1.7. ReferênciasCapítulo 1Arbobast, B.S, Edwards, S.V., Wakeley, J., Beerli, P. ,Slowinski, J.B., 2002. Estimating divergencetimes from molecular <strong>da</strong>ta on phylogenetic and population genetic timescales. Annu. Rev. Ecol.Syst. 33, 707–740.Barrowclough, G.F., Groth, J.G., Mertz, L.A., 2004. Phylogenetic relationships among parrots. OneHundred and Twenty-Second Stated Meeting of the American Ornithologist’s Union. 16 – 21August, Laval, Quebec.Beissinger, S.R., 2000. Ecological mechanisms of extinction. Proc. Natl. Acad. Sci. USA 97, 11688-11689.Bermingham, E., Rohwer, S., Freeman, S., Wood, C., 1992. Vicariance biogeography in thePleistocene and speciation in North American wood warblers: a test of Mengel’s model. Proc.Natl. Acad. Sci. USA 89, 6624–28.Boetticher, H.von, 1943. Ge<strong>da</strong>nken “uber die systematic Stellung einiger Papagaien. Zool. Anz. 143,191-200.Boetticher, H.von, 1959. Papagaien. Wittenberg Lutherstadt, A. Ziemsen.Boles, W.E., 1993. A new cockatoo (Psittaciformes: Cacatui<strong>da</strong>e) from the Tertiary of Rivers Leigh,northwestern Queensland, and an evaluation of rostral characters in the systematics of parrots.Ibis 135, 8-18.Boles, W.E., 1998. A budgerigar Melopsittacus undulatus from the Pliocene of Rivers Leigh, northwesternQueensland. EMU 98, 32-35.Brereton, J.L., 1963. Evolution within the Psittaciformes. Proc. Internatl. Ornitol. Congr. 13, 499-517.Bromham, L., Penny, D., 2003. The modern molecular clock. Nature 4, 216-224.Brown, W.M., George, M.J., Wilson, A.C., 1979. Rapid evolution of animal mitochondrial DNA. Proc.Natl. Acad. Sci. USA 361, 119-134.Chauviré, C.M., 1992. Une nouvelle famille de Perroquetes (Aves, Psittaciformes) <strong>da</strong>ns l`Eocenesupérieour des phosphorites du Qherci, France. Geobios 14, 169-177.Clarke, J.A., Tambussi, C.P., Noriega, J.I., Erickson, G.M, Ketcham, R.A., 2005. Definitive fossilevidence for the exant avian radiation in the Cretaceous. Nature 433, 305-308.Collar, N.J., 1997. Family Psittaci<strong>da</strong>e (Parrots). In: del Hoyo, J., Elliot, A.E., Sargatal, J.(Eds.)Handbook of the Birds of the World, vol. 4. Sandgrouse to Coockos. Lynx Edicións, Barcelona.Pp. 679.22
Capítulo 1Collar, N.J., Gonzaga, L.P., Krabbe, N., Madroño-Nieto, A., Naranjo, L.G., Parker III, T.A., Wege, D.C.,1992. Theathened birds of the Americas, terceira edição. Smithsonian Institution Press,Cambridge. Pp. 280-479.Cooper, A., Penny, D., 1997. Mass survival of birds across the Cretaceous-Tertiary boun<strong>da</strong>ry:molecular evidence. Science 275:1109–1113.Cracraft, J. 1973. Continental drift, palaeoclimatology, and the evolution and biogeography of birds. J.Zool. 169, 455-545.Cracraft, J., 2001. Avian evolution, Gondwana biogeography and the Cretaceous–Tertiary massextinction event. Proc. R. Soc. Lond. B 268, 459–469.de Kloet, R.S., de Kloet, S.R., 2005. The evolution of the spindlin gene in birds: sequence analysis ofan intron of the spindlin W and Z gene revealed four major divisions of the Psittaciformes. Mol.Phylogenet. Evol. (in press).del Hoyo, J., Elliot, A.E., Sargatal, J., 1997. Handbook of the Birds of the World, vol. 4. Sandgrouse toCoockos. Lynx Edicións, Barcelona.Doolittle, R, Feng, D, Tsang, S, Cho, G., Little, E., 1996. Determining divergence times of the majorkingdoms of living organisms with a protein clock. Science 271, 470–77.Dyke, G.J., Mayr, G., 1999. Did parrots exist in the Creteaceous period? Nature 399, 317-318.Ericson, P.G.P., Irestedt, M., Johansson, U.S., 2003. Evolution, biogeography, and patterns ofdiversification in passerine birds. J. Avian Biol. 34, 3-15.Felsenstein, J., 1988. Phylogenies from molecular sequences. Ann. Rev. Ecol. Syst. 19, 445-471.Felsenstein, J., 2004. Inferring Phylogenies. Sinauer Associates, Sunderland.Fleischer, R.C. McIntosh, C.E., Tarr, C.L., 1998. Evolution on a volcanic conveyor belt: usingphylogeographyc reconstructions and K-Ar-based ages of the Hawaiian Islands to estimatemolecular evolutionary rates. Mol. Ecol. 7, 533-545.Forshaw, J., 1989. Parrots of the World, terceira ed. Landsdowne Editions, Melbourne.García-Moreno, J., Sorenson, M.D., Mindell, D.P., 2003. Congruent avian phylogenies inferred frommitochondrial and nuclear DNA sequences. J. Mol. Evol. 57, 27-37.Glenny, F.H. 1954. Antarctica as a center of origins of birds. Ohio J. Sci. 54, 307-314.Graur, D., Li, W.H., 2000. Molecular phylogenetics. In: Grau, D., Li, W.H. (Eds.). Fun<strong>da</strong>mentals ofMolecular Evolution, segun<strong>da</strong> edição. Sinauer Associates, Sunderland. Pp.23
- Page 1 and 2: Erika Sendra TavaresRelações filo
- Page 3 and 4: Tavares, Erika SendraRelações fil
- Page 5 and 6: Strange fascination, fascinating me
- Page 7 and 8: Às pessoas e instituições que ce
- Page 9 and 10: ResumoCom a finalidade de entender
- Page 11 and 12: Capítulo 1Introdução
- Page 13 and 14: Capítulo 1Os Psittaciformes são u
- Page 15 and 16: Capítulo 1vértebras dorsais, uma
- Page 17 and 18: 1.2.2. Importância da tribo Arini
- Page 19 and 20: Capítulo 1atuais mais recentes que
- Page 21 and 22: Capítulo 1bayesiana (descritos a s
- Page 23 and 24: Capítulo 1Em geral, mais de uma to
- Page 25 and 26: 1.5. Datação molecularCapítulo 1
- Page 27 and 28: Capítulo 1dados. Por esse método,
- Page 29: 1.6. ObjetivosCapítulo 1A presente
- Page 33 and 34: Capítulo 1Moritz, C. Hillis, D.M.,
- Page 35 and 36: Capítulo 1Tavares, E.S. 2001. Estu
- Page 37 and 38: 2.1. IntroduçãoCapítulo 2Os psit
- Page 39 and 40: Capítulo 2Tabela 2.1. Táxons amos
- Page 41 and 42: Capítulo 2TTCAGTTTTGGTTTACAAGAC -3
- Page 43 and 44: Capítulo 2terminais (n=32), o temp
- Page 45 and 46: Capítulo 2gama de cada gene. Esses
- Page 47 and 48: Capítulo 2(Tabela 2.2), enquanto a
- Page 49 and 50: Capítulo 2A análise bayesiana das
- Page 51 and 52: Capítulo 2Figura 2.2. Reconstruç
- Page 53 and 54: Capítulo 2a) b)b) d)Figura 2.3. Ma
- Page 55 and 56: Capítulo 22.3.4. Tempos de diverg
- Page 57 and 58: Capítulo 2Figura 2.4. Cronograma m
- Page 59 and 60: Capítulo 2e Pionites. Além disso,
- Page 61 and 62: Capítulo 2florestas tropicais na A
- Page 63 and 64: Capítulo 22.5. ReferênciasArbobas
- Page 65 and 66: Capítulo 2Griffiths, C.S., Barrowc
- Page 67 and 68: Capítulo 2Poe, S., Swofford D.L.,
- Page 69 and 70: Capítulo 3Evolução da organizaç
- Page 71 and 72: Capítulo 3Figura 3.1. Ordem dos ge
- Page 73 and 74: Capítulo 3Nesse caso, também foi
- Page 75 and 76: Capítulo 3A primeira amplificaçã
- Page 77 and 78: Capítulo 3codificadores não apres
- Page 79 and 80: Capítulo 3Não foram identificados
- Page 81 and 82:
Capítulo 3a)b) c)Figura 3.6. a) Ma
- Page 83 and 84:
Capítulo 3Bloco FBloco ENannopsitt
- Page 85 and 86:
Capítulo 3máxima verossimilhança
- Page 87 and 88:
Capítulo 3estar presentes no ances
- Page 89 and 90:
Capítulo 3Lowe, T.M., Eddy, S.R.,
- Page 91 and 92:
Capítulo 4Considerações finais
- Page 93 and 94:
Capítulo 4Foram realizadas estimat