198 CUPRINS

Among the pests of fruit trees in Europe a less signi cant role has been assigned
to the leaf roller Byctiscus betulae L. which is interesting because of unusual damages
on the leaves. The females roll the leaves in cigar-like structures and they lay eggs
into them. The insect has one generation per year and grapevine is not its only host,
although the most abundant populations of weevils are usually found on fruit trees,
where the damage is also the most extensive they also bite the swollen buds and leaves,
these damages are also evident.
Materials and methods
Collection of Insects. Adults and larvae of Byctiscus betulae L. leaf-rolling weevils
were collected from different populations of weevils in the central, southern and in
the northern part of republic, from May to September 2007. Insects were collected
by entomological net and shake off on the cloth [5, 17] from leaves of Pyrus sp., and
Malus sp. Specimens were individually put into sterilized tubes to prevent possible
contaminations and were transported to the laboratory in boxes, where insects were
sterilized by submerging them brie y in a 3% sodium hypochlorite solution and
washing twice in sterile distilled water [10].
Isolation of bacteria. After macroscopic examination, adults living and dead
larvae were surface sterilized with 70% alcohol to remove possible contamination and
then washed in sterile distilled water. The insect bodies were homogenized in nutrient
broth using a glass tissue grinder. After preparing the extract for bacterial isolation,
suspensions were diluted to 10 −5 [4] and 0,1 mL spread on nutrient agar [13]. Plates
were incubated at 30 0 C for 2–3 days. Isolates were determined based on colour and
morphology of the colonies. Individual colonies were isolated, sub-cultured twice to
ensure purity and then stored in 15% sterilized glycerol at −20 0 C and −80 0 C for further
studies. Pure cultures of bacterial colonies were identi ed by their morphology, spore
formation, physiological, biochemical and molecular characteristics.
Bacteria Identi cation. The identi cation procedure of isolated bacteria was
performed according to Manual of Techniques in Insect Pathology [13]. After color and
shape of colonies of bacterial isolates were determined, Gram stain was performed on
isolates. Based on the results of Gram stain and shape of isolates, several physiological
and biochemical tests were performed for all isolates. Isolates were tested for tolerance
to NaCl (grown in nutrient broth containing 5%, 6%, 7%, 8% and 9% NaCl). API20E
biochemical panel test system was performed according to the procedure suggested by
Alsina & Blanch [1], with some modi cations. Bacterial colonies of each isolate were
diluted in 0,85% NaCl solution. The amount of bacteria was adjusted to 1×10 15-16 CFU/
mL. Two hundreds μL of this solution were transferred into each well of API20E panel.
To prevent any contact with air, wells were lled up with mineral oil. Then the panels
were incubated for 18–24 hours at 30 0 C.
DNA extraction, ampli cation by PCR and nucleotide sequencing. Genomic
DNA was extracted using standard phenol/chloroform procedures [11]. DNA
pellets were dissolved in 10 μL TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH
8.0) and stored at 4 0 C until use. PCR ampli cation of 16S rRNA genes of bacterial
isolates was performed with the following universal primers [18]: UNI Primers: F
5′ATTCTAGAGTTTGATCATGGCTCA3′ and R 5′ATGGTACCGTGTGTGACGGG
98