Harpers

346 / CHAPTER 37coordinately regulated. One important way that this isaccomplished is through the fact that these co-regulatedgenes share unique −35 and −10 promoter sequences.These unique promoters are recognized by different σfactors bound to core RNA polymerase.Rho-dependent transcription termination signalsin E coli also appear to have a distinct consensus sequence,as shown in Figure 37–6. The conserved consensussequence, which is about 40 nucleotide pairs inlength, can be seen to contain a hyphenated or interruptedinverted repeat followed by a series of AT basepairs. As transcription proceeds through the hyphenated,inverted repeat, the generated transcript can formthe intramolecular hairpin structure, also depicted inFigure 37–6.Transcription continues into the AT region, andwith the aid of the ρ termination protein the RNApolymerase stops, dissociates from the DNA template,and releases the nascent transcript.Eukaryotic Promoters Are More ComplexIt is clear that the signals in DNA which control transcriptionin eukaryotic cells are of several types. Twotypes of sequence elements are promoter-proximal. Oneof these defines where transcription is to commencealong the DNA, and the other contributes to the mechanismsthat control how frequently this event is to occur.For example, in the thymidine kinase gene of the herpessimplex virus, which utilizes transcription factors of itsmammalian host for gene expression, there is a singleunique transcription start site, and accurate transcriptionfrom this start site depends upon a nucleotide sequencelocated 32 nucleotides upstream from the start site (ie, at−32) (Figure 37–7). This region has the sequence ofTATAAAAG and bears remarkable similarity to thefunctionally related TATA box that is located about 10bp upstream from the prokaryotic mRNA start site (Figure37–5). Mutation or inactivation of the TATA boxmarkedly reduces transcription of this and many othergenes that contain this consensus cis element (see Figures37–7, 37–8). Most mammalian genes have a TATA boxthat is usually located 25–30 bp upstream from the transcriptionstart site. The consensus sequence for a TATAbox is TATAAA, though numerous variations have beencharacterized. The TATA box is bound by 34 kDaTATA binding protein (TBP), which in turn binds severalother proteins called TBP-associated factors(TAFs). This complex of TBP and TAFs is referred to asTFIID. Binding of TFIID to the TATA box sequence isthought to represent the first step in the formation of thetranscription complex on the promoter.A small number of genes lack a TATA box. In suchinstances, two additional cis elements, an initiator sequence(Inr) and the so-called downstream promoterelement (DPE), direct RNA polymerase II to the promoterand in so doing provide basal transcription startingfrom the correct site. The Inr element spans the startDirection of transcriptionCoding strand 5′Template strand 3′AGCCCGCTCGGGCGGCGGGCTCGCCCGATTTTTTTTAAAAAAAA3′DNA5′Coding strand 5′Template strand 3′5′AGCCCGCGGGCGTTTTTTTTAAAAAAAAU U UUUUUU-3′UCRNA transcript3′5′DNAFigure 37–6. The predominant bacterial transcription termination signal contains an inverted, hyphenated repeat(the two boxed areas) followed by a stretch of AT base pairs (top figure). The inverted repeat, when transcribedinto RNA, can generate the secondary structure in the RNA transcript shown at the bottom of the figure.Formation of this RNA hairpin causes RNA polymerase to pause and subsequently the ρ termination factor interactswith the paused polymerase and somehow induces chain termination.