317 The Effect of Gene Polymorphisms (ENOS G894T, PON1 and Catalase -262C→T) ... <strong>December</strong> <strong>2012</strong> impairs sperm functional competence [6] . We searched for an association between polymorphisms of different plasma enzymatic antioxidants (PON1, ENOS G894T and Catalase -262C→T gene polymorphisms) in a Turkish male population with fertility and varicocele, based on the impairment of spermatozoa functions related with increased ROS. This study also aims to examine, if there is an association between different plasma enzymatic antioxidants (PON1, ENOS G894T and Catalase -262C→T gene polymorphisms) and idiopathic male infertility. SUBJECTS AND METHODS Population of the Study Forty male patients with primary infertility with a mean age of 36.8 ± 6.91 years and forty healthy men with a mean age of 41.2 ± 7.63 years were included in the study. The patients were included in the study after physical examination by an urologist. Patients, in whom left-sided grade 2 varicocele was detected, were evaluated radiologically with scrotal coloured doppler ultrasonography (USG). After evaluation with scrotal doppler [7] , patients with clinical varicocele who had varicose vein with reflux and diameter above 2.2 mm were included in the study group. Patients were included in the study after 3 - 5 days of sexual abstinence. Two different laboratory examinations were performed, at least 15 days apart, and the sperm parameters were evaluated according to WHO guidelines [8] . Fertile men were included in the study as control group. The patients had sperm profiles with a count of 5 - 55 million/ml, a viscosity with a volume of 2 – 5 ml, normal pH values, and no leukospermia. The motility was classified as motile a (rapid progressive motion), motile b (slow progressive motion), motile c (non-progressive motion), motile d (non-motile sperm percentiles), motile a + b (32%; progressive sperm motion) and motile a + b + c (40%; total motion) [8] . The patients with clinical left-sided varicocele in study group had no endocrinopathy, no previous surgery for varicocele or inguinal hernia and no leukospermia. They were also non-smokers. The study group consisted of patients who had no child despite regular sexual intercourse for at least a year. Fertile men were included in the control group. Informed consent forms, compatible with the Helsinki declaration, were taken from the patients and the Institutional Review Board approved the study. Genotyping For eNOS G894T Polymorphism For genetic analysis, 5 ml of blood was drawn into tubes containing EDTA from each patient. DNA was extracted using a commercial kit (QIAamp DNA mini kit; Qiagen, Hilden, Germany). In this study, for the detection of G894T polymorphism on ENOS gene, we used primer pairs to amplify a part of the ENOS gene containing exon 7, by polymerase chain reaction (PCR) with the following flanking intronic primers: sense 5’CATGAGGCTCAGCCCCAGAAC-3’ and antisense 5’AGTCAATCCCTTTGGTGCTCAC-3’, followed by Mbo I restriction endonuclease digestion for 16h at 37 °C and resolution by electrophoresis on 3% agarose gel. The resulting 206 bp PCR product was cleaved into two smaller fragments of 119 and 87 bp in the presence of a T nucleotide at 894 (corresponding to Asp 298) but not in its absence. Digested fragments were visualized after ethidium bromide staining under UV light. Genotyping For Paraoxonase 192 Polymorphism PON1 genotypes were determined by PCR according to previously published protocols [9,10] . For paraoxonase 192 polymorphism, a sense primer 5’TATTGTTGCTGTGGGACCTGAG3’ and antisense primer 5’ CACGCTAAACCCAAATACATCTC 3’, which encompasse the 192 polymorphic region of the human PON1 gene, were used. The PCR reaction mixture contained 100 ng DNA template, 0.5 M of each primer, 1.5 mM MgCl2, 200 mM dNTPs and 1 U Taq DNA polymerase (MBI Fermentas). After denaturing the DNA for 5 min at 94 °C, the reaction mixture was subjected to 35 cycles of denaturation for one min at 95 °C, one min annealing at 60 °C and one min extension at 72 °C, for the 192 genotype. The 99 bp PCR product was digested with 8U BspI restriction endonuclease (MBI Fermentas, Lithuania) overnight at 55 °C, the digested products separated by electrophoresis on a 4% metaphore agarose gel and visualized using ethidium bromide. The B-genotype (arginine) contains a unique BspI restriction site which results in 66- and 33-bp products and the A genotype (glutamine) cannot be cut, allowing the PON1 192 genotype to be determined. Genotyping for catalase - 262C→T polymorphism Genotyping for the CAT - 262C→T polymorphism was conducted according to the method described by Forsberg et al with modifications [11] . PCR amplification of the associated region of the CAT gene promotor site was performed using the primers 5’-AGAGCCTCGCCCCGCCGGACCG-3’ (antisense) and 5’-TAAGAGCTGAGAAAGCATAGCT -3’ (sense) with a touch-down program designed as follows: 94°C for 30 s, 68 °C for 45 s, 72 °C for one min, -0.5 °C/cycle, 19 times, then 94 °C for 30 s, 58 °C for 45 s, 72°C for one min, 25 times. The final elongation step was 10 min at 72 °C. Each reaction mixture (25 ml) contained approximately 50 ng of DNA template, five units of Taq DNA polymerase, 1 mM of each primer, 200 mM dNTPs, 20 mM Tris–HCl (pH 8.4), 50 mM KCl and 1.5 mM MgCl2. For restriction digestion with SmaI, 15 ml were withdrawn from the amplification mixture and incubated with five units of the enzyme in the presence
<strong>December</strong> <strong>2012</strong> KUWAIT MEDICAL JOURNAL 318 Table 1: Distribution as per age, sperm motility and varicose vein diameter in study and control groups Demographic features Patient (n = 40) Control (n = 40) M ± SD Median M ± SD Median p- value (Min - Max) (Min-Max) Age 36.8 ± 6.91 36 (22 - 49) 41.2 ± 7.63 42 (28 - 56) 0.006** motile a 16.3 ± 7.99 16 (2 - 35 ) 34.3 ± 16.58 31.5 (11 - 70)
Change language