Abstract Book of EAVLD2012 - eavld congress 2012

Recommendations

Info

S3 - P - 09 PRELIMINARY VALIDATION OF A SOLID- PHASE COMPETITIVE ELISA FOR THE DETECTION OF ANTIBODIES AGAINST WEST NILE DISEASE VIRUS IN HORSE SERA G. L. Autorino 1 , A. Caprioli 1 , F. De Simone 2 , R. Frontoso 1 , D. Lelli 2 , R. Nardini 1 , F. Rosone 1 , M. T. Scicluna 1 . 1 National Reference Centre for Equine Infectious Diseases, Istituto Zooprofilattico Sperimentale Lazio e Toscana, 00178 Roma Italia. 2 Istituto Zooprofilattico Sperimentale Emilia Romagna e Lombardia, Via A. Bianchi 9, 25124 Brescia Italia Keywords: West Nile Disease, serological diagnosis, competitive elisa, validation Introduction In 1998, Italy reported the first equine outbreaks of West Nile Disease (WND). From 2001, a national veterinary surveillance system was adopted in areas considered at risk of WNV introduction, based on the passive surveillance of avian mortality and on the repeated serological testing of sentinel horses first in screening ELISA tests available commercially, either in a competitive format or based on the detection of IgG and IgM. Positive samples are then examined in the confirmatory test represented by the plaque neutralization reduction test. A solidphase competitive ELISA was developed and a preliminarily validation was carried by an interlaboratory trial. The data of the this preliminary validation is presented and discussed. Materials & methods The procedure for the competitive ELISA (C-ELISA), object of this validation, is briefly described as follows. 96 well microplate are pre-adsorbed with a monoclonal antibody (Mab), recognising the domain III (Ed III) of WND virus (WNDV), are prepared ready for use. The reaction is started by the addition of the antigen, a cell-culture cryolysate of inactivated virus, on to the plate and its incubation for 90 minutes at 37°C. In parallel to the first incubation, serum samples and controls are diluted 1:5 and 1:10 on a separate plate. The samples and controls are then transferred on the adsorbed plate containing the antigen and incubated for 60 minutes at 37°C. After washing the plate, the same Mab used for adsorption is added conjugated with horseradish peroxidase. Following another incubation period of 90 minutes at 37°C, ortophenyl-diamine substrate is added and the plate is incubated at room temperature for 15 minutes in the dark. Sulphuric acid is used to stop the enzymatic reaction, which is read using an optical density (OD) of 492nm. Sera are categorized as positive or negative according to percentage inhibition (PI), calculated as the ratio between sample and reaction control. Validation was performed according to WOAH Manual guidelines. The aim for this ELISA test is for screening purposes. Nine laboratories were involved in this validation. Pre-adsorbed plates, reagents (Mab and antigen) and a panel of sera were sent to each of them. The latter was made up of 20 sera, each replicated twice, and numbered from 1 to 40. The panel derived from the sera of five horses, two experimentally infected, two repeatedly vaccinated and one negative. The order of the sera was different for each laboratory. Each participant was requested to carry out the test three times, each time carried out by a different operator and on different days. The OD of each test was registered and returned in an Excel file. Validation criteria for the ELISA were the following: mean OD of control reaction higher than 1.0; OD of negative control < 50% of OD of control reaction for both dilutions; OD of positive control > 50% of OD of control reaction in both dilutions. Runs that did not comply with these criteria were discarded. In analysing all data the following parameters were estimated: Qualitative accuracy, estimated by: Sensitivity (Se) and specificity (Sp), Cohen K value for each laboratory, Weighted Cohen K value for each laboratory, Cohen K value for all laboratories gathered together. K values were calculated by comparing the expected results, positive and negative, with those obtained, for Cohen K value and negative, weak, medium and strong positive for Cohen K value and weighted Cohen K value. In considering both qualitative and semi-quantitative characteristics of the ELISA test, repeatability and reproducibility were estimated using the following parameters: Coefficient of variation (CV), Accordance, Concordance, Concordance Odds Ratio (COR), K value of all laboratories results gathered together. For details regarding the calculation of these parameters, articles by Langton et al., Quatto and Soliani et al. can be consulted (1,2,3,4). Results 1.Both sensitivity and specificity resulted 100%. 2.K values are shown in figure 1. K for all laboratories resulted equal to 0.76. K VALUE 1,2 1 0,8 0,6 0,4 0,2 0 K (2 cat.) WEIGHTED K (4 cat.) K(4 cat.) LAB 1 LAB 2 LAB 3 LAB 4 LAB 5 LAB 6 LAB 7 LAB 8 LAB 9 Figure 1: K values for each laboratory: not weighted with 2 and 4 categories, and weighted with two categories. 3.Values of accordance, concordance and COR are showed in table 1. Table 1: Values of Accordance, concordance and COR for each serum and all laboratories together Serum N° Accordance Concordance COR Serum N° Accordance Concordance COR 1 86,71 81,75 1,46 11 62,14 45,11 2,00 2 95,29 95,24 1,01 12 75,43 74,87 1,03 3 92,43 90,48 1,29 13 64,00 41,27 2,53 4 100 100 1 14 66,86 52,78 1,80 5 76,29 56,88 2,44 15 100 100 1 6 95,29 95,24 1,01 16 100 100 1 7 65,86 49,74 1,95 17 100 100 1 8 86,71 81,75 1,46 18 100 100 1 9 100 100 1 19 100 100 1 10 100 100 1 20 100 100 1 K value of all laboratories together not compared with expected results resulted equal to 0.72. Discussion & conclusions From the results of the evaluated parameters the test is suitable for screening purposes. Accuracy is highly satisfactory since sensitivity and specificity resulted equal to 100%. Furthermore, K values indicate a degree of concordance almost perfect according to the classification of Landis et al. (5) Qualitative repeatability and reproducibility are also satisfactory since CV values are all less than 20%, value set as acceptable limit; accordance and concordance are also close to 100% in more than the half of sera. COR resulted very close to 1 for all sera except for two of them, however with a maximum value of 2.53. An additional advantage of this c-ELISA is that it can be extended to the testing of other species for which it has to be validated. To fulfil the remaining criteria set by WOAH, a second phase of the validation procedure is necessary in which further parameters need to be evaluated, among which are the performances of this test on field samples. References 1.S.D. Langton et al ” Analysing collaborative trials for qualitative microbiological methods: accordance and concordance”, International Journal of Food Microbiology 79 (2002) 175-181 2.http:/www.dsa.unipr.it/soliani/soliani.html 3.J. Richard Landis e Gary G. Koch del 1977 “The measurement of observer agreement for categorial data” Biometrics, Vol. 33, pp.159-174. 4.P. Quatto (2004). “Un test di concordanza tra più esaminatori”. In: Statistica, vol. 64, n. 1, pp. 145-151 5.J. Richard Landis e Gary G. Koch del 1977 “The measurement of observer agreement for categorical data” Biometrics, Vol. 33, pp.159-174.
S3 - P - 10 SIMULTANEOUS DETECTION AND DIFFERENTIATION OF INFLUENZA A VIRUS AND NEWCASTLE DISEASE VIRUS BY ONE STEP RT-PCR. D. Nidzworski 1 , L. Rabalski 1 , B. Szewczyk 1 , K. Śmietanka 2 , Z. Minta 2 1 Intercollegiate Faculty of Biotechnology University of Gdansk and Medical University of Gdansk, Department of Molecular Virology, Gdansk, Poland 2 National Veterinary Research Institute in Pulawy, Department of Poultry Diseases, Pulawy, Poland Influenza virus, Newcastle disease virus, diagnosis, RT-PCR, Introduction Newcastle disease Virus (NDV), a member of the Paramyxoviridae family and Influenza A virus (IAV), from the Orthomyxoviridae family, are two main avian pathogens causing serious economic problems in poultry farming (3,4). NDV strains are classified into three major pathotypes: velogenic, mesogenic and lentogenic (2). Avian Influenza (AI) viruses are also divided into low pathogenic (LPAI) and highly pathogenic (HPAI) strains (1).Both viruses are enveloped, single stranded, negative-sense RNA viruses which give similar symptoms ranging from subclinical infections to severe disease, including loss in egg production, acute respiratory syndrome and high mortality, depending on their level of pathogenicity. This hinders the diagnosis based on clinical and post mortem examination only. Most of the currently available molecular detection methods are also pathogen-specific and require to perform more than one RT- PCR to confirm or exclude the presence of both pathogens. To overcome this disadvantage, we have applied One Step Duplex RT-PCR method to distinguish between those two pathogens. The main objective of the project was to develop new, fast and non-expensive method, which could be used in any veterinary laboratory. Materials & methods Thirty six viruses: sixteen ND Polish pigeon strains, four ND reference strains, four Influenza and twelve other (negative control strains) viruses were isolated from allantoic fluids of SPF embryonated eggs. The 4-week-old SPF chickens were also infected with both viruses (NDV – LaSota; IV – H7N1) Swabs from cloaca and trachea were collected and examined (Tab.1). Table 1: The experimental design Actions Day of experiment Inoculation of birds (4 week old) with 1 LaSota and H7N1 strains Collection of cloacal and oral swabs 4 Collection of cloacal and oral swabs 5 RNA was extracted using an RNeasy Nini Kit (Qiagen, Valencia, CA, USA). After RNA isolation, One Step RT-PCR were carried out. Two sets of primers based on conserve fragments of the M gens of NDV and IV were used in this study: NDV-F-4011: 5’ GTCCCAAATACCGGAGACCT 3’ NDV-R-4142: 5’ TTGTTTGCCACAACCCTACAG 3’ IV-F-VII/25: 5’ AGATGAGTCTTCTAACCGAGGTCG 3’ IV-R-VII/124: 5’ TGCAAAAACATCTTCAAGTCTCTG 3’ The reaction was carried out according to the Transcriptor One- Step RT-PCR Kit protocol (Roche Diagnostics, Mannheim, Germany). The reaction mixture contained: viral RNA, both sets of primers (0,3µM each), buffer (1x), Transcriptor Enzyme Mix and water. Condition of reaction presents Tab. 2 Table 2. Conditions of One Step RT-PCR reaction. Step Temp. Time Cycles Reverse transcription 50ºC 30 min 1 Initial denaturation 94ºC 7 min 1 Denaturation 94ºC 10 sec Annealing 53 ºC 30 sec 10 Elongation 68 ºC 105 sec PCR profile Denaturation 94 ºC 10 sec Annealing 60 ºC 30 sec 25 Elongation 68 ºC 105 sec Final Elongation 68 ºC 7 min 1 Two products were expected: one for NDV – 152 base pair fragment contained conserve M gene fragment; and one for IV – 102 base pair fragment also contained conserve M gene fragment. The results were visualized in 2,5% agarose gel. Results All NDV and Influenza virus strains isolated from eggs and from oral or cloacal swabs were detected by One Step RT-PCR method. The results of analysis are presented in Figure 1 and Tab. 3. NDV IV NDV+IV ntc M 152 bp 102 bp Figure. 1. Analysis of One Step RT-PCR reaction. 2,5% Agarose gel with EtBr. ntc – no template control, M – Mass marker (Hyper Ladder II, BioLine) Table 3. Results of analysis of infected birds and comparison with other previously described methods. Chicken no 41 Chicken no 31 AIV NDV AIV NDV A OS B OS A OS B OS 4 dpi O 20.48 + n.d. n.d. 20.71 + 29.82 + 4 dpi C 22.76 + 29.74 + 24.80 + >35 - 5 dpi O 20.68 + 27.34 + 21.69 + 33.69 + 5 dpi C 22.07 + n.d. n.d. 23.40 + >35 - Chicken no 42 Chicken no 10 AIV NDV AIV NDV A OS A OS A OS B OS 4 dpi O 21.68 + n.d. n.d. 21.98 + 35.00 + 4 dpi C 23.94 + n.d. n.d. 19.55 + 33.39 + 5 dpi O 21.86 + 34.55 + 23.34 + >35 - 5 dpi C 25.01 + 34.97 + 20.72 + n.d. n.d AIV – Avian Influenza Virus; NDV – Newacastle Disease Virus; dpi – day post infection; O – Oral swab; C – Cloacal swab; n.d. – not detected; A – method of detection based on Spackman et al., 2002 (6); B – method of detection based on Mia Kim et al., 2008 (5); OS – One Step RT-PCR Method; “+” – positive; “-“ – negative. Discussion & conclusions Birds infected by Newcastle Disease or Influenza virus give very similar symptoms, hard to distinguish by veterinarians even during post-mortem examination. For this reason, the new One Step RT-PCR method for direct detection and differentiation of NDV and IV was developed. One Step RT-PCR assay can be applied by veterinary diagnosticians for preliminary differentiation between NDV and Influenza virus. The ability to detect both major avian pathogens in a very easy procedure makes this method very attractive for application in veterinary laboratories. References 1. Alexander, D.J. – Orthomyxovirus infections. in: Viral Infections of Birds, red: J.B. McFerran, M.S. McNulty – Elsevier Science, London 1993, 287- 316 2. Beard, C, Hanson, R (1984). Newcastle Disease. In: Hofstad, M, Barnes, H, Calnek, B, Reid, W, Yoder, H. (Eds.) Disease of Poultry, 8 th ed. Iowa State University Press, Ames, 452-470. 3. Capua, I., Alexander, D.J. - Avian influenza and human health - Acta Tropica 83 (2002), 1–6 4. Lamb, R, Collins,P, Kolakofsky, D, Melero J, Nagai,Y, Oldstone, M, Pringle,C, Rima, B. Family paramyxoviridae. In: Fauquet, C, Mayo M, Maniloff J, Desselberger, U, Ball, L. (Eds.) Virus Taxonomy, VIII th Report of the International Committee on Taxonomy of Viruses. Elsevier Academic Press, San Diego, 655-668. 5. Mia Kim, L., Suarez, D.L., Afonso, C.L., 2008. Detection of a broad range of class I and II Newcastle disease viruses using a multiplex real time reverse transcription polymerase chain reaction assay. J. Vet. Diagn. Invest. 20, 414-425. 6. Spackman, E, Senne, DA, Myers, TJ, Bulaga, LL, Garber, LP, Perdue, ML, Lohman, K, Daum, LT, Suarez, DL , 2002. Development of a real-time reverse transcriptase PCR assay for type A influenza virus and the avian H5 and H7 hemagglutinin subtypes.J. Clin Microbiol., 40, 3256
Page 2 and 3:
2 nd CONGRESSOFTHEEUROPEAN ASSOCIAT
Page 4:
Welcome Dear colleagues, Welcome to
Page 7 and 8:
worked with many diagnostic compani
Page 9 and 10:
Products and services for scientist
Page 11 and 12:
16:4518.15 20:0023:00 [S1.]Oralpres
Page 13 and 14:
Day4 Wednesday,4July2012 4 th sessi
Page 15 and 16:
Oral presentations “General Sessi
Page 17 and 18:
antigens or attenuated vaccines can
Page 19 and 20:
conditions, e.g. Staphylococcus aur
Page 21 and 22:
S1 - O - 1 ORAL FLUIDS - SAMPLE MAT
Page 23 and 24:
S1 - O - 03 INTRODUCTION RATE OF A
Page 25 and 26:
S1 - O -05 VALIDATION OF A COMPETIT
Page 27 and 28:
S1 - O - 07 SUBTYPING OF SWINE INFL
Page 29 and 30:
S1 - O - 09 VIRAL DIAGNOSIS USING T
Page 31 and 32:
S1 - O - 11 USING ORAL FLUID FOR TH
Page 33 and 34:
S1 - O - 13 THE FIRST YEAR OF OBLIG
Page 35 and 36:
S1 - O - 15 SEROLOGICAL ANALYSIS AN
Page 37 and 38:
S1 - O - 17 RING TEST EVALUATION FO
Page 39 and 40:
Oral presentations “Diagnostics a
Page 41 and 42:
S2 - O - 01 DEVELOPMENT OF A RAPID
Page 43 and 44:
S2 - O - 03 EVALUATION OF RAPID HRS
Page 45 and 46:
Oral presentations “Emerging, re-
Page 47 and 48:
advances, the fundamental tools of
Page 49 and 50:
S3 - O - 02 25 YEARS OF PASSIVE SUR
Page 51 and 52:
S3 - O - 04 EQUINE NOCARDIOFORM PLA
Page 53 and 54:
S3 - O - 06 DETECTION OF SCHMALLENB
Page 55 and 56:
S3 - O - 08 SCHMALLENBERGVIRUS: SER
Page 57 and 58:
S3 - O - 10 DIAGNOSTIC ASPECTS OF S
Page 59 and 60:
Oral presentations “New technique
Page 61 and 62:
acid and organic solvent. Then a dr
Page 63 and 64:
S4 - O - 02 BIOLOG GENERATION III,
Page 65 and 66:
S4 - O - 04 MATRIX-ASSISTED LASER D
Page 67 and 68:
S4 - O - 06 15 MINUTE ELISA USING A
Page 69 and 70:
S1 - P - 01 LAWSONIA INTRACELLULARI
Page 71 and 72: S1 - P - 03 DETECTION OF PRRSV ANTI
Page 73 and 74: S1 - P - 05 DEVELOPMENT AND EVALUAT
Page 75 and 76: S1 - P - 07 ANALYTICAL EVALUATION O
Page 77 and 78: S1 - P - 09 PTS FOR BVDV ANTIGEN DE
Page 79 and 80: S1 - P - 11 ANTIMICROBIAL SUSCEPTIB
Page 81 and 82: S1 - P - 13 IDENTIFICATION OF GLOBI
Page 83 and 84: S1 - P - 15 ACCURACY OF PARATUBERCU
Page 85 and 86: S1 - P - 17 VIROLOGICAL SURVEILLANC
Page 87 and 88: S1 - P - 19 CHARACTERIZATION OF EXT
Page 89 and 90: S1- P - 21 ANALYSIS OF THE EFFICIEN
Page 91 and 92: S1 - P - 23 RELIABLE AND EARLY DETE
Page 93 and 94: S1 - P - 25 GENOTYPIC VARIABILITY D
Page 95 and 96: S1 - P - 27 PROFICIENCY TESTING (PT
Page 97 and 98: S1 - P - 29 LOW PATHOGENIC AVIAN IN
Page 99 and 100: S1 - P - 31 PRRSV DIAGNOSTICS BY RT
Page 101 and 102: S1 - P - 33 APPLICATION OF A HERD P
Page 103 and 104: S1 - P - 35 DEVELOPMENT OF A BROADL
Page 105 and 106: S1 - P - 37 MONITORING OF BOVINE VI
Page 107 and 108: S1 - P - 39 BOVINE BLOOD DENDRITIC
Page 109 and 110: Poster presentations “Diagnostics
Page 111 and 112: S2 - P - 02 NEW IMMUNOASSAYS FOR DI
Page 113 and 114: Poster presentations “Emerging, r
Page 115 and 116: S3 - P - 02 LIPOPOLYSACCHARIDE-CAPT
Page 117 and 118: S3 - P - 04 DEVELOPMENT OF A SCHMAL
Page 119 and 120: S3 - P - 06 COMPARISON OF CULTURE A
Page 121: S3 - P - 08 EMERGENCE OF SCHMALLENB
Page 125 and 126: S3 - P - 12 PRELIMINARY VALIDATION
Page 127 and 128: S3 - P - 14 DEVELOPMENT OF MULTISPE
Page 129 and 130: S3 - P - 16 DETECTION OF IBV QX IN
Page 131 and 132: S3 - P - 18 PREVALENCE OF COXIELLA
Page 133 and 134: S3 - P - 20 INTERFERON-GAMMA ASSAY
Page 135 and 136: S3 - P - 22 COMPARISON OF THE PERFO
Page 137 and 138: S3 - P - 24 DEVELOPMENT OF A VIRUS
Page 139 and 140: S3 - P - 26 DETECTION OF EQUINE FOA
Page 141 and 142: S4 - P - 01 MOLECULAR CHARACTERIZAT
Page 143 and 144: S4 - P - 03 USEFULNESS OF LIVE/DEAD
Page 145 and 146: S4 - P - 05 EVALUATION OF THREE ELI
Page 147 and 148: S4 - P - 07 EVALUATION OF DIFFERENT
Page 149 and 150: S4 - P - 09 VALIDATION OF THE ID SC
Page 151 and 152: S4 - P - 11 EFFECTIVE TESTING STRAT
Page 153 and 154: List of Abstracts (in order of numb
Page 155 and 156: S1-P-03 BALLAGI ANDREA S1-P-04 BENI
Page 157 and 158: S3-P-06 KELLER SELINA S3-P-07 KÖNI
Page 159 and 160: List of abstracts (alphabetical ord
show all

Abstract Book of EAVLD2012 - eavld congress 2012

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?