AbstractTo clarify the phylogenetic relationships among the genera of Neotropical parrots we analyzed6416 base pairs of nuclear (RAG-1) and mitochondrial DNA sequences (cytochrome b, NADH2,ATPase 6, ATPase 8, COIII, 12S rDNA, and 16S rDNA) from 29 species belonging to 25 out of the 30genera. Phylogenetic analyses using maximum likelihood and Bayesian methods showed that withinNeotropical parrots, Nannopsittaca and Bolborhynchus form the sister clade to all other genera, whichin turn are grouped in two distinctive clades. These two derived clades partition amazons and theirallies from macaws, conures, and related taxa. Molecular <strong>da</strong>ting with a geological calibration for theseparation of New Zealand (82-85 million years, Myr) suggests that the Neotropical parrots shared acommon ancestor with Australian parrots around the end of the Cretaceous (65 Myr), and thus, theirdivergence could be explained by vicariance. The three Neotropical clades may have diverged whilethey were in the Antarctica-South America block, or in South America only. Hypothesis of thediversification in these groups relating historical factors and cladogenesis pattern in were proposed.Sequences of the mitochondrial control region and flanking genes of Ara ararauna,Anodorhynchus hyacinthinus, Bolborhynchus lineola, Brotogeris chiriri, Cyanoliseus patagonus,Cyanopsitta spixii, Diopsittaca nobilis, Enicognathus leptorhynchus, Guarouba guarouba, Myiopsittamonachus, Nanopsittaca <strong>da</strong>chilleae, Orthopsittaca manilata, Primolius auricollis, Pyrrhura picta, andRhynchopsitta pachiryncha show the same gene arrangement first described in Gallus gallus, (which isthe most common mitochondrial genome arrangement in birds). Sequences of the same region inAmazona xanthops, Deroptyus accipitrinus, Forpus crassirostris, Graydi<strong>da</strong>scalus brachyurus,Pionopsitta pileata, Pionopsitta barrabandi, Pionites melanocephala, and Triclaria malachitacearevealed an arrangement of genes with a duplication of the control region, as previously reported inNeotropical parrots from the genera Amazona and Pionus. Exclusive pseudogenes occur in Deroptyusand Pionites. The mapping of these characters in a phylogenetic proposal for the group suggestsambiguity on the inference of the ancestral states of the clades. Two models were proposed andcompared, considering six events of duplication and deletion of genes.2
Capítulo 1Introdução
- Page 1 and 2: Erika Sendra TavaresRelações filo
- Page 3 and 4: Tavares, Erika SendraRelações fil
- Page 5 and 6: Strange fascination, fascinating me
- Page 7 and 8: Às pessoas e instituições que ce
- Page 9: ResumoCom a finalidade de entender
- Page 13 and 14: Capítulo 1Os Psittaciformes são u
- Page 15 and 16: Capítulo 1vértebras dorsais, uma
- Page 17 and 18: 1.2.2. Importância da tribo Arini
- Page 19 and 20: Capítulo 1atuais mais recentes que
- Page 21 and 22: Capítulo 1bayesiana (descritos a s
- Page 23 and 24: Capítulo 1Em geral, mais de uma to
- Page 25 and 26: 1.5. Datação molecularCapítulo 1
- Page 27 and 28: Capítulo 1dados. Por esse método,
- Page 29 and 30: 1.6. ObjetivosCapítulo 1A presente
- Page 31 and 32: Capítulo 1Collar, N.J., Gonzaga, L
- Page 33 and 34: Capítulo 1Moritz, C. Hillis, D.M.,
- Page 35 and 36: Capítulo 1Tavares, E.S. 2001. Estu
- Page 37 and 38: 2.1. IntroduçãoCapítulo 2Os psit
- Page 39 and 40: Capítulo 2Tabela 2.1. Táxons amos
- Page 41 and 42: Capítulo 2TTCAGTTTTGGTTTACAAGAC -3
- Page 43 and 44: Capítulo 2terminais (n=32), o temp
- Page 45 and 46: Capítulo 2gama de cada gene. Esses
- Page 47 and 48: Capítulo 2(Tabela 2.2), enquanto a
- Page 49 and 50: Capítulo 2A análise bayesiana das
- Page 51 and 52: Capítulo 2Figura 2.2. Reconstruç
- Page 53 and 54: Capítulo 2a) b)b) d)Figura 2.3. Ma
- Page 55 and 56: Capítulo 22.3.4. Tempos de diverg
- Page 57 and 58: Capítulo 2Figura 2.4. Cronograma m
- Page 59 and 60: Capítulo 2e Pionites. Além disso,
- Page 61 and 62:
Capítulo 2florestas tropicais na A
- Page 63 and 64:
Capítulo 22.5. ReferênciasArbobas
- Page 65 and 66:
Capítulo 2Griffiths, C.S., Barrowc
- Page 67 and 68:
Capítulo 2Poe, S., Swofford D.L.,
- Page 69 and 70:
Capítulo 3Evolução da organizaç
- Page 71 and 72:
Capítulo 3Figura 3.1. Ordem dos ge
- Page 73 and 74:
Capítulo 3Nesse caso, também foi
- Page 75 and 76:
Capítulo 3A primeira amplificaçã
- Page 77 and 78:
Capítulo 3codificadores não apres
- Page 79 and 80:
Capítulo 3Não foram identificados
- Page 81 and 82:
Capítulo 3a)b) c)Figura 3.6. a) Ma
- Page 83 and 84:
Capítulo 3Bloco FBloco ENannopsitt
- Page 85 and 86:
Capítulo 3máxima verossimilhança
- Page 87 and 88:
Capítulo 3estar presentes no ances
- Page 89 and 90:
Capítulo 3Lowe, T.M., Eddy, S.R.,
- Page 91 and 92:
Capítulo 4Considerações finais
- Page 93 and 94:
Capítulo 4Foram realizadas estimat