Capítulo 1Haddrath, O., Baker., A.J., 2001. Complete mitochondrial DNA genome sequences of extinct birds:ratite phylogenetics and the vicariance biogeography hypothesis. Proc. R. Soc. Lond. B 268,939–945.Harrison, G.L., McLenachan, P.A., Philips, M.J. Slack, K.E. Cooper A., Penny, D., 2004. Four newavian mitochondrial genomes help get to basic evolutionary questions in the Late Cretaceous.Mol. Biol. Evol. 21, 974–983.Hedges, S.B., Parker, P.H., Sibley, C.G., Kumar, S., 1996. Continental breakup and the ordinaldiversification of birds and mammals. Nature 381, 226–29.Holder, M., Lewis, P.O., 2003. Phylogeny estimation: traditional and Bayesian approaches. Naturereviews 4, 275-284.Huelsenbeck, J.P, Rannala, B., 1997. Phylogenetic methods come of age: testing hypothesis in anevolutionary context. Science 276, 227-232.Huelsenbeck, J.P., Ronquist, F., Nielsen, R., Bollback, J.P., 2001. Bayesian inference of phylogeny andits impact on evolutionary biology. Science 294, 2310-2314.Kishino, H., Thorne, JL. Bruno, W.J., 2001. Performance of a divergence time method under aprobabilistic model of rate evolution. Mol. Biol. Evol. 18, 352-361.Klicka J, Zink, R.M., 1997. The importance of recent ice ages in speciation: a failed paradigm. Science277, 1666–69.Livezey, B.C., Zusi, R.L., 2001. Higher-order phylogenetics of modern aves based on comparatveanatomy. Netherlands J. Zool. 51, 179-205.Lovette, I.J., 2004. Mitochondrial <strong>da</strong>ting and mixed support for the “2% rule” in birds. Auk, 121, 1-6.Maddison, W.P., Maddison, D.R., 2004. Mesquite: a modular system for evolutionary analysis. Version1.05 http://mesquiteproject.org.Margoliash, E., 1963. Primary structure and evolution of cytochrome c. Proc. Natl. Acad. Sci USA 50,672-679.Mayr, G., Clarke, J., 2003. The deep divergences of neornithine birds: a phylogenetic analysis ofmorphological characters. Cladistics, 19, 553.Metropolis, N., Rosenbluth, A.W., Rosenbluth, M.N., Teller, A.H., Teller, E., 1953. Equation of statecalculations by fast computing machines. J. Chem. Phys. 21, 1087-1092.Miran<strong>da</strong> Ribeiro, A., 1920. Revisão dos psitacídeos brasileiros. Rev. Mus. Paulista 12, 3-83.Miyaki, C.Y., Matioli, S.R., Burke, T., Wajntal, A., 1998. Parrot evolution and palaeographical events:mitochondrial DNA evidence. Mol. Biol. Evol. 15, 544–551.24
Capítulo 1Moritz, C. Hillis, D.M., 1996. Molecular Systematics: context and controversies. In: Hillis, D.M., Moritz,C., Mable, B.K. (Eds.) Molecular Systematics. Sinauer Associates, Sunderland, Pp. 1-13.Nahum, L.A., Pereira, S.L, Fernandes, F.M.C., Matioli, S.R., Wajntal, A., 2003. Diversification ofRamphastinae (Aves, Ramphasti<strong>da</strong>e) prior to the Cretaceous/Tertiary boun<strong>da</strong>ry as shown bymolecular clock of mtDNA sequences. Genet. Mol. Biol. 26, 411-418.Nei, M. e Kumar, S. 2000. Molecular evolution and phylogenetics, primeira edição. Oxford UniversityPress, New York.Owens, I.P.F., Bennett, P.M., 2000. Ecological basis of extinction risk in birds: habitat loss versushuman persecution and introduced pre<strong>da</strong>tors. Proc. Natl. Acad. Sci. USA 12144-12148.Paton, T., Haddrath, O., Baker, A.J., 2002. Complete mitochondrial DNA genome sequences show thatmodern birds are not descended from transitional shorebirds. Proc. R. Soc. Lond. B 269,839–846.Penhallurick, J., 2001. Primolius Bonaparte, 1857 has priority over Propyrrhura Ribeiro, 1920. Bull. Brit.Orn. C. 121, 38-39.Pereira, S.L., Baker, A.J., Wajntal, A., 2002. Combined nuclear and mitochondrial DNA sequencesresolve generic relationships within the Craci<strong>da</strong>e (Galliformes, Aves). Syst. Biol. 51, 946–958.Peters, J. L. 1937. Checklist of the Birds of the World, volume 3. Harvard University Press, Cambridge.Pinto, O. O. 1937. Catálogo de aves do Brasil. Rev. Mus. Paulista 22, 181-215.Pinto, O. O. 1978. Novo Catálogo <strong>da</strong>s Aves do Brasil, volume 1. Empresa Gráfica <strong>da</strong> Revista dosTribunais S. A., São Paulo.Posa<strong>da</strong>, D., 2003. Selecting models of evolution. In: Salemi, M., Van<strong>da</strong>mme, A.M. The PhylogeneticHandbook: a Practical Approach to DNA and Protein Phylogeny. Cambridge University Press,Cambridge. Pp. 256-282.Posa<strong>da</strong>, D., Cran<strong>da</strong>ll, K.A., 1998. Modeltest: testing the model of DNA substitution. Bioinformatics 14,817-818.Ribas, C.C., 2004. Filogenias Moleculares e Biogeografia Histórica em Psitacídeos (Aves; Psittaci<strong>da</strong>e):Padrões e Processos de Diversificação no Neotrópico. Tese de Doutorado, Instituto deBiociências, Universi<strong>da</strong>de de São Paulo, São Paulo.Ribas, C.C., Miyaki, C.Y., 2004 Molecular systematics in Aratinga parakeets: species limits andhistorical biogeography in the solstitialis group, and the systematic position of Nan<strong>da</strong>yusnen<strong>da</strong>y. Mol. Phylogenet. Evol. 30, 663–675.25
- Page 1 and 2: Erika Sendra TavaresRelações filo
- Page 3 and 4: Tavares, Erika SendraRelações fil
- Page 5 and 6: Strange fascination, fascinating me
- Page 7 and 8: Às pessoas e instituições que ce
- Page 9 and 10: ResumoCom a finalidade de entender
- Page 11 and 12: Capítulo 1Introdução
- Page 13 and 14: Capítulo 1Os Psittaciformes são u
- Page 15 and 16: Capítulo 1vértebras dorsais, uma
- Page 17 and 18: 1.2.2. Importância da tribo Arini
- Page 19 and 20: Capítulo 1atuais mais recentes que
- Page 21 and 22: Capítulo 1bayesiana (descritos a s
- Page 23 and 24: Capítulo 1Em geral, mais de uma to
- Page 25 and 26: 1.5. Datação molecularCapítulo 1
- Page 27 and 28: Capítulo 1dados. Por esse método,
- Page 29 and 30: 1.6. ObjetivosCapítulo 1A presente
- Page 31: Capítulo 1Collar, N.J., Gonzaga, L
- Page 35 and 36: Capítulo 1Tavares, E.S. 2001. Estu
- Page 37 and 38: 2.1. IntroduçãoCapítulo 2Os psit
- Page 39 and 40: Capítulo 2Tabela 2.1. Táxons amos
- Page 41 and 42: Capítulo 2TTCAGTTTTGGTTTACAAGAC -3
- Page 43 and 44: Capítulo 2terminais (n=32), o temp
- Page 45 and 46: Capítulo 2gama de cada gene. Esses
- Page 47 and 48: Capítulo 2(Tabela 2.2), enquanto a
- Page 49 and 50: Capítulo 2A análise bayesiana das
- Page 51 and 52: Capítulo 2Figura 2.2. Reconstruç
- Page 53 and 54: Capítulo 2a) b)b) d)Figura 2.3. Ma
- Page 55 and 56: Capítulo 22.3.4. Tempos de diverg
- Page 57 and 58: Capítulo 2Figura 2.4. Cronograma m
- Page 59 and 60: Capítulo 2e Pionites. Além disso,
- Page 61 and 62: Capítulo 2florestas tropicais na A
- Page 63 and 64: Capítulo 22.5. ReferênciasArbobas
- Page 65 and 66: Capítulo 2Griffiths, C.S., Barrowc
- Page 67 and 68: Capítulo 2Poe, S., Swofford D.L.,
- Page 69 and 70: Capítulo 3Evolução da organizaç
- Page 71 and 72: Capítulo 3Figura 3.1. Ordem dos ge
- Page 73 and 74: Capítulo 3Nesse caso, também foi
- Page 75 and 76: Capítulo 3A primeira amplificaçã
- Page 77 and 78: Capítulo 3codificadores não apres
- Page 79 and 80: Capítulo 3Não foram identificados
- Page 81 and 82: Capítulo 3a)b) c)Figura 3.6. a) Ma
- Page 83 and 84:
Capítulo 3Bloco FBloco ENannopsitt
- Page 85 and 86:
Capítulo 3máxima verossimilhança
- Page 87 and 88:
Capítulo 3estar presentes no ances
- Page 89 and 90:
Capítulo 3Lowe, T.M., Eddy, S.R.,
- Page 91 and 92:
Capítulo 4Considerações finais
- Page 93 and 94:
Capítulo 4Foram realizadas estimat