposals for consideration to the WNA Board of Directors and members. 

h. Attend the Congress of the International Council of Nurses. 

i. Due process in disciplinary matters including notice, full and fair hearings, and the right to 

appeal at the state level. 

j. Be accorded other rights as provided for under common parliamentary or statutory law. 

B. WNA only members shall have the right to: 

a. Receive a WNA membership card, e-mail news from the WNA office, and the Wyoming 

Nurse. 

b. Access to all information on WNA’s web site. 

c. Be a candidate for WNA elective or appointed positions, excluding President, President 

Elect, Vice President, Secretary, and Treasurer, in accordance with qualifications set forth in 

the WNA bylaws. 

d. Submit proposals for consideration to the WNA Board of Directors and members. 

e. Advocacy and a voice for the profession at the state level. 

f. Education, professional development and valuable personal benefits such as: 

i. Continuing education opportunities at regional and state levels. 

ii. Discounts to WNA-sponsored continuing education programs. 

iii. Committee and leadership opportunities. 

iv. Reduced-cost professional liability programs. 

g. Due process in disciplinary matters including notice, full and fair hearings, and the right to 

appeal at the state level. 

h. Be accorded other rights as provided for under common parliamentary or statutory law. 

C. ANA only members shall have the right to: 

a. Receive an ANA membership card, the official publications of ANA, and the Wyoming Nurse. 

b. Access to all information on ANA’s web site – member only included. 

c. Advocacy and a voice for the profession at the national level. 

d. Education and professional development and valuable personal benefits such as: 

i. Continuing education opportunities on a national level. 

ii. Reduced rates for on-line continuing nursing education. 

iii. Reduced-cost professional liability programs. 

iv. Retirement savings programs. 

v. Major and Comprehensive Medical and Dental Insurance. 

vi. Life Insurance, Hospital Disability Income, and Excess Major Medical. 

vii. Auto insurance discounts 

D. Due process in disciplinary matters including notice, full and fair hearings, and the right to appeal at 

the state level. 

E. Be accorded other rights as provided for under common parliamentary or statutory law. 

5 | Page 

48


SECTION 4: OBLIGATIONS 

A. Member shall have the obligation to: 

a. Uphold the Bylaws of ANA, WNA, and RNA to which the member belongs. 

b. Uphold the Code of Ethics for Nurses as adopted by the ANA Membership Assembly. 

c. Pay dues as required by the WNA or ANA. 

d. Fulfill the requirements of an office or committee if elected or appointed. 

SECTION 5: DISCIPLINARY ACTION AND APPEAL PROCESS 

A. Cause for Disciplinary Action: Cause for disciplinary action by WNA against a WNA/ANA member 

shall be limited to failure to fulfill the obligations as cited in these bylaws; and other actions 

detrimental to the purposes, goals, and functions of WNA/ANA. 

B. Disciplinary Proceedings: Disciplinary proceedings shall be conducted in accordance with policies 

and procedures established by the Board of Directors which shall have final disciplinary authority 

over members. 

C. Disciplinary Action: Depending on the severity of the violation, a member may be reprimanded, 

censured, suspended from membership or permanently expelled from membership. 

D. Appeal of Disciplinary Action: A member may appeal any disciplinary action in accordance with 

procedures adopted by the WNA Board of Directors. 

E. Recognition of Disciplinary Action of Another ANA State Nurses Association: Any disciplinary action 

taken by another ANA State Nurses Association against one of its individual SNA/ANA members 

shall be given full recognition and enforcement provided such action was taken in accordance with 

the disciplining State Nurses Associations bylaws and disciplinary procedures. 

SECTION 6: DUES 

A. The rate of dues for categories of membership shall be established by the dues policy adopted by 

the WNA membership assembly and may be adjusted by the Board of Directors. 

B. WNA shall continue to pay dues to the ANA pursuant to the ANA Bylaws and House of Delegate 

policy until such time as two thirds (2/3) of the entire WNA/ANA membership votes to disaffiliate 

from the ANA. WNA membership is defined as individual members of WNA who have ANA rights 

and privileges of membership as a result of their WNA/ANA membership. The vote may occur by 

mail or electronic ballot, with appropriate notice and procedures to protect the integrity and 

validity of the vote. 

C. Members who qualify for associate status may elect to pay fifty percent (50%) of annual dues 

required for regular members. 

D. Members who qualify for special status may elect to pay twenty-five percent (25%) of annual dues 

required for regular members. 

E. Membership rights in WNA are forfeited when dues are thirty (30) days delinquent. 

6 | Page 

49


SECTION 7: CHANGE OF DUES CATEGORY 

When a change in dues category is made within a membership year, no monies shall be refunded nor 

shall additional monies be collected. 

SECTION 8: TRANSFER 

A. A WNA member who has completed full payment of dues in one RNA may transfer to another 

RNA. Transfer is requested through the WNA office. 

B. A member who has paid full dues may transfer to another SNA by requesting transfer through the 

WNA office. 

C. A member of another SNA who has paid dues may transfer to WNA without further payment or 

refund of dues for the remainder of the membership year. 

SECTION 1: DEFINITION 

ARTICLE III: CONSTITUENT NURSES ASSOCIATIONS 

Constituent Nurses Associations of WNA are Region Nurses Associations, hereinafter referred to as 

RNAs. RNAs are organized in accordance with the WNA Bylaws and have adopted bylaws and policies 

that are in harmony with the Bylaws, functions, and purposes of WNA. 

SECTION 2: BOUNDARIES 

A. Boundaries of a RNA shall be defined by the WNA Board of Directors. The boundaries may be 

changed in accordance with procedures adopted by the WNA Board of Directors. 

B. WNA has been divided into five (5) Regions using county lines, as follows: 

a. Northwest Region—Park, Teton, Fremont, Hot Springs, Washakie and Big Horn 

Counties 

b. Northeast Region-Sheridan, Johnson, Campbell, Crook and Weston Counties 

c. Central Region—Natrona, Converse, Niobrara, Goshen and Platte Counties 

d. Southeast Region---Albany, Laramie and Carbon 

e. Southwest Region—Sweetwater, Lincoln, Sublette and Uinta Counties 

SECTION 3: RNA BOARD OF DIRECTORS 

A. Composition: The RNA Board of Directors shall consist of four (4) elected officers: President, 

Vice President, Secretary and Treasurer. 

B. Terms of Office: The President and Treasurer shall be elected in the odd numbered years. 

The Vice President and Secretary shall be elected in the even numbered years. No one shall 

serve more than two consecutive two year terms in the same office. 

7 | Page 

50


C. RNA elections will follow the state election process and occur during the same time. RNA 

members will receive a ballot specific to their region to vote for their region leadership 

while at the same time voting for state elected leadership positions. 

SECTION 4: OBLIGATIONS 

RNAs shall be required to: 

A. Assure that their members are qualified as provided in Article II of these bylaws. 

B. Adopt and maintain such bylaws as do not conflict with the Bylaws of ANA and WNA. 

C. Submit reports to the WNA Board of Directors upon request. 

D. Notify the WNA office of the names and addresses of officers, other members of the Board of 

Directors, and chairpersons of committees. 

E. Provide a copy of the RNA bylaws and amendments to the WNA office. 

F. Send, when requested and possible, nominations of qualified members and associates for WNA 

and ANA offices, delegates to ANA meetings, WNA and ANA committees, allied groups requesting 

representation, and names for submission to the Governor of Wyoming for appointment to the 

State Board of Nursing. 

G. Prepare an annual report for publication when required by the Board of Directors. 

H. Nominate representatives for the WNA Board of Directors. 

I. Assure representation of their Region on WNA Board of Directors. 

SECTION 5: RIGHTS OF A RNA 

Rights of a RNA shall be: 

A. Voting representation on the WNA Board of Directors. 

B. Scheduling RNA meetings with regard to frequency and content. 

C. Elections of officers without censure or interference by the WNA Board of Directors. 

SECTION 6: DISSOLUTION OF A RNA 

A. Dissolution of a RNA can be accomplished by a three-fourths (3/4) vote of a majority of the current 

membership and approved by a majority vote of the Board of Directors of the WNA, provided sixty 

(60) days’ notice was given the total RNA membership of such proposed action. 

B. The Board of Directors of the WNA shall continue to manage the affairs of the RNA until such time 

as the dissolution is complete and final payments of indebtedness are made. 

C. When a RNA is disbanded for any reason, any funds remaining in the treasury after all debts have 

been paid shall be handled in one of the following ways: 

a. In the event that all members of the disbanded RNA join another RNA, the balance of funds 

will go into the operating fund of that RNA. 

b. If the members of the disbanded RNA join more than one other RNA the funds will be 

divided proportionally among the constituent associations involved. Any funds remaining in 

escrow at the end of the two years will be deposited in the WNA general account. 

c. Within three (3) months following disbanding, a final report shall be sent to the WNA office, 

by the President and/or Treasurer of the disbanded RNA. 

8 | Page 

51


SECTION 7: REINSTATEMENT 

Reinstatement of a RNA that has been disbanded may be reinstated by a seventy-five percent (75%) 

vote of the WNA Board of Directors. 

SECTION 8: DISQUALIFICATIONS 

A RNA which fails to comply with the requirements of these Bylaws or for other causes deemed 

sufficient may be disqualified as a constituent Region association of the WNA by a seventy-five percent 

(75%) vote of the WNA Board of Directors provided due notice has been given. Such RNA and its 

members must be notified before the vote is taken and shall have opportunity for a hearing with the 

Board within ninety (90) days prior to the hearing. 

SECTION 9: MERGING OF RNAS 

If one RNA merges with another RNA, the funds remaining in the treasury shall be allocated in the 

operating fund of the RNA with which it is merging. 


9 | Page 

ARTICLE IV: WNA GOVERNANCE 

Governance of WNA is through the Executive Committee (EC) and the Board of Directors (BOD), 

henceforth defined as the Governing Body (GB) of the organization. 

SECTION 2: COMPOSITION OF THE GOVERNING BODY (EC AND BOD) 

A. The Executive Committee (EC) shall be composed of WNA elected officers (President, President- 

Elect, Vice-President, Secretary and Treasurer) and the WNA Executive Director (ED), who is a nonvoting 

member. 

B. The Board of Directors (BOD) shall be composed of the EC and all Region Presidents/elected 

representatives. One new graduate nurse within two years of initial licensure shall be appointed 

the BOD. 

C. The immediate past President, shall be ex-officio member of the BOD. 

D. The WNA President is the presiding officer over the Governing Body. 

SECTION 3: AUTHORITY 

The Governing Body shall have the duty and power, delegated to it by the membership, of acting for 

the membership in the intervals between Annual Meetings, as well as other duties and powers as 

defined in these Bylaws. 

52


SECTION 4: ACCOUNTABILITY 

The Governing Body shall be accountable to the WNA membership. 

SECTION 5: RESPONSIBILITIES 

The Governing Body shall: 

A. Exercise the corporate responsibility and fiduciary duties of the Association consistent with the 

applicable provisions of law. 

B. Provide for implementation of Association policies and positions approved by the WNA 

membership. 

C. Provide direction and approval of the functions of the Executive Committee. 

D. Establish financial policies and procedures, adopt the budget, fix and approve amount of bond for 

appropriate officers and staff, and present an annual financial statement to the membership. 

Professional audit consultation shall be utilized as deemed necessary. 

E. Establish policies and procedures for the transaction of Association activities, and operation and 

maintenance of the WNA Executive Office. 

F. Establish policies and procedures for nominations and elections. 

G. Establish standing and special committees of the Board as deemed necessary for the performance 

of its duties and define the purpose of authority of such committees. 

H. Define qualifications for appointive office, make appointments and fill vacancies as delegated to 

the Board in these Bylaws. 

I. Appoint, define the authority and the responsibilities of, and annually review the performance of 

the WNA Executive Director. 

J. Establish fees for the Annual Meetings, specified activities, and services. 

K. Provide for WNA liaison or representation at meetings of voluntary organizations and of public or 

governmental agencies. 

L. Establish relationships and collaboration with the Wyoming Student Nurses Association. 

M. Assume other duties as may be provided for elsewhere in these Bylaws and by the WNA 

membership. 

N. Confer constituent membership on RNAs meeting the qualifications established in these Bylaws. 

O. Establish policies and procedures for disciplinary action against members and RNAs. 

P. Control the use of the official WNA logo and the procurement and sale of replicas thereof. 

Q. Establish policies and procedures approving publications and other printed materials prior to their 

distribution. 

R. Establish policies and procedures for the collection, analysis, and dissemination of information. 

S. Ensure the maintenance of an archive for the collection and preservation of documents and other 

materials that have contributed and continue to contribute to the historical and cultural 

development of nursing in the state. 

T. Establish the mechanism to advocate for and protect the human rights and ethical concerns of the 

nursing profession. 

10 | Page 

53


SECTION 6: TERM OF OFFICE 

A. Officers shall be elected for a two-year term. The President-Elect and Treasurer shall be elected in 

even numbered years. The Vice-President and Secretary shall be elected in the odd-numbered 

years. 

B. The Governing Body shall appoint the new graduate nurse in even numbered years for a two-year 

term. Only new graduates within two years of initial licensure will be eligible for this position. 

C. No one shall serve more than two (2) consecutive terms in the same office or more than eight (8) 

consecutive years on the Governing Body. Any person who has served less than a full term but 

more than twelve (12) months shall be considered to have served a full term in that office. 

D. Persons may again serve on the Governing Body following a two (2) year absence. 

SECTION 7: QUALIFICATIONS 

To be eligible to serve on the Governing Body, a person shall: 

A. Hold current membership in the WNA and the RNA represented if a RNA representative. 

B. Not concurrently serve as an officer or director of another organization if such participation might result in a 

conflict of interest with WNA. 

SECTION 8: VACANCIES 

A. In the event of a vacancy: 

a. In the office of President, the President-Elect shall become President for the remainder of 

the term and shall continue in the office as President during the following biennium. 

b. In the office of President-Elect, the Vice-President shall become President-Elect for the 

remainder of the term and shall perform the duties of the Vice-President and President- 

Elect until assumption of Presidential duties. 

c. In both the offices of President and President-Elect, the office of President shall be filled by 

the Vice-President who shall serve until the next general membership meeting when both 

vacancies shall be filled by election. 

d. In case of any other office, or chairpersons of standing committees, the Governing Body 

shall appoint a replacement to serve the remainder of the term. 

e. Any member of the Governing Body absent without notice from two (2) consecutive 

meetings of the Governing Body shall be considered to have resigned. Upon confirmation 

by the Secretary of two (2) unexcused absences, the vacancy shall be filled in the manner 

stated above. 

SECTION 9: DUTIES OF OFFICERS 

A. The President of WNA shall serve as the spokesperson on matters of Association policy and 

positions. Specifically, the President of WNA shall: 

1. Be chairperson of the Executive Committee, and the Governing Body. 

2. Preside at all meetings of the WNA. 

11 | Page 

54


3. Present a yearly report at the Annual Meeting. 

4. Serve as a representative to the ANA Membership Assembly. 

5. Serve as WNA ex-officio member of all committees except the Nominating Committee. 

B. The President-Elect shall assume the duties of the President in his/her absence or at the direction 

of the President. The President-Elect shall serve as a representative to the ANA Membership 

Assembly. The President-Elect shall serve as co-chairperson of the Legislative Committee. 

C. The Vice-President shall assume the duties of the President in the absence of the President and 

President-Elect. The Vice-President shall serve as co-chairperson of the Technology and Public 

Relations Committee. The Vice-President shall serve as the elected First Alternate representative to 

the ANA Membership Assembly. 

D. The Treasurer shall be responsible for monitoring the fiscal affairs of the Association and shall 

provide reports and interpretations of WNA’s financial condition to the Governing Body and the 

WNA membership. The Treasurer shall serve as co-chairperson of the Finance Committee. The 

Treasurer shall serve as the elected Second Alternate representative to the ANA Membership 

Assembly. 

E. The Secretary shall be responsible for ensuring that Records are maintained of meetings of the 

WNA, the Board of Directors, and Executive Committee of the Governing Body, and shall notify 

members of the meetings of WNA. The secretary shall serve as co-chairperson of the Nursing 

Practice Committee. The Secretary shall serve as the elected Third Alternate representative to the 

ANA Membership Assembly. 

F. Officers shall fulfill the assigned responsibilities and duties as outlined under Committee Functions. 

G. Officers and other members of the Governing Body shall fulfill the responsibilities of the Governing 

Body as defined in these Bylaws. 

SECTION 10: EXECUTIVE COMMITTEE 

There shall be an Executive Committee of the Governing Body composed of the officers that shall have 

the power to transact business between Board Meetings in accordance with the rules established by 

the Governing Body. Such transactions shall be reported at the next regular meeting of the Governing 

Body. The Executive Committee shall review WNA policies and procedures each year in January. 

SECTION 11: DUTIES OF THE EXECUTIVE DIRECTOR 

The Executive Director shall: 

A. Manage the Association in accordance with policies established by the Board. 

B. Be accountable to the Board of Directors. 

C. Employ, direct, promote, and terminate staff of the Association. 

D. Represent the Association and serve as spokesperson on matters of established policy and 

positions. 

E. Prepare and submit required ANA reports. 

F. Be responsible for the publication of the Wyoming Nurse. 

G. Attend the ANA national meetings. 

H. Serve as an ex-officio member of the Board of Directors and standing committees. 

12 | Page 

55


I. Serve as the elected Fourth ANA Alternate to the Membership Assembly only if the Executive 

Director is an RN member of WNA. 

SECTION 12: MEETINGS 

A. Meetings of the Governing Body shall be held at least two (2) times annually at a time and place 

determined by the Governing Body. Special meetings may be called by the President and shall be 

subject to ratification at the next regular meeting of the Governing Body. 

B. Business requiring action by the Governing Body may be conducted by mail or other media. Such 

action shall be subject to ratification at the next regular meeting of the Governing Body. 

C. Unexcused Absence from two consecutive regular meetings of the Governing Body shall be cause 

for declaring a vacancy in the position. Such vacancy shall be determined by a majority of the 

Governing Body. 

SECTION 13: QUORUM 

A minimum of five members of the voting membership of the Governing Body, one of whom shall be 

the President, President-Elect, or Vice-President, shall constitute a quorum of the Governing Body. 

Minutes shall be distributed to all members of the Governing Body within sixty (60) days of any 

meeting. 

SECTION 1: FREQUENCY 

ARTICLE V: WNA MEETINGS 

The WNA general membership shall meet at least annually, at such place and time as shall be 

determined by the Governing Body. 

SECTION 2: SPECIAL MEETINGS 

Special Meetings of the WNA can be called by the Governing Body and shall be called by the President 

upon written request of a majority of the Regions. 

SECTION 3: NOTICE OF MEETINGS 

A. Notice of the annual business meeting and convention shall be mailed to the membership at least 

thirty (30) days before the first day of the business meeting. 

B. Notice of special business meetings shall be mailed to the membership at least fifteen (15) days 

before the first day of the business meeting. 

13 | Page 

56



Five (5) members of the Governing Body, one of whom shall be the President, President-Elect, or Vice- 

President, and representatives from at least three of the RNAs shall Constitute a quorum for 

transaction of business at any regular or special meeting of WNA. 

SECTION 5: VOTING BODY 

The voting body at all annual and special meetings should consist of all members in good standing who 

are in attendance. 

SECTION 1: STANDING COMMITTEES 

ARTICLE VI: COMMITTEES 

WNA standing committees shall include: Legislative, Nursing Practice, Technology and Public Relations, 

Bylaws and Finance. 

SECTION 2: COMPOSITION 

A standing committee shall be composed of at least three (3) members. 

SECTION 3: APPOINTMENT 

Each standing committee shall be composed of three (3) members of WNA and shall have been 

appointed by the WNA Governing Body. 

A. The President shall appoint a chairperson for the Bylaws Committee and at least one member of 

the Board of Directors to serve on this committee. 

B. The President-Elect shall also serve as the co-chairperson of the Legislative Committee. 

C. The Vice-President shall serve as the co-chairperson of the Technology and Public Relations 

Committee. 

D. The Secretary shall serve as the co-chairperson of the Nursing Practice Committee. 

E. The Treasurer shall serve as the co-chairperson of the Finance Committee. 

SECTION 4: TERM OF OFFICE 

A. Members of all standing committees may serve two (2) terms or until their successors are 

appointed. 

B. Members of all standing committees may serve for two (2) consecutive terms on the same 

committee and may serve again following a two (2) year absence from that committee and no 

more than eight (8) years on the Governing Body without a two year absence. 

C. No members of WNA shall serve on more than two (2) standing committees at a time. 

14 | Page 

57


D. One member of the Finance, Legislative, Technology and Public Relations, and Nursing Practice 

Committee will be appointed in the even years. The remaining two (2) members of these 

committees will be appointed in the odd years. 

SECTION 5: ATTENDANCE 

Unexcused absence from two (2) consecutive committee meetings shall be cause for declaring a 

vacancy in the position. Such vacancy shall be filled by appointment by the Governing Body for the 

remainder of the unexpired term. 

SECTION 6: ACCOUNTABILITY 

Standing committees shall be accountable to the WNA Governing Body and submit reports as required 

by these Bylaws. 


A majority of any committee shall constitute a quorum at any committee meeting. 


A. The Finance Committee shall: 

a. Be co-chaired by the Treasurer and ED. In collaboration, the co-chairs shall recruit at least one other 

member. 

b. Prepare and submit annually a WNA budget. 

c. Appoint an audit committee to perform an internal audit bi-annually at the close of the Treasurer’s 

term of office and submit a report to the Governing Body. 

d. Determine policies and procedures which shall be consistent with these Bylaws. 

e. Monitor WNA financial affairs including investments and expenditures. 

f. Provide fiscal reports and interpret WNA financial condition to the Governing Body and 

membership. 

g. Consult with appropriate accounting and fiscal experts as needed to make recommendations to the 

Governing Body. 

B. The Legislative Committee shall: 

a. Be co-chaired by the President-Elect and the WNA lobbyist. 

b. Lead in legislation and health policy by recommending positions on current legislative issues to the 

WNA Governing Body while keeping the Governing Body current on legislative affairs. 

c. Actively participate in the legislative process as committee members and by mentoring WNA 

membership in the legislative process. 

d. Keep WNA membership informed regarding legislative issues compatible with WNA legislative 

agenda. 

e. Submit an annual budget to the Finance Committee. 

C. The Technology and Public Relations Committee shall be: 

15 | Page 

58


a. Co-chaired by the Vice-President and an appointed Technology and Public Relations committee 

member from Region Presidents. 

b. Promote the development of nursing leaders. 

c. Influence workforce initiatives. 

d. Help sustain organizational viability by using current information and data technologies to increase 

and sustain WNA membership and facilitate achievement of WNA goals. 


D. The Nursing Practice Committee shall: 

a. Be co-chaired by the Secretary and an appointed Nursing Practice Committee member from Region 

Presidents. 

b. Advance the professional development of nurses by strengthening WNA members’ nursing practice 

through educational, consultative, and publication services. 

c. Promote the creation of a professional work environment for the enhancement of the practice of 

nursing. 

d. Develop position and policies for recommendations to the WNA Governing Body related to relevant 

nursing practice issues. 

e. Submit an annual committee budget to the Finance Committee. 

E. The Bylaws Committee shall be appointed for a two-year term in the even years. The Bylaws committee 

shall: 

a. Be chaired by a WNA member appointed by the President. 

b. Be composed of at least one member of the BOD or Region Presidents appointed by the President. 

c. Review WNA and Region bylaws. 

d. Interpret WNA bylaws. 

e. Receive and prepare proposed amendments to WNA bylaws. 

f. Maintain currency of WNA bylaws. 

g. Submit an annual budget to the Finance Committee. 

SECTION 9: REPORTS 

All standing committees shall prepare an annual report to be published for the general membership. 

These reports are to be submitted to the WNA office at least sixty (60) days prior to the first day of the 

Annual Meeting. 

SECTION 10: SPECIAL COMMITTEES 

A. The Governing Body shall establish special committees as deemed necessary to carry out the 

functions of WNA. 

B. The Nominating Committee shall serve as a special committee and shall be appointed for two year 

terms in the odd years. Members shall serve until their successors are appointed. There shall be 

three members of the committee, each representing a different Region or geographical area of 

the state. The committee members shall elect their chairperson. The functions of the Nominating 

Committee shall be to: 

16 | Page 

59


a. Request the names of candidates for elective offices. 

b. Prepare a slate of qualified candidates and publish each slate at least thirty (30) days prior 

to the Annual Meeting. 

c. Present the slate of candidates to the WNA membership. 

d. Implement the policies and procedures for nominations and elections as established by 

these Bylaws and the WNA Governing Body. 


f. 


ARTICLE VII: ORGANIZATIONAL AFFILIATE MEMBERS 

An organizational affiliate member of WNA is an association that: 

A. Is a nursing organization that meets the criteria established by the WNA membership. 

B. Has a governing body composed of a majority of registered nurses, which is not meant to preclude 

the participation of associate nursing organizations. 

C. Has been granted organizational affiliate/membership status by the WNA Governing Body. 

D. Has paid an organization affiliation fee to WNA. 


Each organizational affiliate member shall maintain a mission and purpose harmonious with the 

purposes of WNA 

SECTION 3: RIGHTS AND SERVICES 

Rights and services of the organizational affiliate member shall be determined by the WNA. These 

rights and services do not include ANA rights, including the right to vote for ANA delegates and 

alternates. Rights and services of organizational affiliates shall be posted on the WNA website. 

SECTION 1: NOMINATIONS 

ARTICLE VIII: NOMINATIONS AND ELECTIONS 

A. RNAs and organizational units shall be requested to submit a list of members who are qualified and willing 

to serve in elective offices. 

B. Candidates for any elective office shall meet established qualifications and shall complete a WNA 

resume/consent form. 

C. Members shall be considered eligible for only one office in WNA at any one time. 

D. A member who meets the established qualifications for any elective office may declare as a candidate by 

writing to the WNA office. 

17 | Page 

60


E. The slate of candidates shall be sent to the membership at least thirty (30) days prior to the Annual Business 

meeting. 

F. The committee will strive to have at least two nominees for each position to be filled and placed on the 

ballot 

G. Nominees must sign “Consent to Serve” forms. 

SECTION 2: ELECTIONS 

A. Elections shall be held annually and shall be by secret ballot. Members will vote by electronic 

ballot. 

B. The ballots shall clearly state that candidates for President and President-Elect are concurrently 

running as representatives to the ANA Membership Assembly. Furthermore, Vice-President, 

Treasurer, and Secretary, are concurrently running as First Alternate, Second Alternate, and Third 

Alternate representatives to the ANA Membership Assembly, respectively. This representation is 

for two year terms each or until a successor is elected. 

C. All WNA/ANA members in good standing are eligible to vote. 

D. Members may vote for a member whose name does not appear on the ballot by writing in the 

name of the member if the member is qualified and has consented to serve if elected. 

E. A plurality vote shall constitute an election. In a tie, the choice shall be by lot. 

F. The terms of office shall begin at the adjournment of the WNA Annual Meeting. 

G. All ballots and credentials shall be preserved for sixty (60) days after the adjournment of the WNA 

Annual Meeting. 

SECTION 3: CHALLENGE 

Any challenge to the election shall be filed with the office of WNA not more than thirty (30) days after 

the adjournment of the WNA Annual Meeting. 

SECTION 4: REMOVAL OF ELECTED OFFICERS 

A. Any officer elected by WNA may be removed whenever such action is deemed to be in the best interest of 

the Association, or for just cause. Removal of an elected officer requires a majority vote of WNA 

membership. 

B. Removal of an elected officer shall be handled as a vacancy and the provisions covering vacancies elsewhere 

in these Bylaws shall apply. 

18 | Page 

61


ARTICLE IX: RELATIONSHIP WITH THE AMERICAN NURSES ASSOCIATION 

SECTION 1: MEMBERSHIP 

WNA is a constituent member of the American Nurses Association. WNA shall pay dues to ANA in 

accordance with the policies adopted by the ANA Membership Assembly 

SECTION 2: REPRESENTATION 

A. Membership Assembly: WNA is entitled to representation at regular and special meetings of the 

ANA Membership Assembly in accordance with ANA Bylaws and policy. 

a. The WNA President and President-Elect shall serve as permanent ANA Membership 

Assembly Delegates. The WNA President-Elect shall be elected as President-Elect and ANA 

Membership Assembly Delegate. When the President-Elect becomes President, election as 

an ANA Membership Assembly delegate must occur. 

b. The Vice-President, Treasurer, Secretary, and Executive Director will serve as first, second, 

third, and fourth Membership Assembly Delegate Alternates respectively. 

c. Vacancies shall be filled only by elected alternates. 

SECTION 1: AMENDMENTS WITH NOTICE 

ARTICLE X: AMENDMENTS 

A. The Bylaws Committee chairperson shall receive proposed amendments to these Bylaws at least ninety (90) 

days prior to the WNA Annual Meeting. 

B. Amendments proposed by the Bylaws Committee for action by membership shall be submitted to the WNA 

office sixty (60) days prior to the WNA Annual Membership Meeting and shall be appended to the Annual 

Meeting notice. 

C. These Bylaws may be amended with prior notice at an annual or special meeting of the WNA by a secret 

ballot and a two-thirds (2/3) vote of the membership voting. 

SECTION 2: AMENDMENTS WITHOUT NOTICE 

A. These Bylaws may be amended without prior notice at an annual or special meeting of the WNA by a secret 

ballot and a seventy-five (75%) percent of the membership present and voting. 

B. These Bylaws may be amended by the Board of Directors in the event such amendments are required for 

conformity with the ANA requirements, by two-thirds (2/3) vote of the Governing Body present and voting. 

19 | Page 

62


ARTICLE XI: WYOMING NURSE 

The Wyoming Nurse shall be the official publication of WNA and shall be published and provided to 

each member of WNA according to WNA policies. 

ARTICLE XII: PARLIAMENTARY AUTHORITY 

The most recent edition of Roberts Rules of Order governs this association in all parliamentary 

situations that are not provided for in the law or in the charter, Bylaws, or adopted rules of WNA. 

20 | Page 

63

307.745.8851

The Wyoming Foster Care Program would like to extend a 

heartfelt, “Thank You!” to nurses who are foster parents. 

And to all nurses who, day in and day out, work to support foster 

parents, youth in care and their families, you make a difference 

every day in more ways than you may ever know! 

Fostering is about families. 

Please consider becoming a foster parent! 

Contact Wyoming Foster Care at 307-721-1951, 

email Thomas.Kennah@wyo.gov or go to 

dfs.wyo.gov for more information and 

to find out about other ways you can help.

2021 Wyoming Nursing Summit & Convention

Create successful ePaper yourself

Delete template?

Save as template?