Redesigning Animal Agriculture

132 T. Doran and L. Lambeth
B
A
shRNA sense strand (siRNA passenger)
Fig. 8.3. The DNA-based shRNA expression vector process and the structure of an shRNA. (A) An shRNA
template that features the sense, loop, antisense and termination sequence is engineered downstream of a
promoter sequence. When introduced into the cell, transcription of the RNA results in the formation of a
small hairpin structure that is processed by Dicer and enters the RNAi pathway. (B) Typical shRNA designs
feature an siRNA core sequence that ranges from 19–29 bp in length that forms the shRNA stem. The loop
sequence connects the 3′ end of the upper siRNA stand (shRNA sense strand) to the 5′ end of the lower
siRNA (shRNA antisense strand). The shRNA sense strand is identical to the target mRNA and gives rise to
the siRNA ‘passenger’ strand, and the shRNA antisense strand is complementary to the target mRNA and
gives rise to the siRNA ‘guide’ strand. The poly uridine overhang of the shRNA antisense strand is derived as
part of the termination of transcription.
analysis of gene function in both animal
cells and tissues and shows promise in the
development of novel gene therapies.
All of this preliminary work in construction
of ddRNAi systems for plasmid
and viral vectors has now led to the development
of transgenes featuring pol III promoters
for the expression of shRNAs in
transgenic animals (Golding et al., 2006).
shRNA-mediated ddRNAi
Methods for expression of shRNA have
advanced rapidly since the initial discovery
of RNAi in animal cells. There are a number
of aspects of shRNA molecules and vec-
promoter sense antisense stop
RNA transcribed
‘hairpin’ forms
spontaneously
shRNA is processed
to form an siRNA
5’
3’
U C
A
GGUUCGACGCCUUGGAAUAU
A
UU CCAAGCUGCGGAACCUUAUA
Loop
G G
A
Poly U overhang (from termination) 3’
5’
shRNA antisense strand (siRNA guide)
shRNA stem (19−29 bp)
tor design that have been tested to generate
more effective expression systems. Although
many subtle variations exist, the anatomy of
the expressed shRNA molecules has remained
relatively constant and features a number of
characteristic components that are essential for
function (Fig. 8.3B). Other factors that are crucial
for activity have been considered, including
the loop sequence and the use of a number
of promoter types for shRNA expression.
Effector molecule design
Although a large statistical analysis of factors
affecting shRNA efficacy has not yet
been published, it appears that the same