Summer Undergraduate Research Program - Fred Hutchinson ...

Role of Endogenous Kras G12D in the Progression and Maintenance of of Pancreas Cancer
Ashley M. Dotson 1,2 ; Vikas K. Goel, Ph.D 2 ; Sunil R. Hingorani, M.D., Ph.D. 2
1 Saint Martin’s University, Lacey, WA; 2 Fred Hutchinson Cancer Research Center, Seattle, WA
Conclusions
Results
pTRIPZ shRNA inducible vector used was in a Tet-On configuration
1 2 3 4 5 6
2009 Lee Hartwell Poster Award
We have generated reagents to specifically knockdown
oncogenic KrasG12D expression. We will now use these
reagents to test our central hypothesis, namely whether
invasive PDA is dependent on sustained KrasG12D expression.
134bp
Fig. 6 Amplification PCR. Using the 97 mer oligonucleotide for PCR
amplification, we yielded a 134bp product. Lanes 1 and 2 are Kras*2shRNA;
lanes 3 and 4 account for Kras*3shRNA; lanes 5 and 6 represent
Kras*4shRNA
Fig. 5 pTRIPZ lentiviral shRNA vector
Fig. 4 RNA Interference (RNAi) with shRNA
Future Directions
After purification of shRNA plasmids we will
make our lentivirus using HEK-293 T-cells and then
transduce it in three distinct cell types and
1) WT Kras
2) WT/KrasG12D 3) KrasG12D Hypotheses
Progression of preinvasive disease to invasive PDA requires continued
oncogenic KrasG12D expression
Maintenance of invasive PDA requires continued oncogenic Kras G12D
expression
Abstract
Pancreatic ductal adenocarcinoma (PDA) is currently the fourth leading
cause of cancer death in the United States and accounts for the majority
of all exocrine malignancies. With a five year survival rate of 3-5%,
PDA is one of the most aggressive and lethal malignancies, and has
thus far remained resistant to conventional therapeutic agents1 .
Extensive research has focused on the precursor lesions of PDA,
including the genetic events that give rise to these lesions, particularly
the proto-oncogene Kras. Point mutations activating Kras are found in
over 90% of pancreatic cancers, which has led many in the field to
hypothesize that they are the initiating event. Our laboratory has shown
that endogenous expression of KrasG12D induces pancreatic
intraepithelial neoplasias (PanIN), which eventually progress into fully
invasive PDA. 1 We now propose to use RNA interference (RNAi) to
silence oncogenic KrasG12D expression at distinct points in disease
progression to determine the therapeutic potential of its inhibition. Our
objective was to construct a pTRIPZ lentiviral short hairpin RNA
vector in order to silence endogenous KrasG12D expression in selected
tumor cell lines in hopes of determining whether the sustainability of
pancreas tumor development is contingent on KrasG12D expression.
1 2 3 4 5 6
Fig. 4 RNA Interference (RNAi) with shRNA3 Fig. 5 pTRIPZ lentiviral shRNA vector
114bp
Assay the efficacy of the shRNA by western blotting
Fig. 7 Restriction Digestion. Eluted PCR products were digested using
XhoI and EcoRI enzymes. After digestion we yielded 114bp product.
Lanes 1 and 2 represent Kras*2shRNA; lanes 3 and 4 represent
Kras*3shRNA; lanes 5 and 6 represent Kras*4shRNA. Compared
digested products with eluted, undigested fragments to ensure accuracy
of digestion.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19
Materials and Methods
Three 97bp oligonucleotide templates containing short hairpin RNA
targeting KrasG12D were used as the initial template in polymerase chain
reaction (PCR) amplification
TGCTGTTGACAGTGAGCGAGAGCTGaTGGCGTAGGCAAGATAGTGAA
GCCACAGATGTATCTTGCCTACGCCATCAGCTCCTGCCTACTGCCTCG
Kras*2shRNA GA
TGCTGTTGACAGTGAGCGCTGGAGCTGaTGGCGTAGGCAATAGTGAA
GCCACAGATGTATTGCCTACGCCATCAGCTCCAATGCCTACTGCCTCG
Kras*3shRNA GA
TGCTGTTGACAGTGAGCGACTGaTGGCGTAGGCAAGAGCGTAGTGAA
Background
Kras G12D is the initiating event in pancreas cancer 1
340bp
159
We will study the effects and functionality of KrasG12D Fig. 10 Brightfield3 Fig. 11 Tet-On configuration 48 hours
after the addition of doxycycline
knockdown in our selected tumor cells by
1) Proliferation Assay
2) Soft Agar Assay
3) Apoptosis
4) Ras activation assay
3
Figure 8. Screening Colonies by PCR. Identification of positive clones.
lanes 1-12 represent Kras*2shRNA; lanes 13-19 represent
Kras*3shRNA.
20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38
GCCACAGATGTACGCTCTTGCCTACGCCATCAGCTGCCTACTGCCTCG
GA
Kras*4shRNA
340bp
Table 1. PCR oligonucleotide templates used for amplification. The red highlighted regions
represent the sense and antisense portions of the sequence. The bold, lowercase “a” accounts for
the point mutation.
miR30PCRxhol (5’primer) miR30PCREcoRIF (3’primer)
Figure 9. Screening Colonies by PCR. Lanes 20-24 represent
Kras*3shRNA; lanes 25-36 represent Kras*4shRNA; pTRIPZ containing
GAPDH shRNA was used as a positive control (Lane 37); empty pTRIPZ
used as negative control (Lane 38)
5’CTAAAGTAGCCCCTTGAATTCCGAGG
CAGTAGGCA-3’
5’CAGAAGGCTCGAGAAGGTATATGCTGTT
GACAGTGAGCG-3’
Fig.1 Conditional LSL-KrasG12D and generation of Cre-mediated
recombinase1 Upon confirmation of shRNA, which specifically silences
KrasG12D but also influences its downstream cellular
processes, we will inject the lentivirus into our mouse model
to study the effects on tumor progression.
Table 2. PCR amplification primers containing XhoI and EcoRI cloning sites 2
We resolved an aliquot of the amplified fragments by electrophoresis
on 1.5% agarose gel
Eluted PCR products and an empty pTRIPZ vector were digested with
XhoI and EcoRI enzymes and then purified from gel electrophoresis
References
1. Hingorani, Sunil et al. "Preinvasive and Invasive Ductal Pancreatic Cancer and its Early
Detection in the Mouse." Cancer Cell 4(2003): 437-450.
After digestion, PCR products were ligated with the pTRIPZ vector
We proceeded to transform our ligated plasmid into E.coli STBL3
competent cells in Ampicillin and Zeocin LB Agar plates
Fig. 2 Pancreata from 2 mos. And 5 mos. mice 1
2. Paddison, Patrick et al. "Cloning of Short Hairpin RNAs for Gene Knockdown in Mammalian
Cells." Nature Methods 1(2004): 163-167.
3. Images taken from Sigma “Mission shRNA” pamphlet
Selected 12 clonies from each shRNA sequence and isolated our
plasmid by miniprep (Invitrogen TM )
Acknowledgements
This research was supported by NIH (P30 CA15704), PanCAN and The Lustgarten Foundation.
[S.R.H.]
Graph 1. Representative Chromatogram of positive nucleotide sequencing.
Verified and selected two colonies from each targeted oligonucleotide for
sequencing. Produced a positive sequence for Kras*2shRNA. Awaiting
results from other templates.
Identified the positive clones by PCR
Fig. 3 Pancreatic intraepithelial neoplasias 1
This program was supported by CURE Supplement, NCI 2 P30 CA01570435
pTRIPZ sequencing 5’ primer
5’-GGAAAGAATCAAGGAGG-3’
Ability to observe endogenous behavior of KrasG12D in relation to tumor
progression and survival may offer potential opportunities for effective
therapeutic targets