Capítulo 2Crowe TM, Short LL. 1992. A new gallinaceous bird from the Oligocene of Nebraska, with comments on thephylogenetic position of the Gallinuloidi<strong>da</strong>e. Contrib. Sci. Natl. Hist. Museum Los Angeles County 36,179–185.de Kloet, R.S. e de Kloet, S.R., 2005. The evolution of the spindlin gene in birds: sequence analysis of anintron of the spindlin W and Z gene revealed four major divisions of the Psittaciformes. Mol. Phylol.Evol. (in press).del Hoyo, J., Elliot, A.E., Sargatal, J.(Eds.), 1997. Handbook of the Birds of the World, vol. 4. Sandgrouse toCoockos. Lynx Edicións, Barcelona.Desjardins, P., Morais, R., 1990. Sequence and gene organization of the chicken mitochondrial genome: anovel gene order in higher vertebrates. J. Mol. Biol. 212, 599-634.Dingle, R.V., Lavelle, M., 1998. Late Cretaceous- Cenozoic climatic variations of the northern AntarcticaPeninsula: new geochemical evidence and review. Paleogeog. Paleoclimat. Paleoecol. 141, 215-232.Dyke, G.J., 2001. The evolutionary radiation of modern birds: systematics and patterns of diversification.Geol. J. 36, 305-315.Eberhard, J.R., Bermingham, E., 2004. Phylogeny and biogeography of the Amazona ochrocephala (Aves:Psittaci<strong>da</strong>e) complex. Auk 121, 318-332.Effron, B., 1979. Bootstrap methods: another look at the jackknife. Ann. Statistics 7, 1-26.Ericson, P.G.P., Irestedt, M., Johansson, U.S., 2003. Evolution, biogeography, and patterns ofdiversification in passerine birds. J. Avian Biol. 34, 3-15.Felsenstein, J., 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39,783-791.Flynn, J.J., Wyss, A.R., 1998. Recent advances in South American mammalian paleontology. Trends Ecol.Evol. 13, 449-454.Forshaw, J., 1989. Parrots of the World, third ed. Landsdowne Editions, Melbourne.Foster, P.G., Hickey., D.A., 1999. Compositional bias may affect both DNA-based and protein-basedphylogenetic reconstructions. J. Mol. Evol. 48, 284–290.Galtier, N., Gouy, M., 1998. Inferring pattern and process: maximum likelihood implementation of anonhomogenous model of DNA sequence evolution for phylogenetic analysis. Mol. Biol. Evol. 15,871–879.56
Capítulo 2Griffiths, C.S., Barrowclough, G.F., Groth, J.G., Mertz, L., 2004. Phylogeny of the Falconi<strong>da</strong>e (Aves): acomparison of the efficacy of morphological, mitochondrial, and nuclear <strong>da</strong>ta. Mol. Phylogenet. Evol.32, 101-109.Groth, J.G., Barrowclough, G.F., 1999. Basal divergence in birds and the phylogenetic utility of the nuclearRAG-1 gene. Mol. Phylogenet. Evol. 12, 115–123.Haddrath, O., Baker., A.J., 2001. Complete mitochondrial DNA genome sequences of extinct birds: ratitephylogenetics and the vicariance biogeography hypothesis. Proc. R. Soc. Lond. B 268, 939–945.Hagelberg, E., 1994. Mitochondrial DNA from ancient bones. In: Herrmann, B., Hummel, S., (Eds.) AncientDNA, New York, Pp. 195-204.Harrison, G.L., McLenachan, P.A., Phillips, M.J., Slack, K.E., Cooper, A., Penny, D., 2004. Four new avianmitochondrial genomes help get to basic evolutionary questions in the Late Cretaceous. Mol. Biol.Evol. 21, 974-983.Hasegawa, M., Kishino H., Yano, T., 1985. Dating of the human-ape splitting by a molecular clock ofmitochondrial DNA. J. Mol. Evol. 22, 160-174.Hedges, S.B., Parker, P.H., Sibley, C.G., Kumar, S., 1996. Continental breakup and the ordinaldiversification of birds and mammals. Nature 381, 226–229.Hooghiemstra H., van der Hammen, T., 1998. Neogene and Quaternary development of the Neotropicalrain forest: the forest refugia hypothesis, and a literature overview. Earth Sci. Rev. 44, 147–183.Irestedt, M., Johansson, U.S., Parsons, T.J., Ericson, P.G.P., 2001. Phylogeny of the major lineages ofsuboscines (Passeriformes) analysed by nuclear DNA sequence <strong>da</strong>ta. J. Avian. Biol. 32, 15-25.Jaramillo, C.A., Dilcher, D.L., 2000. Microfloral diversity patterns of the late Paleocene–Eocene interval inColombia, northern South America. Geology 28, 815-818.Jermiin, L.S., Foster, P.G., Graur, D., Lowe, R.M., Crozier, R.H., 1996. Unbiased estimation of symmetricaldirectional mutation pressure from protein-coding DNA. J. Mol. Evol. 42, 476-480.Kishino, H., Thorne, JL. Bruno, W.J., 2001. Performance of a divergence time method under a probabilisticmodel of rate evolution. Mol. Biol. Evol. 18, 352-361.Kocher, T.D., Thomas, W.K., Meyer, A., Edwards, S.V., Paabo, S., Villablanca, F.X., Wilson, A.C., 1989.Dynamics of mitochondrial DNA evolution in animals: amplification and sequencing with conservedprimers. Proc. Natl. Acad. Sci. USA 86, 6196–6200.Lockhart, P.J., Steel, M.A., Hendy, M.D., Penny, D., 1994. Recovering evolutionary trees under a morerealistic model of sequence evolution. Mol. Biol. Evol. 11, 605–612.Lovette, I.J., 2004. Mitochondrial <strong>da</strong>ting and mixed support for the “2% rule” in birds. Auk, 121, 1-6.57
- Page 1 and 2:
Erika Sendra TavaresRelações filo
- Page 3 and 4:
Tavares, Erika SendraRelações fil
- Page 5 and 6:
Strange fascination, fascinating me
- Page 7 and 8:
Às pessoas e instituições que ce
- Page 9 and 10:
ResumoCom a finalidade de entender
- Page 11 and 12:
Capítulo 1Introdução
- Page 13 and 14: Capítulo 1Os Psittaciformes são u
- Page 15 and 16: Capítulo 1vértebras dorsais, uma
- Page 17 and 18: 1.2.2. Importância da tribo Arini
- Page 19 and 20: Capítulo 1atuais mais recentes que
- Page 21 and 22: Capítulo 1bayesiana (descritos a s
- Page 23 and 24: Capítulo 1Em geral, mais de uma to
- Page 25 and 26: 1.5. Datação molecularCapítulo 1
- Page 27 and 28: Capítulo 1dados. Por esse método,
- Page 29 and 30: 1.6. ObjetivosCapítulo 1A presente
- Page 31 and 32: Capítulo 1Collar, N.J., Gonzaga, L
- Page 33 and 34: Capítulo 1Moritz, C. Hillis, D.M.,
- Page 35 and 36: Capítulo 1Tavares, E.S. 2001. Estu
- Page 37 and 38: 2.1. IntroduçãoCapítulo 2Os psit
- Page 39 and 40: Capítulo 2Tabela 2.1. Táxons amos
- Page 41 and 42: Capítulo 2TTCAGTTTTGGTTTACAAGAC -3
- Page 43 and 44: Capítulo 2terminais (n=32), o temp
- Page 45 and 46: Capítulo 2gama de cada gene. Esses
- Page 47 and 48: Capítulo 2(Tabela 2.2), enquanto a
- Page 49 and 50: Capítulo 2A análise bayesiana das
- Page 51 and 52: Capítulo 2Figura 2.2. Reconstruç
- Page 53 and 54: Capítulo 2a) b)b) d)Figura 2.3. Ma
- Page 55 and 56: Capítulo 22.3.4. Tempos de diverg
- Page 57 and 58: Capítulo 2Figura 2.4. Cronograma m
- Page 59 and 60: Capítulo 2e Pionites. Além disso,
- Page 61 and 62: Capítulo 2florestas tropicais na A
- Page 63: Capítulo 22.5. ReferênciasArbobas
- Page 67 and 68: Capítulo 2Poe, S., Swofford D.L.,
- Page 69 and 70: Capítulo 3Evolução da organizaç
- Page 71 and 72: Capítulo 3Figura 3.1. Ordem dos ge
- Page 73 and 74: Capítulo 3Nesse caso, também foi
- Page 75 and 76: Capítulo 3A primeira amplificaçã
- Page 77 and 78: Capítulo 3codificadores não apres
- Page 79 and 80: Capítulo 3Não foram identificados
- Page 81 and 82: Capítulo 3a)b) c)Figura 3.6. a) Ma
- Page 83 and 84: Capítulo 3Bloco FBloco ENannopsitt
- Page 85 and 86: Capítulo 3máxima verossimilhança
- Page 87 and 88: Capítulo 3estar presentes no ances
- Page 89 and 90: Capítulo 3Lowe, T.M., Eddy, S.R.,
- Page 91 and 92: Capítulo 4Considerações finais
- Page 93 and 94: Capítulo 4Foram realizadas estimat