03.04.2013 Views

1. Raportul Stiintific si Tehnic (RST) in extenso al proiectului cu titlul ...

1. Raportul Stiintific si Tehnic (RST) in extenso al proiectului cu titlul ...

1. Raportul Stiintific si Tehnic (RST) in extenso al proiectului cu titlul ...

SHOW MORE
SHOW LESS

You also want an ePaper? Increase the reach of your titles

YUMPU automatically turns print PDFs into web optimized ePapers that Google loves.

Clarificare<br />

• imersare lame <strong>in</strong> xilen 2 x 10 m<strong>in</strong>.<br />

Montare <strong>in</strong> B<strong>al</strong>sam de Canada (lamele umede)<br />

Anticorpi<br />

Anti- human CD95, APO-1, Fas<br />

Clona APO-1 Dako<br />

Dilutie 1/200<br />

Biot<strong>in</strong> conjugated goat anti mouse immunoglobul<strong>in</strong> specific polyclon<strong>al</strong> antibody<br />

PharM<strong>in</strong>gen Internation<strong>al</strong><br />

Dilutie 1/200<br />

Solutie ABC Compplex/HRP<br />

Dako<br />

Anti- human tumor necro<strong>si</strong>s factor soluble receptor I (sTNF RI)<br />

Clona 16803.1<br />

1/100<br />

(la care ABII tot 1/100)<br />

Sigma<br />

Anexa 6. Protocol de recoltare de produse biologice (sange) de la pacienti <strong>si</strong> apart<strong>in</strong>atori<br />

(rude) <strong>in</strong>rolate <strong>in</strong> proiectul CAPMAT 42-105 / 2008<br />

Anexa 7. Primeri <strong>in</strong>vestigate ca fi<strong>in</strong>d de utilizat pentru MSI <strong>in</strong> proiectul CAPMAT / 42-105<br />

D13S171<br />

Forward primer: CCTACCATTGACACTCTCAG<br />

Reverse primer: TAGGGCCATCCATTCT<br />

D13S267

Hooray! Your file is uploaded and ready to be published.

Saved successfully!

Ooh no, something went wrong!