01. Gene therapy Boulikas.pdf - Gene therapy & Molecular Biology

More documents

Recommendations

Info

eferred to as the SNE (SRF/NF-κB-like element), as well as four classical NF-κB sites within the human CMV promoter, contributed to TPA responsiveness; the SNE sites of the simian CMV promoter contain potential overlapping core recognition binding motifs for SRF, Rel/ NF-κB, ETS, and YY1 class transcription factors but fail to respond to either serum or tumor necrosis factor α; the TPA responsiveness of both human and simian CMV elements proved to involve synergistic interactions between the core SRF binding site (CCATATATGG) and the adjacent inverted ETS binding motifs (TTCC TTCC), which correlated directly with formation of a bound tripartite complex containing both the cellular SRF and ELK-1 proteins. This protein complex was more abundant in U- 937, K-562, and HeLa cell extracts than in Raji, HF, Boulikas: An overview on gene therapy 34 BALB/c 3T3, or HL-60 cells. A 40-fold stimulation of chloramphenicol acetyltransferase activity mediated by four tandem repeats of the SNE could be induced within 2 h (and up to 250-fold within 6 h) after addition of TPA in DNA-transfected U-937 cells, indicating that the stimulation appeared likely to be a true protein kinase Cmediated signal transduction event rather than a differentiation response (Chan et al, 1996). These studies demonstrate that different cell types are expected to sustain different levels of expression from CMV and that, for cell culture transfections, PKC transduction pathways are likely to stimulate transgene expression from CMV promoters. These findings have important implications for promoter choice in gene therapy. 7TCAATATTGGCCATTAGCCATATTATTCATTGGTTATATAGCATAAATCAATATTGGC TATTGGCCATTGCATACGTTGTATCTATATCATAATATGTACATTTATATTGGCTCATGTC CAATATGACCGCCATGTTGGCATTGATTATTGACTAGTTATTAATAGTAATCAATTACGG GGTCATTAGTTCATAGCCCATATATGGAGTTCC TTCCGCGTTACATAACTTACGGTAAATGGCC CGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCA TAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACT GCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTCCGCCCCCTAttgacgtcaaTGACG GTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTACGGGACTTTCCTACTTGGC AGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACACCA ATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCA ATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAATAACCCC GCCCCGTTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGC TCGTTTAGTGAACCGTCAGATCACTAGAAGCTTTATTGCGGTAGTTTATCACAGTTAAATT GCTAACGCAGTCAGTG803 Figure 13A. The CMV promoter sequence from plasmid pRL-CMV, 4079 bp (nucleotides 7-803, Promega) (LOCUS AF025843) 37TCTGCTTATATAGACCTCCCACCGTACACGCCTACCGCCCATTTGCGTCAATGGGGC GGAGTTGTTACGACATTTTGGAAAGTCCCGTTGATTTTGGTGCCAAAACAAACTCCCATT GACGTCAATGGGGTGGAGACTTGGAAATCCCCGTGAGTCAAACCGCTATCCACGCCCAT TGATGTACTGCCAAAACCGCATCACCATGGTAATAGCGATGACTAATACGTAGATGTACT GCCAAGTAGGAAAGTCCCATAAGGTCATGTACTGGGCATAATGCCAGGCGGGCCATTTA CCGTCATTGACGTCAATAGGGGGCGTACTTGGCATATGATACACTTGATGTACTGCCAA GTGGGCAGTTTACCGTAAATACTCCACCCATTGACGTCAATGGAAAGTCCCTATTGGCGT TACTATGGGAACATACGTCATTATTGACGTCAATGGGCGGGGGTCGTTGGGCGGTCAGCC AGGCGGGCCATTTACCGTAAGTTATGTAACGCGGAACTCCATATATGGGCTATGAACTAA TGACCCCGTAATTGATTACTATTAATAACTAGTCAATAATCAATGTCAACATGGCGGTAA TGTTGGACATGAGCCAATATAAATGTACATATTATGATATGGATACAACGTATGCAATGG GCCAA695 Figure 13B. The CMV IE promoter (nucleotides 37-695, 658 bp) from the expression vector pCMVtkLUC + (ACCESSION AF027129). ttgacgtcaa is the binding site of HB16; GGGACTTTCC is the binding site for HIVEN 86A (two sites); CCATATATGG is the SRF binding site; TTCC is the ETS core motif; three CATTGACG motifs in each sequence are in bold-face (see Boulikas, 1994 for more references).
A closely related family of ubiquitous DNA binding proteins, called MDBP, binds with high affinity to two 14 base pair (bp) sites within the human cytomegalovirus immediate early gene 1 (CMV IE1) enhancer; these MDBP sites did not require cytosine methylation for optimal binding; mutation of one of the enhancer MDBP sites to prevent MDBP recognition modestly increased the function of a neighboring CREB binding site in a transient transfection assay (Zhang et al, 1995). Furthermore, the CMV promoter competed with the Egr1 promoter for transcription factors or co-factors which might be required for activation by WT1; WT1 was converted from an activator to a repressor by co-transfection of an excess of the parental CMV-based vector (Reddy et al, 1995). C. Tissue-specific promoters in gene therapy A number of studies have used tissue-specific promoters and enhancers from mammalian genes in order to attain a cell type-specific expression of the transgene. The discovery of genes which are expressed at high levels in specific tumor cell types has prompted the idea of the use of their promoter or enhancer DNA sequences to express in this particular cancer cell type therapeutically important genes (Venkatesh et al, 1990; Brady et al, 1994; Dimaio et al, 1994; Osaki et al, 1994; Pang et al, 1995). Examples include the expression of the suicidal CD gene under control of the regulatory regions of the tumor marker gene carcinoembryonic antigen (Richards et al, 1995), the expression of HSV-tk gene, under control of αfetoprotein enhancer and albumin promoter, into adult liver cells in transgenic animals (Su et al, 1996), the expression of β-galactosidase in tyrosine hydroxylaseexpressing neurons in the substantia nigra midbrain of adult rats using the tyrosine hydroxylase promoter (Song et al, 1997), and the expression of the lacZ marker gene under control of the murine pancreatic amylase promoter in the pancreas in neonatal and adult mice (Dematteo et al, 1997). Transduction of the human LDL-R cDNA under the transcriptional control of the liver-type pyruvate kinase promoter allowed high and tissue specific expression of the gene in primary hepatocytes (Pages et al, 1996b). Fibroblasts, infected with recombinant retroviruses and selected with G418 for the expression of the vector carrying the therapeutic gene, have been used for the ex vivo treatment in animal models; when the therapeutic gene was either under control of the viral LTR or an heterologous internal promoter, expression of the transgene from the integrated retrovirus was shut off (Scharfmann et al, 1991). The use of the dihydrofolate reductase housekeeping gene promoter which is expressed in all cell types, led to sustained expression, albeit at very low levels (Scharfmann et al, 1991); it appears that the Gene Therapy and Molecular Biology Vol 1, page 35 35 combination of a suitable enhancer and promoter for a particular cell type and the method of introduction of the transgene is crucial for sustained expression. Combination of the mouse muscle creatine kinase enhancer with the human cytomegalovirus promoter to drive the expression of the canine factor IX gene in ex vivo infected mouse primary myoblasts led to the expression of factor IX and its secretion in the blood of mice transplanted with these myoblasts for over 6 months; however, the levels of factor IX protein secreted into the plasma (10 ng/ml for 10 7 injected cells) were not sufficient to be of therapeutic value (Dai et al, 1992). Joki and coworkers (1995) have used the promoter of the early growth response gene 1 (EGR-1, also known as Zif/268, TIS-8, NFGI-A, or Krox-24) to confer selective expression of the luciferase gene in glioma cell lines exposed to ionizing radiation; a 10-fold higher activity in luciferase activity was found after irradiation of the cells which was detectable at 1-3 h after stimulation with 20 Gy (stereotactic radiosurgery during treatment of isolated brain metastases, arteriovenous malformations, meningiomas, craniopharyngiomas, and glioblastomas uses a single dose of 20-30 Gy). Transfection of the HSVtk gene under control of the EGF-1 promoter rendered irradiated, but not nonirradiated, cells sensitive to GCV. Irradiation induces DNA repair, cell cycle arrest, and reinitiation of DNA synthesis in surviving cells; γradiation also induces higher levels of a number of proteins including p53, AP-1, NF-κB, TNF, IL-1, and EGF-1. Therefore, use of the EGF-1 promoter can activate gene expression selectively in radiation fields and could be used to drive the expression of cytotoxic genes (HSV-tk) for the killing of cancer cells. Peptides containing the three zinc fingers of Zif268 could efficiently repress activated transcription from promoter constructs prepared with Zif268 binding sites inserted at various positions with respect to the TATA box (Kim and Pabo, 1997); such strategies could find important applications in gene therapy leading to construction of artificial promoters able to activate or repress transcription of transferred genes. A potent hybrid CAG promoter was used to drive the HSV-tk gene and showed effective eradication of pancreatic tumors in animal xenografts (Aoki et al, 1997). D. Molecular switch systems The ability to regulate gene expression via exogenous stimuli will facilitate the study of gene functions in mammalian cells. Molecular switch systems have been devised (Wang et al, 1994) allowing the researcher to turn on or off individual genes; the switch used by Delort and Capecchi (1996) is composed of three elements: (i) the inducible UAS promoter, a synthetic promoter containing
Page 1 and 2: Gene Ther Mol Biol Vol 1, 1-172. Ma
Page 3 and 4: I. Introduction Monumental progress
Page 5 and 6: The use of retroviral vectors in hu
Page 7 and 8: displaying the cleavable EGF domain
Page 9 and 10: molecules in the nucleus (Lowe and
Page 11 and 12: sensitive mutations which allow pro
Page 13 and 14: processed as described in panel A s
Page 15 and 16: On the contrary, the payload capaci
Page 17 and 18: in K562 human erythroleukemia cells
Page 19 and 20: defective HSV virus (DeLuca and Sch
Page 21 and 22: complex into the cytosol from the e
Page 23 and 24: Gene Therapy and Molecular Biology
Page 25 and 26: delivered by Sendai virus-liposome
Page 27 and 28: plasmids with the cell surface, tra
Page 29 and 30: infected by adenovirus alone; infec
Page 33: B. Transcription factor binding sit
Page 37 and 38: cells. I-CreI is a member of this c
Page 41 and 42: C. Considerations of chromatin stru
Page 45 and 46: A. The molecular basis of cancer im
Page 47 and 48: fragments, or heat shock proteins c
Page 49 and 50: ecombinant vaccinia virus expressin
Page 51 and 52: HIV-1 envelope DNA construct develo
Page 53 and 54: inding sites A GYYY oriented in opp
Page 57 and 58: Prives, 1994). Whereas the wild-typ
Page 59 and 60: mutant p53 (mutations on p53 are wi
Page 61 and 62: master regulator of the cell cycle
Page 63 and 64: Work from several groups has shown
Page 65 and 66: chromatin condensation, drop in pH,
Page 67 and 68: Figure 23. A pathway leading to the
Page 69 and 70: Excessive necrotic death in cells o
Page 71 and 72: implantation, and similar processes
Page 73 and 74: normal cells in the surroundings. T
Page 79 and 80: A bicistronic retroviral vector (Ha
Page 81 and 82: C. Antisense ras gene transfer for
Page 83 and 84: equal to 6.0 showed S1 hyperreactiv
Page 85 and 86:
protein (e.g. Smith et al, 1995; Fo
Page 87 and 88:
transduced primary mouse fibroblast
Page 89 and 90:
IL-1 - receptor antagonist protein
Page 91 and 92:
p53 lung cancer retroviru s MHC cla
Page 93 and 94:
Gene Therapy and Molecular Biology
Page 95 and 96:
designed by immunization with porti
Page 97 and 98:
Isolation of an RNA aptamer that ca
Page 99 and 100:
induction of human apoE in neonate
Page 101 and 102:
atrium in heart, endothelial cells
Page 103 and 104:
which eliminated tumors in small an
Page 105 and 106:
C. Transfer of other genes against
Page 107 and 108:
Page 109 and 110:
significant reduction in neointima
Page 111 and 112:
(Prehn et al, 1996); this implies a
Page 113 and 114:
B. Approaches to gene therapy of RA
Page 115 and 116:
of human immunoglobulin and antigen
Page 117 and 118:
A. Etiology and mechanisms of destr
Page 119 and 120:
Page 121 and 122:
However, CsA also inhibits the acti
Page 123 and 124:
The peptide kinin, after binding to
Page 125 and 126:
intake when administered to adrenal
Page 127 and 128:
Introgen Therapeutics (Austin and H
Page 129 and 130:
When a subfragment of only 513 bp o
Page 131 and 132:
Armentano D, Zabner J, Sacks C, Soo
Page 133 and 134:
Brady HJM, Miles CG, Pennington DJ,
Page 135 and 136:
Chen J, Stickles RJ, Daichendt KA (
Page 137 and 138:
Day ML, Wu S, Basler JW (1993) Pros
Page 139 and 140:
Farmer G, Bargonetti J, Zhu H, Frie
Page 141 and 142:
Giovannangeli C, Perrouault L, Escu
Page 143 and 144:
the neoplastic phenotype by replace
Page 145 and 146:
integrate in a site-specific fashio
Page 147 and 148:
Li R, Waga S, Hannon GJ, Beach D, S
Page 149 and 150:
adiation-induced apoptosis in the g
Page 151 and 152:
Nakaya T, Iwai S, Fujinaga K, Sato
Page 153 and 154:
Polyak K, Xia Y, Zweier JL, Kinzler
Page 155 and 156:
macrophages from simian immunodefic
Page 157 and 158:
intimal hyperplasia in a rat caroti
Page 159 and 160:
Trono D, Feinberg MB, Baltimore D (
Page 161 and 162:
Wattiaux R, Jadot M, Warnier-Pirott
Page 163 and 164:
similar to mammalian interleukin-1
Page 165 and 166:
Page 167 and 168:
24. Gene Marking /Infectious Diseas
Page 169 and 170:
Drug 50. Gene Therapy /Phase I /Can
Page 171 and 172:
76. Gene Therapy /Phase I /Cancer /
Page 173 and 174:
99. Gene Therapy /Phase II /Cancer
Page 175 and 176:
120. Gene Therapy /Phase I /Monogen
Page 177 and 178:
Page 179 and 180:
cancer not specified) /Immunotherap
show all

01. Gene therapy Boulikas.pdf - Gene therapy & Molecular Biology

Create successful ePaper yourself

Delete template?

Save as template?