Capítulo 2Shimo<strong>da</strong>ira, H., Hasegawa, M., 2001. CONSEL: for assessing the confidence of phylogenetic treeselection. Bioinformatics 17, 1246-7.Sick, H., 1997. Ornitologia Brasileira, segun<strong>da</strong> ed., Editora Nova Fronteira S. A., Rio de Janeiro.Slowinski, J.B., 2001. Molecular polytomies. Mol. Phylogenet Evol. 19, 114-120.Smith, A.G., Smith, D.G., Funnell, B.M., 1994. Atlas of Mesozoic and Cenozoic coastlines, Cambridge,Cambridge University Press.Smith, G.A., 1975. Systematics of parrots. Ibis 117, 18-68.Swofford, D.L., 2002. PAUP*: Phylogenetic analysis using parsimony (*and related methods). Version 4.Sinauer Associates, Sunderland, MA.Takezaki, N., Rzhetsky, A., Nei, M., 1995. Phylogenetic test of molecular clock and linearized trees. Mol.Biol. Evol. 12, 823-833.Tavares, E.S., Yamashita, C., Miyaki, C.Y., 2004. Phylogenetic relationships among some Neotropicalparrot genera (Psittaci<strong>da</strong>e) based on mitochondrial sequences. Auk 121, 230-242.Thorne, J.L., Kishino, H., 2002. Divergence time and evolutionary rate estimation with multilocus DNA <strong>da</strong>ta.Syst. Biol. 51, 689-702.Thorne, J.L., Kishino, H., Painter, I.S., 1998. Estimating the rate of evolution of the rate of molecularevolution. Mol. Biol. Evol. 15, 1647-1657.Van Tuinen, M., Dyke, G.J., 2004. Callibration of Galliform molecular clocks using multiple fossils andgenetic partitions. Mol. Phylogenet. Evol. 30, 74-86.Van Tuinen, M., Hedges, S.B., 2001. Calibration of avian molecular clocks. Mol. Biol. Evol. 18, 206-213.Verheyen, R., 1956. Analyse du potentiel morphologique et projet d’une nouvelle classification desPsittaciformes. Bull. Inst. R. Sci. Nat. Belg. 32, 54pp.Wilf, P. Cúneo, N.R., Johnson, K.R., 2003. High plant diversity in Eocene South America: evidence fromPatagonia. Science 300, 122-125.Woodburne, M.O., Case J.A., 1996. Dispersal, vicariance, and the Late Cretaceous to early Tertiary landmammal biogeography from South America to Australia. Jour. Mamm. Evol. 3, 121-161.Yang, Z., 1997. Phylogenetic analysis by maximum likelihood (PAML), version 2.0. Univ. Carlifornia,Berkeley.60
Capítulo 3Evolução <strong>da</strong> organização dos genes mitocondriais aoredor <strong>da</strong> região controladora em psitacídeosneotropicais (tribo Arini)
- Page 1 and 2:
Erika Sendra TavaresRelações filo
- Page 3 and 4:
Tavares, Erika SendraRelações fil
- Page 5 and 6:
Strange fascination, fascinating me
- Page 7 and 8:
Às pessoas e instituições que ce
- Page 9 and 10:
ResumoCom a finalidade de entender
- Page 11 and 12:
Capítulo 1Introdução
- Page 13 and 14:
Capítulo 1Os Psittaciformes são u
- Page 15 and 16:
Capítulo 1vértebras dorsais, uma
- Page 17 and 18: 1.2.2. Importância da tribo Arini
- Page 19 and 20: Capítulo 1atuais mais recentes que
- Page 21 and 22: Capítulo 1bayesiana (descritos a s
- Page 23 and 24: Capítulo 1Em geral, mais de uma to
- Page 25 and 26: 1.5. Datação molecularCapítulo 1
- Page 27 and 28: Capítulo 1dados. Por esse método,
- Page 29 and 30: 1.6. ObjetivosCapítulo 1A presente
- Page 31 and 32: Capítulo 1Collar, N.J., Gonzaga, L
- Page 33 and 34: Capítulo 1Moritz, C. Hillis, D.M.,
- Page 35 and 36: Capítulo 1Tavares, E.S. 2001. Estu
- Page 37 and 38: 2.1. IntroduçãoCapítulo 2Os psit
- Page 39 and 40: Capítulo 2Tabela 2.1. Táxons amos
- Page 41 and 42: Capítulo 2TTCAGTTTTGGTTTACAAGAC -3
- Page 43 and 44: Capítulo 2terminais (n=32), o temp
- Page 45 and 46: Capítulo 2gama de cada gene. Esses
- Page 47 and 48: Capítulo 2(Tabela 2.2), enquanto a
- Page 49 and 50: Capítulo 2A análise bayesiana das
- Page 51 and 52: Capítulo 2Figura 2.2. Reconstruç
- Page 53 and 54: Capítulo 2a) b)b) d)Figura 2.3. Ma
- Page 55 and 56: Capítulo 22.3.4. Tempos de diverg
- Page 57 and 58: Capítulo 2Figura 2.4. Cronograma m
- Page 59 and 60: Capítulo 2e Pionites. Além disso,
- Page 61 and 62: Capítulo 2florestas tropicais na A
- Page 63 and 64: Capítulo 22.5. ReferênciasArbobas
- Page 65 and 66: Capítulo 2Griffiths, C.S., Barrowc
- Page 67: Capítulo 2Poe, S., Swofford D.L.,
- Page 71 and 72: Capítulo 3Figura 3.1. Ordem dos ge
- Page 73 and 74: Capítulo 3Nesse caso, também foi
- Page 75 and 76: Capítulo 3A primeira amplificaçã
- Page 77 and 78: Capítulo 3codificadores não apres
- Page 79 and 80: Capítulo 3Não foram identificados
- Page 81 and 82: Capítulo 3a)b) c)Figura 3.6. a) Ma
- Page 83 and 84: Capítulo 3Bloco FBloco ENannopsitt
- Page 85 and 86: Capítulo 3máxima verossimilhança
- Page 87 and 88: Capítulo 3estar presentes no ances
- Page 89 and 90: Capítulo 3Lowe, T.M., Eddy, S.R.,
- Page 91 and 92: Capítulo 4Considerações finais
- Page 93 and 94: Capítulo 4Foram realizadas estimat