PCR Detection of Microbial Pathogens PCR Detection of Microbial ...

More documents

Recommendations

Info

M. hyopneumoniae Detection 249 Fig. 1. Sampling of air from expectoration of a coughing pig. The device with the filter is held at a distance of 10–20 cm in front of the mouth of a possibly coughing pig, and air is pumped during 1–2 min (courtesy of Dr. Katharina Stärk, IVI, Mittelhäusen). 14. TE buffer: 10 mM Tris-HCl, 1 mM EDTA, pH 8.5. 15. PCIA: phenol:chloroform:isoamylalcohol (49.5:49.5:1; v/v/v). 16. 3M Sodium-acetate, pH 4.5. 17. 80% Ethanol, prechilled in freezer. 18. Instagene matrix (Bio-Rad, Hercules, CA, USA). 19. Oligonucleotide primers, each 10 µM (see Table 1). 20. 10 X PCR buffer: 10 mM Tris-HCl, pH 8.3, 1.5 mM MgCl 2, 50 mM KCl, 0.005% Tween ® 20-detergent. 21. Lysis buffer: 100 mM Tris-HCl, 0.05% Tween 20 detergent, 0.2 mg/mL proteinase K, pH 8.5. 22. 100 mM dATP, 100 mM dCTP, 100 mM dGTP, 100 mM dTTP. 23. Oligonucleotides, 10 µM (see Table 1). 24. Taq DNA polymerase, 5 U/µL. 25. Thermal cycler and corresponding thin-walled tubes for PCR applications. 26. 10X Kinase buffer: 0.5 M Tris-HCl, 0.1 M MgCl 2, 50 mM dithithreitol, 1 mM spermidine HCl, 1 mM EDTA, pH7.6. 27. Bacteriophage T4-polynucleotide kinase (10 U/µL). 28. [γ-32P]ATP (1000 Ci/mmol, 10 µCi/µl).
250 Kobisch and Frey Table 1 Oligonucleotide Primers a Annealing Fragment Name Utilization Sequence 5'–3' direction temperature size Hp1 1 st step L- primer TTCAAATTATAACCTCGGTC 57°C Hp3 1 st step R- primer AGCAAATTTAGTCTCTCTGC 57°C Hp4 2 nd step L- primer CGCTTTAGTACCGATATGGG 58°C 702 bp Hp6 2 nd step R- primer GCCATTCGCTTATATGGTGA 58°C Hp42 hybridization ACTGCCCCAAATGGAACAGG MHP950-1L 1 st step L- primer AGGAACACCATCGCGATTTTTA 52°C MHP950-1R 1 st step R- primer ATAAAAATGGCATTCCTTTTCA 52°C MHP950-2L 2 nd step L- primer CCCTTTGTCTTAATTTTTGAA 52°C 807 bp MHP950-2R 2 nd step R- primer GCCGATTCTAGTACCCTAATCC 52°C a Based on the nucleotide sequence of GenBank Accession no. AF004388 29. 10X SSC buffer, 1X SSC is: 15 mM Na-citrate, 150 mM NaCl. 30. 0.5 M EDTA. 31. Agarose gel equipment including agarose, TBE running buffer (90 mM Tris-base, 90 mM boric acid, 2 mM EDTA, pH 8.3), gel loading buffer, ethidium bromide, DNA size marker, as well as photographic equipment for documentation. For more details see refs. 12 and 13 and other chapters of this volume. 32. Equipment for Southern blot hybridization. 33. Autoradiography film for detection of radioactively labeled DNA probes. 3. Methods The methods described below are aimed at (i) the detection of M. hyopneumoniae in tracheobronchiolar washings; (ii) the detection of M. hyopneumoniae in lung tissue samples; and (iii) the detection of M. hyopneumoniae from air samples from pig housing or expectoration of coughing pigs. 3.1. Detection of M. hyopneumoniae in Tracheobronchiolar Washings 3.1.1. General Remarks Detection of M. hyopneumoniae in tracheobronchiolar washings, done on non-anesthetized pigs, requires some experience in handling with pigs. Lung lavages obtained can be kept frozen until analysis by PCR in the laboratory. After extraction of DNA from the samples (14), detection of M. hyopneumoniae DNA is done preferentially by nested PCR “ABC” with the primer pairs Hp1/ Hp3 and Hp4/Hp6, followed by a detection step involving a radioactively labeled oligonucleotide (see Subheadings 3.4.1., 3.4.2., and 3.4.4.) in order to
Page 1 and 2:
TM Methods in Molecular Biology VOL
Page 3 and 4:
4 Sachse 2. Selection of Target Seq
Page 5 and 6:
Table 1 Target Sequences Used in PC
Page 7 and 8:
8 Sachse Fig. 1. Structural organiz
Page 9 and 10:
10 Sachse proteins (66-68), invasio
Page 11 and 12:
12 Sachse Since there appears to be
Page 13 and 14:
14 Sachse In the context of identif
Page 15 and 16:
16 Sachse to partially compensate t
Page 17 and 18:
18 Sachse nostic potential of PCR.
Page 19 and 20:
20 Sachse product has to be confirm
Page 21 and 22:
22 Sachse 7. van Camp, G., Fierens,
Page 23 and 24:
24 Sachse 33. Rappelli, P., Are, R.
Page 25 and 26:
26 Sachse 60. Furrer, B., Candrian,
Page 27 and 28:
28 Sachse 89. Bloch, W. (1991) A bi
Page 29 and 30:
30 Sachse
Page 31 and 32:
32 Rådström et al. Fig. 1. Illust
Page 33 and 34:
34 Rådström et al. immunoglobulin
Page 35 and 36:
36 Rådström et al. and the captur
Page 37 and 38:
Table 2 Comparison of the Performan
Page 39 and 40:
40 Rådström et al. explain these
Page 41 and 42:
42 Rådström et al. 5.1. Proteins
Page 43 and 44:
44 Rådström et al. neous. Consequ
Page 45 and 46:
46 Rådström et al. 11. Powell, H.
Page 47 and 48:
48 Rådström et al. 39. Katcher, H
Page 49 and 50:
50 Rådström et al. 73. Nagai, M.,
Page 51 and 52:
52 Hoorfar and Cook 2. FOOD-PCR: A
Page 53 and 54:
54 Hoorfar and Cook Fig. 2. Practic
Page 55 and 56:
56 Hoorfar and Cook Fig. 4. The str
Page 57 and 58:
Table 58 3 Hoorfar and Cook Test Co
Page 59 and 60:
60 Hoorfar and Cook The choosing an
Page 61 and 62:
62 Hoorfar and Cook 10. Demanding L
Page 63 and 64:
64 Hoorfar and Cook 15. Anon. (1995
Page 65 and 66:
66 Lübeck and Hoorfar ods for the
Page 67 and 68:
68 Lübeck and Hoorfar amplificatio
Page 69 and 70:
70 Lübeck and Hoorfar It may be ne
Page 71 and 72:
72 Lübeck and Hoorfar specificity
Page 73 and 74:
74 Lübeck and Hoorfar The latter i
Page 75 and 76:
76 Lübeck and Hoorfar A simple che
Page 77 and 78:
78 Lübeck and Hoorfar 13. Hanai, K
Page 79 and 80:
80 Lübeck and Hoorfar 43. Mitchell
Page 81 and 82:
82 Lübeck and Hoorfar 70. Lawrence
Page 83 and 84:
84 Lübeck and Hoorfar 98. Lantz, P
Page 85 and 86:
88 Frey Table 1 Presence of the Var
Page 87 and 88:
90 Frey 13. Lysis buffer: 100 mM Tr
Page 89 and 90:
92 Frey as template for PCR. In add
Page 91 and 92:
94 Frey strains, including all sero
Page 93 and 94:
96 Frey
Page 95 and 96:
98 Ewalt and Bricker (named for the
Page 97 and 98:
100 Ewalt and Bricker 4. Ethidium b
Page 99 and 100:
102 Ewalt and Bricker Primer Cockta
Page 101 and 102:
104 Ewalt and Bricker Fig. 2. Typic
Page 103 and 104:
106 Ewalt and Bricker with betaine
Page 105 and 106:
108 Ewalt and Bricker unused ethidi
Page 107 and 108:
110 Englen et al. which campylobact
Page 109 and 110:
112 Englen et al. 18. Dehydrated cu
Page 111 and 112:
114 Englen et al. 3.1.3. Fecal Samp
Page 113 and 114:
116 Englen et al. respectively), an
Page 115 and 116:
118 Englen et al. Fig. 1. Identific
Page 117 and 118:
120 Englen et al. 3. Goossens, H.,
Page 119 and 120:
122 Englen et al.
Page 121 and 122:
124 Sachse and Hotzel Table 1 Compa
Page 123 and 124:
126 Sachse and Hotzel Table 2 Prime
Page 125 and 126:
128 Sachse and Hotzel 7. Phenol: sa
Page 127 and 128:
130 Sachse and Hotzel 4. Vortex mix
Page 129 and 130:
132 Sachse and Hotzel Fig. 2. Speci
Page 131 and 132:
134 Sachse and Hotzel In the latter
Page 133 and 134:
136 Sachse and Hotzel 17. Longbotto
Page 135 and 136:
138 Popoff spastic paralysis. The g
Page 137 and 138:
Table 3 Primers for Toxin Gene Dete
Page 139 and 140:
142 Popoff 18. Agarose gel loading
Page 141 and 142:
144 Popoff Taq reaction buffer 1X,
Page 143 and 144:
146 Popoff almost all C. perfringen
Page 145 and 146:
148 Popoff 2. Add to each PCR tube
Page 147 and 148:
150 Popoff 7. Hielm, S., Hyyttia, E
Page 149 and 150:
152 Popoff 35. Wieckowski, E., Bill
Page 151 and 152:
154 Berri et al. 2. Materials 1. C.
Page 153 and 154:
156 Berri et al. 3.3.2. Vaginal Swa
Page 155 and 156:
158 Berri et al. Fig. 1. Trans-PCR.
Page 157 and 158:
160 Berri et al. Fig. 3. Sensitivit
Page 159 and 160:
162 Berri et al.
Page 161 and 162:
164 Gallien The first description o
Page 163 and 164:
166 Gallien
Page 165 and 166:
168 Gallien 2. Materials 2.1. Bacte
Page 167 and 168:
170 Gallien 10. Ethidium bromide: 1
Page 169 and 170:
Table 2 Components (in µL) of 25-
Page 171 and 172:
Table 4 Components (in µL) of 25-
Page 173 and 174:
176 Gallien 3.3. Specific Isolation
Page 175 and 176:
Table 6 PCR Conditions for Subtypin
Page 177 and 178:
180 Gallien Fig. 3. Photographic im
Page 179 and 180:
182 Gallien 3. Boyce, T. G., Swerdl
Page 181 and 182:
184 Gallien enteropathogenic E. col
Page 183 and 184:
186 O'Connor This chapter will desc
Page 185 and 186:
188 O'Connor 2.2. PCR of Enriched F
Page 187 and 188:
190 O'Connor 4. Notes 1. In enrichi
Page 189 and 190:
192 O'Connor 4. O’Sullivan, N., F
Page 191 and 192:
194 Lester and LeFebvre titers (4).
Page 193 and 194:
196 Lester and LeFebvre 3.1.2. Samp
Page 195 and 196: Fig. 1. Sensitivity of the PCR assa
Page 197 and 198: 200 Lester and LeFebvre 5. Swart, K
Page 199 and 200: 202 Skuce et al. Table 1 Significan
Page 201 and 202: 204 Skuce et al. commercial kits. E
Page 203 and 204: 206 Skuce et al. Fig. 1. Schematic
Page 205 and 206: 208 Skuce et al. 5. Disposable ster
Page 207 and 208: 210 Skuce et al. 2.5.2. Sequence An
Page 209 and 210: 212 Skuce et al. 2. Carefully trans
Page 211 and 212: Table 4 Recommended PCR Amplificati
Page 213 and 214: 216 Skuce et al. Fig. 3. PCR produc
Page 215 and 216: 218 Skuce et al. Fig. 5. Spoligotyp
Page 217 and 218: 220 Skuce et al. 14. Aranaz, A., Li
Page 219 and 220: 222 Skuce et al.
Page 221 and 222: 224 Khan Simultaneous detection of
Page 223 and 224: 226 Khan 10. Incubate for 20 min at
Page 225 and 226: 228 Khan 5. Periodically, multiplex
Page 227 and 228: 230 Khan
Page 229 and 230: 232 Hotzel et al. tis (2). Particul
Page 231 and 232: 234 Hotzel et al. 8. Sodium dodecyl
Page 233 and 234: 236 Hotzel et al. 3. Methods 3.1. D
Page 235 and 236: 238 Hotzel et al. 3.1.5. Semen (see
Page 237 and 238: 240 Hotzel et al. Fig. 1 Detection
Page 239 and 240: 242 Hotzel et al. 4. Notes 1. The u
Page 241 and 242: 244 Hotzel et al. in Mycoplasma Pro
Page 243 and 244: 246 Hotzel et al.
Page 245: 248 Kobisch and Frey PCR assay to d
Page 249 and 250: 252 Kobisch and Frey 3.2.1. Prepara
Page 251 and 252: 254 Kobisch and Frey First round of
Page 253 and 254: 256 Kobisch and Frey References 1.
Page 255 and 256: 258 Christensen et al. thrombotic m
Page 257 and 258: 260 Christensen et al. Table 1 Spec
Page 259 and 260: Table 2 Oligonucleotide Primers for
Page 261 and 262: 264 Christensen et al. 3.2. Extract
Page 263 and 264: Table 3 PCR Protocols for the Patho
Page 265 and 266: 268 Christensen et al. 2. Apply fra
Page 267 and 268: 270 Christensen et al. 7. To reduce
Page 269 and 270: 272 Christensen et al. 24. Fisher,
Page 271 and 272: 274 Christensen et al. 54. Hunt, M.
Page 273 and 274: 276 Malorny and Helmuth valent meta
Page 275 and 276: 278 Malorny and Helmuth 12. Apparat
Page 277 and 278: 280 Malorny and Helmuth 3.3. Amplif
Page 279 and 280: 282 Malorny and Helmuth Table 2 Vol
Page 281 and 282: 284 Malorny and Helmuth Table 4 PCR
Page 283 and 284: 286 Malorny and Helmuth 3. Wallace,
Page 285 and 286: 288 Malorny and Helmuth
Page 287 and 288: 290 Wastling and Mattsson is an imp
Page 289 and 290: 292 Wastling and Mattsson 2. Remove
Page 291 and 292: 294 Wastling and Mattsson Fig. 1. B
Page 293 and 294: 296 Wastling and Mattsson time PCR
Page 295 and 296: 298 Wastling and Mattsson
Page 297 and 298:
300 Pozio and La Rosa Table 1 Princ
Page 299 and 300:
302 Pozio and La Rosa regions; spot
Page 301 and 302:
304 Pozio and La Rosa 3. Proteinase
Page 303 and 304:
306 Pozio and La Rosa Table 3 PCR-R
Page 305 and 306:
308 Pozio and La Rosa 2. Pepsin sho
Page 307 and 308:
310 Pozio and La Rosa
Page 309 and 310:
312 Knutsson and Rådström The ref
Page 311 and 312:
314 Knutsson and Rådström Fig. 1.
Page 313 and 314:
316 Knutsson and Rådström 2.4. El
Page 315 and 316:
318 Knutsson and Rådström the swa
Page 317 and 318:
320 Knutsson and Rådström Fig. 3.
Page 319 and 320:
322 Knutsson and Rådström 4. Alek
Page 321:
324 Knutsson and Rådström 34. Hee
show all

PCR Detection of Microbial Pathogens PCR Detection of Microbial ...

Create successful ePaper yourself

Delete template?

Save as template?