Molecular Characterization and Gene Expression Profiling ... - CUSAT

186 S.P. Antony et al. / Immunobiology 216 (2011) 184–194
Table 3
Primers used for the study.
ORF/gene Primer sequence (5 ′ –3 ′ ) Annealing temp. ( ◦ C) Amplicon size (bp) References
Crustin F – tgttcccacgacttcaagtgtgc 60 299 Chen et al. (2004)
R – caaagattcaactaaataaacag
�­actin F – cttgtggttgacaatggctccg 60 520 Zhang et al. (2007)
R – tggtgaaggagtagccacgctc
18S rRNA F – ttgtacgaggatcgagtgga 52 350 Supungul et al. (2004)
R – atgctttcgcagtaggtcgt
Latency related gene F – cttgtgggaaaagggtcctc 53 647 Liu et al. (2005)
R – tcgtcaaggcttacgtgtcc
VP28 F – ctgctgtgattgctgtattt 54 555 Liu et al. (2005)
R – cagtgccagagtaggtgac
DNA polymerase F – tgggaagaaagatgcgagag 54 586 Liu et al. (2005)
R – ccctccgaacaacatctcag
Endonuclease F – tgacgaggaggattgtaaag 50 408 Liu et al. (2005)
R – ttatggttctgtatttgagg
Thymidine kinase F – gagcagccatacgggtaaac 54 412 Liu et al. (2005)
R – gcgagcgtctaccttaatc
Protein kinase F – tggagggtggggaccaacggacaaaac 55 512 Liu et al. (2005)
R – caaattgacagtagagaattttgcac
Ribonucleotide reductase F – atctgctagtccctgcacac 53 408 Liu et al. (2005)
R – aaagaggtggtgaaggcacg
Table 4
Result of BLAST analysis of crustin­like AMP nucleotide (FJ535568).
Closest species Accession number E­value % identity
Farfantepenaeus paulensis EF182747 1e−31 94%
Litopenaeus vannamei AF430072 5e−31 94%
Farfantepenaeus subtilis EF450744 7e−30 93%
Farfantepenaeus brasiliensis EF601055 7e−30 93%
the intermoult stage were sampled during the study. On the 15th
day all the groups were challenged with WSSV by feeding WSSV
infected P. monodon tissue at the rate of 1 g/animal. The animals
were maintained on their respective diets post­challenge WSSV.
After 48 h five animals each from all the groups were sampled for
the gene expression analysis.
Haemolymph and tissue collection
Haemolymph was collected from the rostral sinus using specially
designed capillary tubes (RNase­free) rinsed using pre­cooled
anticoagulant solution (RNase­free, 10% sodium citrate, pH 7.0).
Tissues including gill, muscle, heart, hepatopancreas and intestine
were collected. Haemolymph and the tissues were suspended in
TRI reagent (Sigma) for total RNA isolation.
Total RNA isolation and reverse transcription
Total RNA was extracted from the haemocytes and the target tissues
using TRI Reagent (Sigma) following manufacture’s protocol.
RNA was quantified and the purity was checked by spectrophotometry
at 260 and 280 nm. Only RNAs with absorbance ratio
(A 260:A 280) ≥ 1.8 were used for further experiments. First strand
cDNA was generated in a 20 �l reaction volume containing 5 �g
total RNA, 1× RT buffer, 2 mM dNTP, 2 �M oligo d(T 20), 20 U of
RNase inhibitor and 100 U of M­MLV reverse transcriptase (New
England Biolabs, USA). The reaction was conducted at 42 ◦ C for 1 h
followed by an inactivation step at 85 ◦ C for 15 min.
Semi­quantitative RT­PCR analysis of gene expression
Expression of the target gene when supplemented with different
immunostimulants was determined by semi­quantitative
RT­PCR analysis using �­actin and 18S rRNA as the internal
control pre and post­challenge WSSV (Marone et al. 2001).
PCR amplification of 1 �l of cDNA was performed in a 25 �l
reaction volume containing 1× Standard Taq buffer (10 mM
Tris–HCl, 50 mM KCl, pH 8.3), 3.5 mM MgCl 2, 200 �M dNTPs,
0.4 �M each primer and 1 U Taq DNA polymerase (New England
Biolabs). Amplification was performed using the target
gene primers, Crustin (Forward – 5 ′ ­tgttcccacgacttcaagtgtgc­3 ′ and
Reverse – 5 ′ ­caaagattcaactaaataaacag­3 ′ ) and �­actin (Forward –
Fig. 1. Nucleotide and amino acid sequences of crustin­like AMP from the haemocyte of the Giant tiger shrimp, Penaeus monodon (GenBank accession no. FJ535568). Asterisk
indicates stop codon.