Experimentelle Untersuchungen zur Transgenese bei Nutztieren

Aus dem
Institut für Nutztiergenetik, Mariensee
im Friedrich-Loeffler-Institut
Experimentelle Untersuchungen zur Transgenese
bei Nutztieren
Habilitationsschrift
zur Erlangung der Venia legendi
an der Stiftung Tierärztliche Hochschule Hannover
Vorgelegt von
Dr. rer. nat. Wilfried August Kues
Hannover 2008
1

2
Für und mit Brigitte

Inhaltsverzeichnis
1.0 Eigene Publikationen zur Thematik dieser Habilitationsschrift 4
1.1 Charakterisierung primärer Zellen als Donorzellen für den Kerntransfer 4
1.2 DNA-Mikroinjektion und somatischer Kerntransfer 4
1.3 Übersichtsartikel: Transgene Nutztiere, Stammzellen und DNA-Array Analysen 5
2.0 Einleitung 6
2.1 Die DNA als Träger der genetischen Information und reverse Genetik 6
2.2 Erstellung transgener Nutztiere 8
2.3 Transgene Schweine als Zell- und Organdonoren für die Xenotransplantation 10
2.4 Pharming: Produktion rekombinanter Proteine in der Milchdrüse 12
2.5 Transgene Tiere für landwirtschaftliche Nutzungen 13
2.6 Neuere Methoden der Transgenese 14
2.6.1 Klonen durch somatischen Kerntransfer 14
2.6.2 Gene knock-down in Nutztieren durch RNA-Interferenz 16
2.6.3 Virus-vermittelte Transgenese 16
2.6.4 Konditionale Mutagenese 17
2.6.5 Induzierbare Promotoren und konditionale Expressionskontrolle 18
2.7 Genomprojekte und ihre Bedeutung für die Transgenese 19
2.8 Epigenetik 22
3.0 Fragestellungen 24
4.0 Ergebnisse und Diskussion 25
4.1 Primäre somatische und Stamm-Zellen als Donorzellen für den Kerntransfer 25
4.2 Gene knock-down-Versuche in transgenen Embryonen 29
4.3 Generierung transgener Schweine mit konditionaler Transgenregulation 32
5.0 Zusammenfassung 39
6.0 Literaturverzeichnis 40
7.0 Danksagungen 54
8.0 Darstellung des eigenen Anteils an den wissenschaftlichen Arbeiten 55
9.0 Abkürzungsverzeichnis 59
10.0 Anhang: Nachdruck der eigenen Publikationen 60
3

1.0 Eigene Publikationen zur Thematik dieser Habilitationsschrift
1.1 Charakterisierung primärer Zellen als Donorzellen für den Kerntransfer
Anger, M., Kues, W.A., Klima, J., Mielenz, M., Motlik, J., Carnwath, J.W. and Niemann, H.
2003. Cloning and cell cycle-specific regulation of Polo-like kinase in porcine fetal
fibroblasts.
Molecular Reproduction and Development 65, 245-253.
Kues, W. A., Petersen, B., Mysegades, W., Carnwath, J.W. and Niemann, H. 2005. Isolation
of fetal stem cells from murine and porcine somatic tissue.
Biology of Reproduction 72, 1020-1028
Yadav, P., Kues, W.A., Herrmann, D., Carnwath, J.W., Niemann, H. 2005. Bovine ICMs
express the Oct4 ortholog.
Molecular Reproduction and Development 72, 182-190.
Dieckhoff, B., Karlas, A., Hofmann, A., Kues, W.A., Petersen, B., Pfeifer, A., Niemann, H.,
Kurth, R., Denner, J. 2007. Inhibition of porcine endogenous retroviruses (PERVs) in primary
porcine cells by RNA interference using lentiviral vectors.
Archives of Virology 152, 629-34.
1.2 DNA-Mikroinjektion und somatischer Kerntransfer
Schätzlein S., Lucas-Hahn, A., Lemme, E., Kues, W.A., Dorsch, M., Manns, M., Niemann,
H., Rudolph, K.H. 2004. Telomere length is reset during early embryogenesis.
Proceedings of the National Academy of Sciences of the USA 101, 8034-8038.
Hölker, M., Petersen, B., Hassel, P., Kues, W.A., Lemme, E., Lucas-Hahn, A., Niemann, H.
2005. Duration of in vitro maturation of recipient oocytes affects blastocyst development of
cloned porcine embryos.
Cloning and Stem Cells 7, 34-43.
Kues, W.A., Schwinzer, R., Wirth, D., Verhoeyen, E., Lemme, E., Herrmann, D., Barg-Kues,
B., Hauser, H., Wonigeit, K., Niemann H. 2006. Epigenetic silencing and tissue independent
expression of a novel tetracycline inducible system in double-transgenic pigs.
FASEB Journal 20, E1-E10, doi: 10.1096/fj.05-5415fje.
Deppenmeier, S., Bock, O., Mengel, M., Niemann, H., Kues, W., Lemme, E., Wirth, D,
Wonigeit, K., Kreipe, H. 2006. Health status of transgenic pig lines expressing human
complement regulator protein CD59.
Xenotransplantation 13, 345-356.
Hornen, N., Kues, W.A., Carnwath, J.W., Lucas-Hahn, A., Petersen, B., Hassel, P., Niemann,
H. 2007. Production of viable pigs from fetal somatic stem cells.
Cloning and Stem Cells 9, 364-73.
Iqbal, K, Kues, W.A., Niemann, H. 2007. Parent of origin dependent gene-specific knock
down in mouse embryos.
Biochemical and Biophysical Research Communications 358, 727-732.
4

Dieckhoff, B., Petersen, B., Kues, W.A., Kurth, R., Niemann, H., Denner, J. 2008.
Knockdown of porcine endogenous retrovirus (PERV) expression by PERV-specific shRNA
in transgenic pigs.
Xenotransplantation 15, 36-45.
1.3 Übersichtsartikel: Transgene Nutztiere, Stammzellen und DNA-Array Analysen
Niemann, H., und Kues, W.A. 2003. Application of transgenesis in livestock for agriculture
and biomedicine.
Animal Reproduction Science 79, 291-317.
Kues, W.A. und Niemann, H. 2004. The contribution of farm animals to human health.
Trends in Biotechnology 22, 286-294.
Kues, W.A., Carnwath, J.W., Niemann, H. 2005. From fibroblasts and stem cells:
Implications for cell therapies and somatic cloning.
Reproduction, Fertility and Development 17, 125-134.
Niemann H, Kues W, Carnwath JW. 2005. Transgenic farm animals: present and future.
OIE Scientific and Technical Reviews (Rev. Sci. Tech. Off. Int. Epiz.) 24, 284-298.
Niemann, H. und Kues, W.A. 2007. Transgenic farm animals – an update.
Reproduction, Fertility and Development 19, 762-770.
Niemann, H., Carnwath, J.W., Kues, W.A. 2007. Application of array technology to
mammalian embryos.
Theriogenology 68S, S165-S177.
Kues, W.A., Rath, D., Niemann, H. 2008. Reproductive biotechnology goes genomics.
CAB Reviews: Perspectives in Agriculture, Veterinary Science, Nutrition and Natural
Resources 3, No. 036, 1-18.
5

2.0 Einleitung
2.1 DNA als Träger der genetischen Information und reverse Genetik
Die Desoxyribonucleinsäure (DNS, bzw. DNA) ist der Träger der genetischen Information.
DNA wurde 1869 erstmals von Friedrich Miescher aus Eiterzellen isoliert, ihre biologische
Funktion als Informationsträger wurde aber erst 1944 durch Transformation von
Pneumokokken gezeigt (Avery et al., 1944). Die Aufklärung der DNA-Molekülstruktur als
Doppelhelix (Watson und Crick, 1953) erlaubte erstmals einen Einblick, wie biologische
Information gespeichert, repliziert und abgelesen wird und bildete eine wichtige Grundlage
für die Entwicklung der Molekularbiologie.
Seit ca. 1970 wurde es möglich, in kurzen DNA-Stücken die Basenabfolge zu bestimmen
(DNA-Sequenzierung), sowie DNA-Stücke gezielt neu zusammen zu setzen und die
Eigenschaften der rekombinanten DNA in vitro und in verschiedenen einfachen
Modellorganismen, vorwiegend Escherichia coli (E. coli), oder in eukaryotischen Zell-Linien,
zu testen (Sanger et al., 1973; Maxam und Gilbert, 1977; Sanger et al., 1977; Jackson et al.,
1972; Johnson, 1983; Watson et al., 1983, Mulligan et al., 1979). So konnten grundlegende
molekulare Eigenschaften der DNA wie der Aufbau von Genen, regulatorischen Sequenzen
(Promotor, Enhancer, Silencer) und die Intron-Exon-Organisation eukaryotischer Gene
aufgeklärt werden (Glover, 1985; Sambrook et al., 1989). Ein Standardverfahren in E.coli ist
die Transformation mit ringförmigen DNA-Molekülen (Plasmide), die eine Antibiotika-
Resistenz und einen Startpunkt für die Replikation (origin of replication) in ihrer Sequenz
tragen. Zusätzlich kann Fremd-DNA in ein Plasmid ligiert werden, typischerweise 1 000 – 20
000 Basenpaare (1-20 kBp). Die Plasmide liegen episomal in E. coli vor und werden bei jeder
Zellteilung repliziert (Glover, 1985; Sambrook et al., 1989). Falls die Fremd-DNA
prokaryotische Promotorelemente und eine protein-kodierende Sequenz enthält, wird diese
Information abgelesen und das rekombinante Protein exprimiert. Zahlreiche Medikamente
werden mittlerweile rekombinant in Bakterien hergestellt. Humanes Insulin,
Wachtumshormon, Erythropoietin und Interferon sind die umsatzstärksten Medikamente
(Blockbuster) mit jeweils mehr als 1 Milliarde $ Umsatz pro Jahr (Nightingale und Martin,
2004). In Prokaryoten erfolgt im wesentlichen eine direkte Ablesung der genetischen
Information, im Eukaryoten liegt eine wesentlich komplexere Regulation der Genaktivität
vor, die bisher erst teilweise entschlüsselt ist.
6

Bereits 1971 wurden durch Inkubation von Spermien mit Fremd-DNA transgene Embryonen
erstellt (Brackett et al, 1971), bzw. durch Infektion präimplantatorischer Maus-Embryonen
mit Simian Virus 40 (Jaenisch und Mintz, 1974) oder Moloney Leukemia-Viren (Jaenisch,
1976) transgene Mäuse erzeugt, die die Fremd-DNA in ihr Genom integriert hatten, und an
ihre Nachkommen weitergaben. Trotz Veränderung des Genotyps (reverse genetics) dieser
Tiere, wurden keine phänotypischen Veränderungen gezeigt.
Der erste Nachweis, dass eine rekombinante DNA-Sequenz eine phänotypische Änderung im
Säuger zur Folge hatte, wurde 1982 publiziert (Palmiter et al. 1982, Abb.1). Diese Arbeit ist
ein Meilenstein in der Genetik und die Grundlage für ein vertieftes molekulares Verständnis
der Gen-Phänotyp-Beziehung und für transgene Forschungsansätze, die darauf abzielen, die
komplexe Genregulation in Eukaryoten und speziell in Säugern zu verstehen. In dieser Arbeit
wurde ein Expressionskonstrukt mit dem Metallothionein-Promoter und der cDNA des
Rattenwachstumshormons (rGH) verwendet. Das aufgereinigte DNA-Expressionskonstrukt
wurde dann direkt in den männlichen Vorkern von Mauszygoten injiziert, die anschließend in
den Eileiter von scheinschwangeren Empfängertieren übertragen wurden.
Abb. 1. Verstärktes Wachstum in transgenen Mäusen.
Transgene Maus (links), in der die Expression des Ratten-Wachstumshormongens zu verstärktem Wachstum
führt; zum Vergleich ein nicht-transgenes Geschwistertier (rechts) (Palmiter et al., 1982).
Die Integration der rGH-Sequenz in das Mausgenom wurde in den Nachkommen durch
Southern blot-Nachweis mit einer markierten komplementären Sonde gezeigt. Die transgenen
7

Tiere zeigten phänotypisch ein verstärktes Wachstum, das durch die erhöhten Serumspiegel
des Wachstumshormons hervorgerufen wurde.
Transgene Mausmodelle sind mittlerweile ein Standardwerkzeug der molekularbiologischen
Forschung geworden, sie werden für das Verständnis genetischer Erkrankungen, wie
Parkinson, Alzheimer, Trisomie 21, sowie die Entwicklung von Therapiemöglichkeiten in der
Immunologie, der Krebsforschung und der Grundlagenforschung verwendet (Dodart und
May, 2005; Yang und Gong, 2005; Scharschmidt und Segre, 2008). Insbesondere die
Möglichkeit über murine embryonale Stammzellen (ES) gezielt spezifische Gene
auszuschalten (Gene knock-out) hat die Anwendungsfelder der reversen Genetik vergrößert
(Mansour et al., 1988; Capecchi, 1989; Götz et al., 1998; Müller, 1999). Weitere
Verfeinerungen des Methodenrepertoires sind die konditionale Expression von Transgenen
über Rekombinasen (z.B. Cre/loxP-System), die konditionale Expression von binären
Expressionskassetten (tet-on, tet-off) oder die RNA-Interferenz (RNAi) mittels kurzer
doppelsträngiger RNAs (siRNA oder shRNA) (Orban et al., 1992; Gu et al., 1994; Furth et
al., 1994; Zhou et al., 2006).
Allerdings hat das Mausmodell neben zahlreichen Vorteilen auch Beschränkungen, die sich
insbesondere aus den gravierenden anatomischen und physiologischen Unterschieden
zwischen Maus und Mensch ergeben (Habermann et al., 2007; Wall und Shani, 2008; Taft,
2008). Daher ist das Mausmodell für spezifische Fragestellungen, z.B. in
Transplantationsmedizin, Kreislauf/Bluthochdruckforschung oder Gerontologie aufgrund der
geringen Größe und kurzen Lebensdauer nur sehr bedingt aussagekräftig.
2.2 Erstellung transgener Nutztiere
Transgene Nutztiere stellen für spezifische biomedizinische Fragestellungen eine interessante
Alternative zum Mausmodell dar. Hierzu zählen insbesondere Xenotransplantation, Pharming
(Produktion rekombinanter Proteine in der Milchdrüse), Bluthochdruck- und Altersforschung.
Auch in der Landwirtschaft kann eine gezielte genetische Veränderung von Nutztieren
wesentliche Vorteile für eine effizientere und ressourcenschonendere Produktion haben (Wall,
1996).
Die ersten genetisch veränderten Schweine, Schafe und Kaninchen wurden 1985 durch DNA-
Mikroinjektion in Zygotenstadien erstellt (Hammer et al., 1985, Brem et al., 1985). In der
Folgezeit wurde über transgene Ansätze versucht, verschiedene Eigenschaften von Nutztieren
zu verbessern: Wachstum und Futterverwertung (Pursel, 1998; Golovan et al., 2001),
Milchleistung (Zuelke, 1998; Brophy et al., 2003), Wolleigenschaften (Damak et al., 1996),
8

sowie Reproduktion und Krankheitsresistenz (Müller et al., 1992; Clements et al., 1994;
Müller und Brem, 1994; Wolf et al., 2000). Als wesentlicher Nachteil dieses Verfahrens
erwies sich, dass die Erfolgsrate transgener Nachkommen mit durchschnittlich 5-10% der
geborenen Tiere sehr gering ist (Abb.2). Bezogen auf die mikroinjizierten Embryonen liegen
die Erfolgsraten bei 1-3% (Abb.2). Im Gegensatz zur Maus, weisen Zygoten von Rind und
Schwein einen sehr hohen Anteil von Lipiden auf, die die DNA-Mikroinjektion in
Zygotenvorkerne erschweren. Nur durch zusätzliche Schritte, wie Zentrifugation der Zygoten,
können die Vorkerne dargestellt werden (Abb.3). Erschwerend kommt hinzu, dass von den
transgenen Trägertieren (founder animals) nur ein Teil das Transgen vererbt
(Keimbahntransmission) und die gewünschte Expression aufweist (Hogan et al., 1996). Da
die Fremd-DNA zufallsmäßig in das Genom integriert, können Mosaik-Integration,
insertionale Mutationen, variable Kopienzahlen des Transgens und variable Expression durch
Positionseffekte benachbarter DNA-Sequenzen auftreten (Hogan et al., 1986; Deppenmeier et
al., 2006).
Maus
Kaninchen
Schwein
Schaf
Rind
0 5 10 15 [%]
Abb. 2. Effizienz der DNA-Vorkerninjektion in verschiedenen Säugerspezies.
Die Transgenese-Effizienz ist als relativer Anteil der transgenen Tieren an den geborenen Nachkommen
(gestrichelte Säulen) und an den DNA-injizierten und auf Empfängertier übertragenen Embryonen (schwarze,
gefüllte Säulen) angegeben (verändert nach Wall, 1996).
In den letzten Jahren wurde deutlich, dass an der komplexen Regulation der Genomaktivität
in Eukaryoten auch zahlreiche sogenannte epigenetische Mechanismen (Epi-Genetik =
„Über“-Genetik) beteiligt sind (Reik, 2007). Als Epigenetik bezeichnet man vererbbare
Eigenschaften, die nicht direkt in der DNA-Sequenz verankert sind. Relativ gut untersucht
sind Methylierungen der Cytosin-Base in CG-Dinukleotiden (CpG) bei Säugern, sowie
9

Methylierungen, Azetylierungen und Phosphorylierungen der Histon-Proteine (Chandler und
Jones, 1988; Bird, 1992; Li, 2002; Maatouk et al., 2006).
Bedingt durch die hohen Kosten für die Erstellung transgener Nutztiere, die erforderliche
umfangreiche Logistik und die langen Reproduktionszeiten, fokussierte sich die Forschung im
wesentlichen auf biomedizinisch relevante Gebiete wie Xenotransplantation und Pharming.
Insbesondere bei Nutztieren, aber auch in der Maus sind die Probleme der Transgenese mit
häufig ungenügender Expression, oder ektopischer Expression nur teilweise verstanden.
Gegenwärtig ist es aufgrund der unzureichenden Vorhersagbarkeit der transgenen Expression,
immer noch notwendig, zahlreiche Linien auf die gewünschten Expressionseigenschaften zu
untersuchen. Bei der Maus stellt das aufgrund der kurzen Generationszeiten und der relativ
geringen Kosten kein grundlegendes Problem dar, bei Nutztieren ergeben sich enorme Kosten
bei der Erstellung und Charakterisierung. Es wird geschätzt, dass die Kosten für die
Erstellung eines transgenen Rindes ca. 100 000 $ betragen, bei Schweinen werden Kosten
von ca. 25 000 $ genannt (Wall, 1996).
A B
Promotor Transgen-cDNA Poly(A)
Abb. 3. DNA-Mikroinjektion in einen Vorkern einer porcinen Zygote.
A) Nach Zentrifugation bei 10 000 g ist die undurchsichtige Lipidfraktion des Zytoplasmas in einer Zellhälfte
konzentriert. In einen der dadurch sichtbar gewordenen Vorkerne wird mit Hilfe einer Mikrokapillare (rechte
Bildhälfte) die DNA-Lösung injiziert. B) Schematische Darstellung eines Minigen-DNA-Konstrukts bestehend
aus einem Promotor, einer protein-kodierenden cDNA und einer Polyadenylierungssequenz, die die Stabilität der
abgelesenen mRNA erhöht.
Daraus ergibt sich, dass für einen breiteren Einsatz der Transgenese bei Nutztieren, die
Effizienz der Transgenese erhöht und die Kosten deutlich sinken müssen. Trotz dieser
Schwierigkeiten sind in den letzten Jahren wesentliche Fortschritte in der Erstellung
transgener Nutztiere erzielt worden.
2.3 Transgene Schweine als Zell- und Organdonoren für die Xenotransplantation
Die Erfolge der Allotransplantation, d.h. die Transplantation humaner Organe in Patienten mit
Organausfall, hat zu einer dramatischen Verknappung der verfügbaren Organe geführt. Selbst
10

eine verbesserte Allokation und die Lebendspende von Organen können den Bedarf bei
weitem nicht decken (Deutsche Stiftung Organtransplantation: www.dso.de). In Deutschland
stehen ca. 12 000 Patienten auf der Warteliste für eine Nierentransplantation, pro Jahr sind
aber nur knapp 4 000 Spendernieren verfügbar. Für andere Organe, wie Herz, Leber und
Lunge können mit den verfügbaren Spenderorganen jeweils nur ein Drittel bis die Hälfte der
notwendigen Transplantationen durchgeführt werden. Aufgrund der Organmangelsituation
versterben in Deutschland pro Tag im Durchschnitt drei Patienten auf der Warteliste an
akutem Organversagen.
Eine mögliche Alternative stellt die Transplantation von Tierorganen (Xenotransplantation)
dar (White, 1996; Bach, 1998, Niemann und Kues, 2000). Wesentliche Voraussetzungen für
klinische Studien mit Xenotransplantaten sind, dass die immunologischen
Abstoßungsreaktionen vermindert oder überwunden werden können, die Übertragung von
Tierpathogenen ausgeschlossen werden kann, und eine weitgehende physiologische
Kompatibilität zu dem entsprechenden Humanorgan besteht. Das Schwein stellt dabei die am
besten geeignete Spezies dar, da die technischen Möglichkeiten zur genetischen Modifikation
des Schweinegenoms vorhanden sind, die Haltung unter kontrollierten Bedingungen in
spezifisch pathogenfreien (SPF) oder gnotobiotischen Anlagen etabliert ist, aufgrund der
multiparen Reproduktion sehr schnell zahlreiche Nachkommen erzeugt werden können und
eine grosse Ähnlichkeit in der Physiologie und Anatomie zum Menschen bestehen (Niemann
und Kues, 2000).
Bisher sind im wesentlichen transgene Schweine mit Expression humaner
Komplementregulatoren (regulators of complement activation – RCA) (McCurry et al., 1995;
Cozzi et al., 1997; Zaidi et al., 1998; Niemann et al., 2001), bzw. mit einem Gene knock-out
der α-1,3-Galactosyltransferase (Dai et al. 2002; Lai et al., 2002) für Xeno-
transplantationsmodelle produziert worden. Beide methodischen Ansätze setzen auf
molekularer Ebene auf der Unterdrückung der hyperakut ablaufenden Komplement-
vermittelten Abstoßung an (Yang-Guang und Sykes 2007; Zhong, 2007). Nach
Xenotransplantation von RCA-transgenen, bzw Gal-knock-out Nieren und Herzen in nicht-
humane Primaten wurden maximale Überlebenszeit von 179 Tagen erreicht, die medianen
Überlebenszeiten liegen aber deutlich unter 60 Tagen (McGregor et al., 2004; Kuwaki et al.,
2005; Yamada et al., 2005). Obwohl die geringen Transplantationszahlen keine statistisch
signifikanten Aussagen erlauben, wird angenommen, dass zu den bisherigen genetischen
Modifikationen weitere Transgene in das Schweinegenome eingeführt werden müssen, um die
nachfolgenden Abstoßungsreaktionen, wie die akut vaskuläre Abstoßung (AVR) und die
11

zelluläre Abstoßung kontrollieren können und dadurch längere Überlebenszeiten zu
ermöglichen.
2.4 Pharming: Produktion rekombinanter Proteine in der Milchdrüse
2006 wurde von der European Medicine Agency (EMEA) erstmalig ein rekombinantes
Protein aus der Milchdrüse als Medikament zugelassen (Niemann und Kues, 2007).
Rekombinantes humanes Antithrombin III wird in der Milch transgener Ziegen produziert
und ist zunächst für die prophylaktische Behandlung von Patienten mit Antithrombindefizienz
vorgesehen. Inzwischen ist die Entwicklung fortgeschritten und zahlreiche weitere
rekombinante Proteine aus der Milchdrüse von Kaninchen, Ziegen, Schafen oder Kühen
befinden sich in der klinischen Prüfung (Tab.1).
Tab. 1: Entwicklungsstand in der Produktion rekombinanter Proteine aus der Milchdrüse von Nutztieren
Rekombinantes Protein Hersteller Tierart Klinische Prüfung
humanes Antithrombin III GTC Biotherapeutics Ziege EU: zugelassen
(Produktname: ATryn) USA: Phase 3
C1 Estera se Inhibitor Pharming Kaninchen Phase 3
MM-093 (AFp) Merrimack und GTC Ziege Phase 2
α-Glucosidase Pharming Kaninchen Phase 2 (gestoppt)
humanes Wach stumshormon BioSidus Rind Vorklinisch
Albumin GTC Biotherapeutics Rind Vorklinisch
Fibrinogen Pharming Rind Vorklinisch
Collagen Pharming Rind Vorklinisch
Lactoferrin Pharming Rind Vorklinisch
α-1 Antitrypsin GTC Biotherapeutics Ziege Vorklinisch
Malaria-Vakzin GTC Biotherapeutics Ziege Vorklinisch
CD137 monoklonaler AK GTC Biotherapeutics Ziege Vorklinisch
(verändert nach Echelard et al., 2006)
Die Milchdrüse weist für die rekombinante Proteinproduktion eine Reihe von Vorteilen auf.
So können Prokaryoten keine posttranslatorischen Glykosylierungen durchführen, die für die
Aktivität zahlreicher eukaryotischer Proteine notwendig sind. Die Produktion komplexer
Proteine in eukaryotischen Zellkulturen ist häufig nur mit geringer Syntheseleistung und
Ausbeute möglich und entsprechend kostenaufwendig. Die Milchdrüse ist für hohe
metabolische Syntheseraten von Proteinen ausgelegt, Milch kann durch Melken einfach
gewonnen und für die Aufreinigung der rekombinanten Proteine verwendet werden (Rudolph,
1999; Echelard et al., 2006).
12

2.5 Transgene Tiere für landwirtschaftliche Nutzungen
Tabelle 2 zeigt eine Zusammenfassung der wichtigsten transgenen Ansätze zur Verbesserung
von Nutztieren für die landwirtschaftliche Produktion. So sind transgene Schweine erstellt
worden, die ein Desaturase-Gen im Fettgewebe produzieren und dadurch ein höheres
Verhältnis von vielfach ungesättigten zu gesättigten Fettsäuren im Muskelfleisch aufweisen
(Saeki et al., 2004; Lai et al., 2006). Insbesondere Omega-3-Fettsäuren wurden vermehrt
gebildet. Eine Diät mit hohem Anteil ungesättigter Fettsäuren wird mit einem verminderten
Risiko für Herzkreislauferkrankungen korreliert, und daher von den Gesundheitsbehörden
empfohlen.
Die Expression von bovinem Lactalbumin in der Milchdrüse von Schweinen führte zu einem
höheren Laktose-Gehalt und erhöhter Milchproduktion, was wiederum zu besseren
Entwicklungsraten der neugeborenen Ferkel führte (Wheeler et al., 2001). Durch die
Expression bakterieller Phytase in der Speicheldrüse von Schweinen können diese Tiere sonst
unverdaubares pflanzliches Phytat metabolisieren (Golovan et al., 2001). Dadurch wird die
Phosphat-Belastung in der Gülle signifikant vermindert.
Tab. 2 Transgene Nutztiere für landwirtschaftlich wichtige Merkmale
Tierart Transgen/Konstrukt Phänotyp Methode Referenz
Schwein Wachstumshormon/hMT-pGH verbessertes Wachstum, weniger Körperfett Mikroinjektion Nottle et al., 1999
Schwein Insulin-like Wachstumsfaktor verbessertes Wachstum Mikroinjektion Pursel et al., 1999
Schwein Desaturase/maP2-FAD erhöhte Werte für mehrfach ungesättigte Fettsäuren Mikroinjektion Saeki et al., 2004
Schwein Desaturase/CAGGS-hfat-1 erhöhte Werte für mehrfach ungesättigte Fettsäuren somatischer Kerntransfer Lai et al., 2006
Schwein Phytase/PSP-APPA Phytat-Metabolisierung Mikroinjektion Golovan et al., 2001
Schwein Laktalbumin/genomische DNA erhöhter Laktosegehalt der Milch Mikroinjektion Wheeler et al. 2001
Schwein Mx-Protein/mMx1-Mx Influenza-Resistenz Mikroinjektion Müller et al., 1992
Schwein/Schaf IgA/a,K-a,K Pathogen-Resistenz Mikroinjektion Lo et al., 199
Schaf Insulin-like Wachstumsfaktor Wollwachstum Mikroinjektion Damak et al., 1996
Schaf PRNP knock-out-Konstrukt Scrapie-Resistenz (Tiere neonatal verstorben) somatischer Kerntransfer Denning et al. 2001
Ziege Stearoyl-CoA Desaturase veränderte Milchzusammensetzung Mikroinjektion Reh et al., 2004
Rind Kaseine/genomische DNA veränderte Milchzusammensetzung somatischer Kerntransfer Brophy et al., 2003
Rind Lysostaphin Staphylococcus aureus-Resistenz somatischer Kerntransfer Wall et al., 2005
(verändert aus Niemann und Kues, 2007)
Der Einsatz dieser Tiere in der kommerziellen Fleischproduktion würde den kostspieligen
Futterzusatz von rekombinanten Phytasen oder organischem Phosphor vermeiden und einen
wesentlichen Beitrag zu verminderten Phosphat-Emissionen liefern.
Über Gene knock-out und Gene knock-down-Techniken wurden Rinder mit einer Deletion
des Prionprotein-Gens (PRNP), bzw. mit signifikant verminderten PRNP-mRNA-Werten
erstellt (Kuroiwa et al., 2004; Golding et al., 2006; Richt et al., 2007). Diese sollten genetisch
13

esistent gegen die bovine spongiforme Enzephalitis (BSE) sein, erste Ergebnisse aus in vitro
Versuchen scheinen diese Resistenz zu bestätigen (Richt et al., 2007). BSE-resistente Rinder
sind insbesondere für das Pharming von Interesse, da hier alle Produktionsschritte nach Good
Manufacturing Practices (GMP) durchgeführt werden müssen, und Freiheit von möglichen
Pathogenen gewährleistet sein muss.
Bisher sind keine transgenen Tiere für die landwirtschaftliche Produktion zugelassen.
Mittlerweile werden transgene Zierfische kommerziell in den USA, Hong Kong, Taiwan und
Malaysia gehandelt (Niemann und Kues, 2007). Bei den Medaka (Oryzias latipes) und
Zebrabärblingen (Danio rerio) werden verschiedene fluoreszente Proteine im Muskelgewebe
exprimiert (Chou et al., 2003; Gong et al., 2003), die die Eigenfärbung der Fische
überstrahlen. Ein Bericht der Food and Drug Administration der USA (FDA, 2003) stellte
fest, dass diese transgenen Fische unbedenklich sind. Die transgenen Zierfische können
möglicherweise zu einer veränderten Einstellung der Öffenlichkeit gegenüber gentechnisch
veränderten Tieren beitragen.
2.6 Neuere Methoden der Transgenese
2.6.1 Klonen durch somatischen Kerntransfer
1997 wurde erstmals das erfolgreiche Klonen eines Säugers über den Kerntransfer einer
somatischen Zelle in eine entkernte Oozyte beschrieben (Wilmut et al., 1997). Damit wurde
gezeigt, dass somatische Zellen grundsätzlich reprogrammierbar sind und nach
Reprogrammierung eine komplette Ontogenese durchlaufen können. In der Folge wurde das
somatische Klonen zu einer Schlüsseltechnik für die Grundlagenforschung, um Prozesse der
Reprogrammierung, der Pluripotenz und der zellulären Differenzierung untersuchen zu
können. Daneben wird das Klonen von genetisch wertvollen Tieren durch somatischen
Kerntransfer mittlerweile kommerziell angeboten (Panarace et al., 2006).
Ein weiterer wichtiger Aspekt ist, dass über das Klonen auch transgene Ansätze ermöglicht
wurden, die zuvor im Nutztier nicht verfügbar waren (Cibelli et al., 1998). So können in der
Maus über etablierte ES-Zellen Gene knock-out-Mutanten erhalten werden. Für Nutztiere sind
bis heute keine echten ES-Zellen isoliert worden, und die klassische Knock-out-Technik ist
daher nicht verfügbar. Mit dem somatischen Klonen eröffnet sich die Möglichkeit, zunächst
einen Gene knock-out in primären somatischen Zellen durchzuführen (Schnieke et al., 1997;
Dai et al., 2002; Lai et al., 2002), und vorselektionierte Zellen mit Knock-out dann als
Kernspenderzellen einzusetzen (Kolber-Simonds et al., 2004; Abb. 4).
14

Über die homologe Rekombination in primären Fibroblasten wurden Schafe mit einem Gen-
knock-out für das Prion Protein (PRNP) geklont, die allerdings kurz nach der Geburt
verstarben (Denning et al., 2001). Im Rind konnten vitale Tiere mit PRNP-knock-out erhalten
werden (Kuroiwa et al., 2004; Richt et al., 2007). Im Schwein wurden Knock-out Tiere für die
α-1,3- Galaktosyltransferase erstellt (Dai et al., 2002; Lai et al., 2002), die in der
Xenotransplantation eine wesentliche Rolle spielt (siehe 2.3).
Targeting-Konstrukt
Elektroporation
homologe Rekombination
Zweite
Durchmusterung
auf ein „loss of
heterozygosity“-
Ereignis
Isolation rekombinierter
Zellklone
Gen knock-out Tier
Somatischer Kerntransfer
Embryotransfer auf
synchronisiertes
Empfängertier
15
-/-
entkernte Oozyte
Abb.4 Erstellung von Gene knock-out Schweinen durch somatischen Kerntransfer (mod. aus Niemann u. Kues,
2003)
Über einen sogenannten Gene knock-in wurde der Blutgerinnungsfaktor IX gezielt in einen
aktiven Genbereich des ovinen Genoms integriert und anschließend über den somatischen
Kerntransfer vitale Schafe geklont (Schnieke et al., 1997).
Das somatische Klonen hat entscheidende Vorteile für die Transgenese von Nutztieren.
Allerdings sind neben dem hohen mikromanipulatorischen Aufwands für den Kerntransfer
(Du et al., 2005) auch neue Probleme (Young et al., 1998; DeSousa et al., 2001) und Kosten
entstanden. So war die ursprüngliche Ansicht, dass nur Zellen in der G0 oder G1-Phase des
Zellzyklus als Kernspender geeignet seien (Wilmut et al., 1997). Dies scheint aber aus
heutiger Sicht für den Klonerfolg nicht entscheidend zu sein. Auch die Frage, ob es

Unterschiede verschiedener somatischer Zellen in Bezug auf Differenzierungsgrad,
Ausgangsgewebe, oder Passagenzahl in vitro gibt, ist nicht abschließend geklärt (Kues et al.,
2000; Kues et al., 2005b). Bei der Maus konnte gezeigt werden, dass auch terminal
ausdifferenzierte Zellen aus dem Nerven- und Blutsystem zu Klonnachkommen führen
können (Hochedlinger und Jaenisch, 2002; Eggan et al., 2004), allerdings mit stark reduzierter
Effizienz verglichen zu Fibroblasten. Porcine fetale Stammzellen und Fibroblasten zeigten
ähnliche Kloneffizienzen (Hornen et al., 2007). Fibroblasten dienen in den meisten
Klonversuchen als Kerndonoren. Fibroblasten sind relativ leicht zu kultivieren und benötigen
keine Supplementation mit spezifischen Wachstumsfaktoren in der in vitro Kultur. Allerdings
handelt es sich hier stets um heterogene Zellpopulationen mit beschränkter Proliferation in
vitro (Hayflick, 1965).
2.6.2 Knock-down in Nutztieren durch RNA interference
Eine Alternative zum klassischen Gene knock-out ist der Gene knock-down, bei dem über
RNA-Interferenz eine Degradation von spezifischen mRNAs erreicht wird (Fire et al., 1998;
Jorgensen et al., 1998; Sharp, 2001). Bei Säugern werden dabei kurze doppelsträngige RNAs
(17-25 Bp), sogenannte short interfering RNA (siRNA), bzw. short hairpin RNA (shRNA),
vom RNA-Induced Silencing Complex (RISC) gebunden, und mRNAs mit komplementären
Sequenzbereichen selektiv degradiert (Elbashir et al., 2001). Man vermutet, dass der RNAi-
Mechnismus neben der Genregulation vor allem eine Funktion in der Virusresistenz hat.
Durch das zelluläre Dicer-Enzym werden doppelsträngige RNAs, wie sie in RNA-Viren als
Genom vorkommen, erkannt und zu siRNAs prozessiert. Diese „maßgeschneiderten“
virusspezifischen siRNAs führen dann zu einer Degradation von viralen mRNAs.
Für die Transgenese können siRNA-Expressionskonstrukte in das Genom eingebracht werden
und den funktionellen Verlust eines spezifischen Transkriptes bewirken. Da keine
Veränderung auf der Ziel-DNA-Sequenz notwendig ist, ist eine Zucht auf Homozygotie, wie
bei Gene knock-out Ansätzen nicht notwendig (Tenenhaus-Dann et al., 2006). In
Kombination mit neuartigen Vektoren für die Transgenese, wie Lentiviren, ist damit im
Prinzip eine direkte genetische Veränderung von Produktionslinien von Nutztieren möglich.
2.6.3 Virus-vermittelte Transgenese
Die ersten viralen Ansätze zur Transgenese bei Mäusen mit SV40 oder Moloney Leukemia-
Virus (Jaenisch und Mintz, 1974; Jaenisch, 1976) und mit Retroviren bei Rindern (Haskell
and Bowen, 1995; Chan et al., 1998) führten zu Tieren, die die Fremd-DNA im Genom
16

integriert trugen; die Fremd-DNA war jedoch stillgelegt (DNA silencing) und die Tiere damit
phänotypisch unverändert. In den letzten Jahren zeigte sich, dass Lentiviren, eine Unterklasse
der Retroviren, deutlich bessere Vektoren für die Erstellung transgener Mäuse und Nutztiere
darstellen (Pfeifer et al., 2002; Hofmann et al., 2003 u. 2004; Whitelaw et al., 2004). So
können transgene Tiere direkt durch Injektion der Lentiviren in den perivitellinen Raum von
Zygotenstadien erzeugt werden. Dabei wurde eine sehr hohe Rate transgener Nachkommen
beobachtet, in denen eine aktive Expression der Transgene festgestellt wurde. Offenbar
kommt es durch die veränderte Zusammensetzung der terminalen Repeat-Bereiche bei den
Lentiviren nicht zu einem DNA-Silencing im Säugergenom. Ein weiterer Faktor ist, dass nach
lentiviraler Infektion multiple Integrationen auf verschiedenen Chromosomen stattfinden.
Inwiefern dies zu einer höheren Rate von Integrationsmutationen führt, muss noch abgeklärt
werden.
2.6.4 Konditionale Mutagenese
Eine weitere Verfeinerung des Methodenrepertoires stellt die konditionale Mutagenese dar.
So kann ein konventioneller Gene knock-out zunächst einmal nicht räumlich oder zeitlich
beschränkt werden. Für viele Untersuchungen ist es aber wünschenswert, ein Gen zu einem
definierten Zeitpunk aus- oder anzuschalten, um z.B. kompensatorische Mechanismen, die
sich bei einem permanenten Knock-out entwickeln können, zu vermeiden. Auch können so
Gene, die essentiell für die Embryogenese sind und Letalmutationen darstellen, gezielt nach
der Geburt ausgeschaltet werden. Die Methoden für die konditionale Mutagenese sind im
wesentlichen in der Maus entwickelt worden. So ist die Cre-spezifische DNA-Rekombinase
des Bakteriophagen P1 auch in Säugerzellen aktiv und kann spezifische Rekombinationen von
DNA-Sequenzen durchführen, die von als „loxP“ bezeichneten Erkennungssequenzen
flankiert sind (Sauer, 1998). Das 38kD Cre Protein benötigt dabei keine weiteren Cofaktoren.
Je nach Orientierung der loxP-Erkennungssequenzen zueinander, kommt es dabei zur
Exzision der flankierten DNA-Region oder zur Inversion (Sauer und Henderson, 1988).
Durch das Einführen der loxP-Erkennungssequenzen in ein Zielgen und die zusätzliche
Präsenz des Cre-Gens unter der Kontrolle eines gewebespezifischen Promoters kann ein
beschränkter gewebespezifischer Knock-out erreicht werden (Orban et al., 1992; Gu et al.,
1994; St-Onge et al., 1996). Für diesen Ansatz sind zwei Linien transgener Mäuse notwendig.
Die erste Linie trägt dabei die Cre-Rekombinase unter der Kontrolle eines Promoters mit dem
gewünschten Expressionsprofil. In der zweiten Linie wird die DNA-Zielregion über
homologe Rekombination in ES-Zellen mit loxP-Sequenzen flankiert. Durch die loxP-
17

Sequenzen wird die normale Expression nicht beeinträchtigt. Durch Linien-Verpaarung
werden beide Modifikationen in einem Genom kombiniert. So zeigen DNA-Polymerase ß-
defiziente Mäuse einen embryonal-lethalen Phenotyp. Durch konditionale Mutagenese war es
möglich, lebensfähige Nachkommen mit loxP-flankiertem DNA-Polymerase ß-Gen zu
erhalten und selektiv einen Knock-out in T-Zellen zu generieren (Gu et al., 1994). Eine
wichtige Voraussetzung, um mögliche embryonal-letalen Phenotypen vorhersagen zu können,
ist die Analyse der Genexpression in frühen Entwicklungsstadien, z.B. über in situ-
Hybridisierungstechniken (Kues und Wunder, 1992; Kues et al., 1995a, b). Der Nachteil des
Cre/loxP-System und anderer Rekombinasen ist, dass die Methodik relativ aufwendig ist, und
in der Regel nur einmal eine Rekombination erfolgt.
2.6.5 Induzierbare Promotoren und konditionale Expressionskontrolle
Eine Möglichkeit für die konditionale Expressionkontrolle sind sogenannte induzierbare
Promotoren, die mittels exogener Substanzen reguliert werden können. Hierzu gehören der
Metallothioneinpromoter (Nottle et al., 1999), sowie Hitzeschock- und Steroid induzierbare
Promotoren. Jedoch hat sich gezeigt, dass diese induzierbaren Promotoren in der Transgenese
nur beschränkt nutzbar sind, da sie teilweise eine geringe Induktion zeigten, bzw. die
Induktoren unspezifische physiologische Effekte zeigten (Yarranton, 1992). Ein wesentlicher
Fortschritt wurde mit dem Tetracyclin-regulierten System erzielt (Gossen und Bujard, 1992).
Hierbei werden wiederum zwei Transgene in das Genom eingeführt (Abb.5). Ein Konstrukt
wird dabei von einem tetracycylin-sensitiven Promoter (ptTA) kontrolliert. Sobald der
rekombinante Transaktivator (tTA) an den ptTA bindet, wird das Transgen exprimiert. Der tTA
wird von einer zweiten Kassette kodiert; er ist aus zwei Domänen zusammengesetzt: einem
Virusprotein 22 (VP22)-Anteil, mit transaktivierender Funktion und einem Protein-Anteil, der
Tetracyclin binden kann (Gossen et al., 1995). Durch die Bindung von Tetracyclin kommt es
zu einer Konformationsänderung des Gesamtproteins und die DNA-Bindungsfähigkeit geht
verloren.
In dieser Situation wird der pTA nicht mehr aktiviert und das Zieltransgen abgestellt (tet-off-
System). Durch Mutagenese wurden auch tTA-Varianten entwickelt, die erst durch
Tetracyclin-Bindung aktiv an den Promoter binden (Tet-on-system, Furth et al., 1994). In
beiden Fällen werden zwei unabhängige Transgene benötigt, was für den Nutztierbereich ein
wesentliches Hindernis darstellt. Es gibt aber auch erfolgversprechende Ansätze, beide
Transgen-Kassetten auf einem Konstrukt zu verbinden (Schultze et al., 1996) und damit eine
vereinfachte konditionale Expression zu erzielen.
18

Abb.5. Konditionale Expressionskontrolle im tet-off-System
Für die konditionale Expressionskontrolle werden zwei Konstrukte benötigt. Das tetracycline responsive element
(TRE) ist vor einem minimalen Promoter (pminCMV) lokalisiert, dieser wird ohne Aktivierung nicht exprimiert.
Der Transaktivator (tTA) wird von dem zweiten Konstrukt kodiert, der tTA bindet an die TRE-Sequenz und
aktiviert die Expression. In Gegenwart von Tetracyclin, bzw. Doxycyclin (DOX) wird der tTA durch eine
Konformationsänderung inaktiviert, und die Expression des TRE-Konstruktes wird abgestellt. (mod. aus Fa.
Clontech Handbuch).
2.7 Genomprojekte und ihre Bedeutung für die Transgenese
Seit ca. 1970 werden Methoden zur schnellen Sequenzierung kurzer DNA-Fragmenten
entwickelt (Sanger et al., 1973; Maxam und Gilbert 1977; Sanger et al., 1977). Pro Reaktion
konnten maximal 400-800 Basen gelesen werden. Aufgrund des notwendigen zeitlichen und
technischen Aufwands wurden nur ausgesuchte DNA-Bereiche sequenziert. Vollständig
wurden Plasmide und kleine virale Genome mit bis zu 50 Kilobasenpaaren (kBp) sequenziert.
Ab ca. 1990 wurde die Komplettsequenzierung des humanen Genoms (HUGO-Projekt)
initiiert, zu diesem Zeitpunkt wurden die Kosten für die Sequenzierung einer Base mit ca. 1.-
US $ angenommen, hochgerechnet für ein haploides Humangenom mit 3 x 10 9 Bp ergibt dies
3 Milliarden US $. Aufgrund der extrem hohen Kosten und der verfügbaren
Sequenzierverfahren, die zu dieser Zeit im wesentlichen in „Handarbeit“ durchgeführt
19

wurden, wurde das HUGO-Projekt von vielen Wissenschaftlern zunächst als illusorisch
angesehen. Die Entwicklung automatisierter Sequenziermaschinen erlaubte innerhalb weniger
Jahre deutlich leistungsfähigere Hochdurchsatzsequenziermethoden und wesentlich reduzierte
Kosten (Bennett et al., 2005). Gegenwärtig liegen die Kosten für eine Sequenzierung eines
Säugergenoms mit einfacher Abdeckung in der Größenordnung von ca. 100 000 US $. Im
Jahr 2001 wurden die ersten Rohentwürfe der humanen Genomsequenzierung publiziert
(Lander et al., 2001). Aufgrund der Humangenomsequenz wird die Anzahl der protein-
kodierenden Gene heute mit ca. 25 000 annotiert (Goodstadt und Ponting, 2006). Einem
Drittel der Gene kann dabei eine eindeutige Funktion zugeordnet, bei einem weiteren Drittel
gibt es Vermutungen über die Funktion, und für ein Drittel liegt keine Annotationen vor.
Die durch das HUGO-Projekt begonnene Entwicklung führte zur Genomsequenzierung von
zahlreichen Organismen. So sind gegenwärtig > 1000 Prokaryoten-Genome und > 49
Eukaryoten-Genome sequenziert. Unter anderem auch die Genome von Rind (Adelson, 2008),
Hund (Lindblad-Toh et al., 2005) und Pferd (www.broad.mit.edu.mammals.horse). Für das
Schwein liegen Teilgenomsequenzierungen vor. Ein freier Zugang zu umfassenden und
annotierten Genominformationen ist über die Internet-Seiten von ENSEMBL
(www.ensembl.org), National Center for Biotechnology Information (www.pubmed.org) und
der Universität von Californien, Santa Cruz (http://genome.ucsc.edu) möglich. So sind z.B.
auf der ENSEMBL-Seite umfassende Genominformationen von 49 Eukaryoten-Spezies,
einschließlich von kompletten und Teilgenomsequenzen von Nutztieren aufgearbeitet und
direkt zugänglich. Zahlreiche Funktionen können benutzerdefiniert dargestellt und extrahiert
werden, z.B. Chromosomenlokalisation annotierter Gene, deren Exon-Intron-Struktur,
bekannte Splice-Varianten, Einzelnukleotidpolymorphismen (SNP), die Lokalisation von
CpG-reichen-Regionen (CpG-islands), der GC-Gehalt, die Position von repetitiven
Elementen. Neben zahlreichen weiteren Informationen kann direkt auf die DNA-Sequenz
zugegriffen werden. Noch nicht sequenzierte Bereiche, bzw. Sequenzdaten mit geringer
Qualität von Eukaryoten erstrecken sich im wesentlichen auf hochrepetitive
Genomabschnitte, z.B. Centromeren, Telomeren, sowie auf das Y-Chromosom.
Beispielhaft zeigt Abb. 6 ein 100 kBp-Abschnitt auf dem Rinderchromosom 2, auf dem das
Myostatin-Gen (GDF8) lokalisiert ist. Myostatin ist ein negativer Regulator des
Muskelwachstums, und eine Reduktion oder der Verlust der Myostatinaktivität führt bei
Rindern zum Doppellender-Phänotyp mit Muskelhypertrophie (Grobet et al., 1997; Kambadur
et al., 1997; McPherron und Lee, 1997). Bei zahlreichen Fleischrinderrassen, wie Blaue
20

Belgier und Piedmonteser, sind durch konventionelle Züchtung Mutationen und Deletionen
im Myostatin-Gen selektioniert worden.
Abb. 6. Schematische Darstellung des Genlocus für das bovine Myostatin-Gen (GDF8). Ein 100 kBp-Bereich
wurde aus Ensembl (www.ensembl.org) extrahiert.
Die Regulation des Muskelwachstums ist bei Säugern offenbar hochkonserviert, so wurde bei
Texel-Schafen mit hypertrophen Muskelwachstum eine Mutation im GDF8-Gen entdeckt, die
keine Veränderung des Leserasters bedingt, aber im GDF8-Transkript eine falsche
Zielsequenz für eine microRNA darstellt. Durch die RNAi-vermittelte Degradation des
Transkripts wird eine signifikante Verringerung der Myostatin-Spiegel mit entsprechendem
Phänotyp hervorgerufen (Clop et al., 2006). Beim Menschen ist eine Mutation beschrieben
worden, die das Spleißen der Prä-mRNA und den Leseraster verändert und ebenfalls zu einem
Phänotyp mit Muskelhypertrophie führt (Schuelke et al., 2004). Über ENSEMBL können die
entsprechenden syntenen Genomabschnitte dieser Spezies direkt miteinander verglichen
21

werden, bzw. in das Design von genetischen Veränderungen einfließen. Zusammen mit der
Verfügbarkeit von cDNA- und genomischen DNA-Klonen zahlreicher Spezies in öffentlichen
Genbanken (z.B. Ressourcen Zentrum Berlin, jetzt ImaGenes) ergeben sich für die
Transgenese bisher ungeahnte Möglichkeiten, so dass auch komplexe Veränderungen des
Genoms (Kuroiwa et al., 2002; Grosse-Hovest et al., 2004) wesentlich vereinfacht werden.
2.8 Epigenetik
In der Epigenetik geht es um das Verständnis, wie Information über die Genregulation, die
nicht direkt in der DNA-Sequenz kodiert ist, von einer Zell- oder Organismen-Generation in
die nächste gelangt (Reik, 2002). Spezifische epigenetische Prozesse umfassen komplexe
Genregulations-Mechanismen, unter anderem das Imprinting, das Gen-Silencing und die
Reprogrammierung. Die griechische Vorsilbe epi hat mehrere Bedeutungen, wie „nach“,
„hinterher“ oder „zusätzlich, über“. So beschreibt die Epigenetik alle Prozesse in einer Zelle,
die als „zusätzlich zu“ den Prozessen und Informationen der Genetik gelten. Die Gesamtheit
aller epigenetischen Mechanismen wird als Epigenom bezeichnet.
Es gibt verschiedene Mechanismen, die in der Epigenetik wirksam werden. Die
bestuntersuchten in Säugern sind DNA-Methylierung und Histon-Modifikationen. Bei der
DNA-Methylierung wird die Cytosin-Base in CG-Dinukleotiden an der 5-Position methyliert
(Abb. 7). Somit wird eine „fünfte“ Base eingeführt, da sich Cytosin und 5-Methyl-Cytosin
funktionell unterscheiden. Die Promoterbereiche von vielen Genen umfassen CpG-reiche
Regionen, die als „CpG islands“ bezeichnet werden. In aktiven Genen sind die CpG islands
unmethyliert, in inaktiven Genen sind die CpG islands und weitere Promoterbereiche häufig
Cytosin-methyliert. Auch beim Imprinting ist in der Regel das inaktive Allel an den CpG-
Positionen Cytosin-methyliert. Während der frühen Embryogenese kommt es zu einem
Neusetzen des größten Teils der DNA-Methylierung. So wird in der befruchteten Oozyte
zunächst die DNA des paternalen und dann die DNA des maternalen Vorkerns demethyliert.
Aufgrund der zeitlichen Aufeinanderabfolge geht man davon aus, dass die Demethylierung
des paternalen Vorkerns aktiv und die des maternalen Vorkerns passiv erfolgt (Mayer et al.,
2000 a, b). Bis zum Blastozystenstadium erfolgt dann eine aktive Remethylierung. Diese
Neusetzung der DNA-Methylierungen wird heute als ein Prozess der Reprogrammierung der
Gameten-DNA verstanden, um ein funktionelles Embryonenepigenom zu formen.
Ausgenommen von diesen DNA-Methylierungsänderungen im frühen Embryo sind geprägte
Gene (imprinted genes), die erst in der Gametogenese neu methyliert werden.
22

Abb. 7. Die DNA-Methyltransferase (DNA-MTase) katalysiert die Methylierung von Cytosin-Basen in CpG-
Dinukleotiden zu 5-Methyl-Cytosin (m 5 CpG). Dabei dient S-Adenosylmethionin (AdoMet) als Methylgruppen-
Donor (aus Heby, 1995).
Wichtige Histonmodifikationen sind Azetylierungen, Methylierungen oder
Phosphorylierungen an spezifischen Aminosäuren der Seitenkette des Histons H3 (Koipally et
al., 1999; Senawong et al., 2003; Eilertsen et al., 2008; Nandy et al., 2008). Je nach Histon-
Modifikation kann so ein komprimierter, oder ein aufgelockerter Packungszustand des
Chromatins (DNA/Histon-Komplex) erreicht werden (Yao et al., 2001). Im komprimierten
Zustand ist die DNA unzugänglich und Transkriptionsfaktoren können nicht oder nur
vermindert binden; im aufgelockerten Zustand können Transkriptionsfaktoren leichter binden
und die Transkription starten. Aktive DNA-Bereiche mit aufgelockerter DNA werden auch
als Euchromatin bezeichnet, komprimierte inaktive DNA-Bereiche als Heterochromatin.
Es ist noch nicht eindeutig geklärt, inwieweit CpG-Methylierung und Histon-Modifikationen
miteinander interagieren und in welcher Reihenfolge die DNA und Histonmodifikationen
erfolgen. Es gilt aber als gesichert, dass beide Mechanismen zum regionalen Packungszustand
der DNA (Eu- und Heterochromatin) und zur differentiellen Genaktivität beitragen (Reik,
2002). Dementsprechend sind sie für die Transgenese und die Expressionsprofile in
transgenen Tieren von essentieller Bedeutung.
23

3.0 Fragestellungen
Die Zielsetzung der vorliegenden Arbeit war es, verbesserte Methoden zur Transgenese von
Nutztieren zu etablieren. Dabei wurde insbesondere auf die Spezies Schwein fokussiert, da im
Rahmen von BMBF und DFG geförderten Projekten Fördermittel für die Generierung
transgener Schweine als Xenotransplantationsmodell eingeworben werden konnten.
Methodisch wurden dabei zwei Ansätze verfolgt. Die „klassische“ Mikroinjektion von DNA-
Expressionskonstrukten in den Vorkern von Zygoten und der somatische Kerntransfer
(Klonen) von Kernspenderzellen in entkernte Metaphase II-Oocyten. Für den somatischen
Kerntransfer wurden insbesondere die Gewinnung und Kultur der Kernspenderzellen aus
adulten und fetalen Geweben untersucht und die Zellkulturen detailliert charakterisiert.
Um eine konditionale Expressionskontrolle der eingesetzten DNA-Transgene zu erreichen,
wurden neuartige tetracyclin-regulierte Expressionskassetten (tet-off) eingesetzt. Damit sollte
die Möglichkeit einer von aussen-regulierbaren Transgenexpression im Schwein evaluiert
werden. Bisher war dieser Ansatz in keiner Nutztierspezies untersucht worden.
24

4.0 Ergebnisse und Diskussion
Im Ergebnisteil wird auf folgende Aspekte eingegangen:
1) Charakterisierung von primären Kernspenderzellen und Isolierung somatischer Stamm-
zellen (Anger et al., 2003; Kues et al., 2005a, b),
2) Gene knock-down-Versuche in transgenen Embryonen (Iqbal et al., 2007),
3) Generierung und detaillierte Untersuchung von transgenen Schweinen mit konditioneller
Genexpression (tet-off: Kues et al., 2006a; Deppenmeier et al., 2006; Niemann u. Kues, 2003;
Niemann u. Kues, 2007).
Die anderen Aspekte dieser wissenschaftlichen Thematik können in den Nachdrucken der
Orginalpublikationen (in Kapitel 10.0) nachgelesen werden (Schätzlein et al., 2004; Hoelker
et al., 2005; Yadav et al., 2005; Hornen et al., 2007; Dieckhoff et al., 2007, 2008; Kues u.
Niemann, 2004; Niemann et al., 2005; Niemann et al., 2007; Kues et al., 2008).
4.1 Primäre somatische und Stamm-Zellen als Donorzellen für den Kerntransfer
Nach der erstmaligen Beschreibung eines erfolgreichen Klonexperiments mit somatischen
Zellen (Wilmut et al., 1997), ging man davon aus, dass die Zellzyklusphase der
Kernspenderzelle entscheidend für die erfolgreiche Weiterentwicklung der rekonstruierten
Embryonen sei. Insbesondere wurde die Ansicht favorisiert, dass primäre Zellen in der G0-
Phase des Zellzyklus am besten geeignet seien (Wilmut et al., 1997; Wells et al., 1999).
Fibroblasten, die direkt aus adultem Gewebe isoliert werden, liegen überwiegend in der G0-
Phase vor. In der Kultur primärer Zellen wird durch den Zusatz von Serum und
Wachstumsfaktoren zum Kulturmedium eine starke Proliferationsstimulation erzeugt
(Connell-Crowley et al., 1998), so dass in der Regel maximale Zellwachstums- und
Teilungsraten vorliegen. Primäre humane Fibroblasten können in Kultur bis zu 50
Zellteilungen durchführen, bevor sie in Zellseneszenz übergehen (Hayflick, 1965). Für die
Anreicherung von Zellkulturen in bestimmten Zellzyklusphasen gibt es eine Reihe von
Methoden, die aber meistens für transformierte Zellen optimiert sind (Holley et al., 1968;
Reed, 1997; Zetterberg et al., 1995). Für die Zellzyklussynchronisierung primärer
Fibroblasten von Nutztierspezies waren keine etablierten Protokolle vorhanden; dies gilt
insbesondere für unerwünschte oder toxische Effekte der möglichen Verfahren.
Als Kerndonorzellen für den somatischen Kerntransfer wurden hier überwiegend primäre
Fibroblastenkulturen angelegt und detailliert charakterisiert. Dabei wurden insbesondere die
Homogenität der Fibroblasten, die Proliferationsfähigkeit, die Transfizierbarkeit mit DNA-
25

Konstrukten und die Zellzyklussynchronisierung untersucht (Kues et al., 2002; Anger et al.,
2003; Kues et al., 2005a).
Es wurden Methoden für die Isolation primärer Fibroblasten aus fetalen und adulten Gewebe
von Nutztieren entwickelt und die etablierten Zellkulturen hinsichtlich der
Proliferationsfähigkeit in Kultur und der Zellzyklussynchronisierung detailliert untersucht.
Die primären Zellen konnten genetisch verändert werden (Dieckhoff et al., 2007) und wurden
erfolgreich für Klonversuche verwendet (Schaetzlein et al., 2004; Hornen et al., 2007;
Dieckhoff et al., 2008). Es konnte gezeigt werden, dass porcine fetale Fibroblasten
grundsätzlich Zellzyklus synchronisierbar sind. Maximal wurden Anreicherungen in der
G0/G1-Phase des Zellzyklus von 80-90 % der Zellen erreicht, dabei wurden sowohl
Serumreduktion als auch chemische Inhibitoren des Zellzyklus (Pedrail et al., 1980; Kitagawa
et al., 1994), wie Aphidicolin und Butyrolactone eingesetzt (Kues et al., 2000). Die optimale
Zellzyklussynchronisierung wurde nach 48 Stunden Kultur in serumreduzierten
Zellkulturmedien erreicht; damit sind wesentlich kürzere Synchronisationszeiten möglich, als
zunächst beschrieben (Wilmut et al., 1997; Wells et al., 1999). Bei längeren
Serumentzugszeiten (als 48 Stunden) kam es zunehmend zum apoptotischen Zelltod, wobei
eine direkte Korrelation mit der Serumreduktion und der Zeitdauer der Behandlung
festgestellt werden konnte. In den primären Fibroblasten wurde dabei eine unkonventionelle
Form der Apoptose beobachtet (Kues et al., 2002). Die Messung der Zellzyklusphasen durch
Fluorescence activated cell sorting (FACS) wurde durch Reverse transcriptase-polymerase
chain reaction (RT-PCR)-Bestimmungen der Transkripte des zellzyklus-spezifisch regulierten
Gens Polo-ähnlicher Kinase (Polo-like kinase) auf molekularer Ebene untermauert (Kues et
al., 2000; Kues et al., 2002).
In den Primärkulturen porciner Fibroblasten wurde ein neuer Stammzelltyp gefunden, der mit
Hilfe der Explantatmethode und der Kultur unter hohen Zelldichten angereichert werden
konnte (Abb. 8). Diese fetalen somatischen Stammzellen (FSSCs) konnten aus fetalem
Bindegewebe von Schwein, Maus, Rind und Schaf isoliert werden (Kues et al., 2005a), in
adultem Gewebe kommen sie offenbar in wesentlich geringerer Frequenz vor.
26

eseeding of
outgrowing cells
Tissue explant
Standard culture
Fibroblast monolayer
confluent,
mitotic inactive
High density culture
Colonies of FSSCs
colony growth on monolayer,
mitotic active,
Oct-4, Stat3, TNAP positive
27
Fetus
Abb. 8. Isolation fetaler somatischer Zellen (FSSC, aus Kues et al., 2005b).
Suspension culture
Anchorage independent growth
reaggregation,
growth as spheroids
Die FSSCs wachsen als Kolonien auf einem autologem Nährzellrasen aus Fibroblasten, sie
exprimieren Stammzellmarker (Yeom et al., 1996), wie OCT4, alkaline Phosphatase (AP) und
STAT3, zeigen kein Hayflick-Limit und nach Injektion muriner FSSCs in Maus-Blastozysten
konnten chimäre Feten erhalten werden, in denen die injizierten Zellen zu somatischen
Geweben und der Keimbahn beitrugen (Abb.9). Inwieweit der beobachtete Chimärismus
durch Zellfusion (Ying et al., 2002; Wang et al., 2003) bedingt ist, muss in weitergehenden
Untersuchungen abgeklärt werden. Porcine FSSCs wurden zudem erfolgreich im Kerntransfer
eingesetzt (Hornen et al., 2007). Aufgrund ihrer höheren Potenz sind FSSCs möglicherweise
bessere Kernspender im Klonverfahren. Durch ihre längere Proliferationsfähigkeit in Kultur
vereinfachen sie genetische Modifikationen und die Isolierung von Zellklonen.
Zur Zeit wird davon ausgegangen, dass FSSCs einen gewebe-spezifischen Stammzelltyp
darstellen. Fibroblasten stellen einen Hauptzelltyp in Bindegewebe dar, wo sie eine Reihe von
Funktionen erfüllen (Moulin et al., 1999; Chang et al., 2002; Han et al., 2002), unter anderem
sind sie an der Regeneration beteiligt. In Fetalstadien von Säugern verheilen
Hautverletzungen ohne Narbenbildung (Moulin et al., 1999), was als ein indirekter Hinweis
auf eine höhere Zellplastizität von Bindegewebszellen in diesem Stadium gewertet werden
kann.

A Wt chimeric fetus day 15.5 p.c.
B
Chimeric fetuses control OG2/Rosa26
Abb.9. Zellchimärismus in Mausfeten nach Injektion von Rosa26/OG2-transgenen FSSCs in Blastozysten.
A) Durch histologischen Nachweis der LacZ-Expression (Pfeile) kann die Beteiligung der injizierten Zellen an
den Fetalorganen gezeigt werden (rechter Embryo). Links ein Kontrollembryo.
B) Nachweis von GFP-positiven Zellen (OG2) in chimärer Keimleiste. Rechts als Positivkontrolle die
Keimleiste eines OG2 transgenen Fetuses (aus Kues et al., 2005a).
28

4.2 Gene knock-down Versuche in transgenen Embryonen
Das Transkriptom in frühen Säugerembryonen wird zunächst durch maternale mRNAs
geprägt, die in der Oozyte angereichert vorliegen (Schultz, 2002). Im Zygotenstadium erfolgt
keine Transkription des embryonalen Genoms, die Proteinsynthese ist in diese Phase von den
maternalen Transkripten abhängig. Die Aktivierung des embryonalen Genoms (embryonic
genome activation) erfolgt spezies-spezifisch bei murinen Embryonen am Ende des
Zygotenstadiums, bei humanen und porcinen Embryonen im 4-Zellstadium und bei bovinen
Embryonen im 8-Zellstadium (Telford et al., 1990).
In der Literatur war gezeigt worden, dass der RNAi-Mechanismus in Säugerembryonen
funktionell ist, dabei wurden überwiegend lange doppelsträngige RNA (500-1000 bp)
injiziert, und verschiedene Gentranskripte, wie E-Cadherin, Mos, Plat, Oct4, Coxa, Cox5b
und Cox6b selektiv degradiert (Svoboda et al., 2000; Wianny et al., 2000; Plusa et al., 2004;
Paradis et al., 2005; Nganvongpanit et al., 2007; Cui et al., 2006). Die doppelsträngigen
RNAs werden durch das zelleigene Enzym Dicer in siRNAs prozessiert, die dann in dem
eigentlichen RNAi-Mechanismus den Abbau von komplementären Transkripten verursachen
(Svoboda et al., 2000). Bei diesem Verfahren ist also eine relativ hohe Beladung der
Embryonen mit siRNAs notwendig, von denen nur ein Teil funktionell ist, zusätzlich kann es
zu unspezifischen Effekten kommen. Zudem kann bei Genen, die ein biphasisches
Expressionsmuster zeigen, d.h. die sowohl im maternalen Transkriptom vorliegen, als auch
im embryonalen Genom transkribiert werden, nicht ausgeschlossen werden, dass maternale
und embryonale Transkripte unterschiedlich sensitiv für den RNAi-Mechanismus sind. So ist
bekannt, dass maternale Transkripte eine Halbwertzeit im Bereich von Tagen, embryonale
Transkripte dagegem im Bereich von Minuten besitzen (Karlson et al., 2005).
In transgenen Mäusen wurde getestet, ob im RNAi-Mechanismus eine differentielle
Degradierung von maternalen und embryonalen Transkripten auftritt. Dazu wurde eine
funktionelle synthetische siRNA (22 bp) gegen GFP in transgene Mausembryonen injiziert.
(Iqbal et al., 2007). Um die Degradation von maternalen und embryonalen Transkripten
verfolgen zu können, wurden transgene Mäuse (OG2), die das Green Fluorescent Protein
(GFP) unter Kontrolle des keimbahnspezifischen Promoters Oct4 exprimieren (Szabo et al.,
2002), verwendet. In transgen-homozygoten Embryonen wird GFP in allen Blastomeren
exprimiert, also sowohl maternal als auch embryonal. Bei Verpaarungen mit Wildtypmäusen
entstehen hemizygot-transgene Embryonen, bei denen die GFP-Expression davon abhängt, ob
sie das Transgen-Allel von der mütterlichen (OG2 mat/- ) oder der väterlichen (OG2 pat/- ) Seite
29

geerbt haben. OG mat/- Embryonen zeigen eine kontinuierliche GFP-Expression von der Oocyte
bis zur Blastozyste, während OG pat/- -Embryonen erst ab dem 4-8-Zellstadium GFP-positiv
werden (Abb.10). Die RNAi der GFP-Expression kann somit an lebenden Embryonen
selektiv für maternale und embryonale Transkripte evaluiert werden.
Abb. 10. Vererbungsabhängige Expression von Oct4-GFP in hemizygoten Mausembryonen.
A) Embryonen mit paternal vererbten Transgen (OG2 pat/- ) zeigen GFP-Expression ab dem 8-Zellstadium,
Embryonen mit maternal vererbten Transgen (OG2 mat/- ) zeigen in allen Stadium von Zygote bis Blastocyste
GFP-Fluoreszenz. B) Schematischer Aufbau der siRNA, die verwendete siRNA ist mit dem Fluorochrom
Rhodamine konjugiert. C) Injektion der siRNA in OG2 mat/- -Zygote unter Hellfeldbedingungen (oben),
Fluoreszenzanregung für GFP (mitte) und Fluoreszenzanregung für Rhodamin (unten) (aus Iqbal et al., 2007).
Durch Mikroinjektion einer short interfering RNA (siRNA), die gegen die GFP mRNA
gerichtet ist, wurden die unterschiedlichen RNAi-Kinetiken bei Embryonen mit maternaler,
bzw. embryonaler GFP-Expression ermittelt.
Dabei zeigte sich, dass die Expression vom paternalen Allel nahezu komplett inhibiert werden
kann; es war keine GFP-Fluoreszenz nachweisbar. In den OG mat/- Embryonen konnte eine
Reduktion der GFP-mRNA um ca. 95% nachgewiesen werden, aufgrund der hohen
Proteinstabilität von GFP war aber erst in Blastozysten eine relative Verringerung der GFP-
Fluoreszenz feststellbar (Abb.11). Diese Untersuchung zeigt, dass eine einmalige Injektion
von siRNA im Zygotenstadium ausreichend ist, um bis zum Blastozystenstadium eine RNA-
Interferenz zu erreichen. Durch die Verwendung einer synthetischen siRNA, können
unspezifische Effekte, die bei langen doppelsträngigen RNAs beobachtet werden, weitgehend
30

vermieden werden. Um zu bestimmen, wie lange der Effekt einer einmaligen siRNA-
Injektion, anhält, müssten in Folgeuntersuchungen Postimplantations-Stadien untersucht
werden.
(OG2 pat /-) (OG2 mat /-)
Abb.11. RNAi in hemizygoten Mausembryonen.
Nach Injektion der GFP-spezifischen siRNA (Fig.10) in hemizygote OG2 transgene Zygoten wurden diese in
vitro kultiviert. 2-Zell, Morula- und Blastozystenstadien von OG2 pat/- (links) und OG2 mat/- (rechts) sind im
Hellfeld und unter GFP-Fluoreszenzanregung dargestellt (aus Iqbal et al., 2007).
Im Gegensatz zu den relativ aufwendigen Verfahren eine RNA-Interferenz in
postimplantatorischen Embryonen zu induzieren (Mellitzer et al., 2002; Caligari et al., 2004;
Soares et al., 2005), ist das siRNA-Injektionsverfahren wesentlich einfach durchzuführen und
zeitlich mindestens bis zum Blastozystenstadium effektiv.
31

4.3. Generierung transgener Schwein mit konditioneller Transgenexpression
Über die DNA-Mikroinjektion in einen Vorkern von Schweinezygoten wurden transgene
Linien mit Expression des humanen Komplementregulators CD59 erstellt (Niemann und
Kues, 2003). Als regulative Sequenz wurde der Cytomegalovirus (CMV) Immediate Early-
Promotor gewählt, der als einer der stärksten Promotoren in der Zellkultur gilt.
Abb. 12. Generation transgener Schwein mit Expression von hCD59
A) Minigen-Konstrukt mit hCD59 cDNA, B) Injektion des aufgereinigten Konstruktes in einen Vorkern einer
Schweinezygote, C) Transgenes F0-Tier, D) Organspezifische Expression von hCD59 in einem F1-Tier, E)
Nachweis von hCD59 auf der Zelloberfläche von porcinen Fibroblasten und Endothelzellen, F) funktioneller
Nachweis von hCD59 in Schweinefibroblasten durch verminderte Lyse durch Humankomplement, G)
funktioneller Nachweis von hCD59 in einem Nierenperfusionsystem mit Humanblut (aus Niemann und Kues,
2003).
Es wurden 5 Linien transgener Schweine mit diesem Konstrukt etabliert. Abb. 12 fasst die
Ergebnisse aus der Linie 5 zusammen. Bei Expressionsuntersuchungen zeigte sich, dass eine
32

starke Expression von hCD59 in Pankreas, Niere, Herz und Haut vorlag. Auch primäre
Endothelzellen, die aus der Aorta isoliert wurden, wiesen eine, wenn auch geringe Expression
von hCD59 auf. In Perfusionen von Schweinenieren mit Humanblut, die in Zusammenarbeit
mit der Medizinischen Hochschule Hannover durchgeführt wurden, konnte gezeigt werden,
dass die vorhandene hCD59-Expression ausreichte, um wesentlich verbesserte
Perfusionszeiten zu erreichen und die hyperaktute Abstoßung zu unterdrücken (Niemann et
al., 2001).
Feingewebliche Untersuchungen zeigten, dass eine starke Variegation der hCD59-Expression
in allen CMV-transgenen Linien vorlag (Abb. 13). So waren in der Niere einzelne Zellen
stark anfärbbar, während benachbarte Zellen keine nachweisbare hCD59-Expression
aufwiesen.
Abb. 13. Variegierte Transgenexpression in CMV-hCD59 transgenen Schweinen (L5).
A), C), E) immunhistologischer Nachweis von hCD59 in Herz, Pankreas und Nierengewebe eines Linie 5-
Tieres. B), D) und F) Kontrollgewebe eines wt-Tieres (aus Niemann et al., 2001). H) Vergrößerter Ausschnitt
einer immunhistologischen Anfärbung für hCD59 in der Niere.
In einem weitergehenden Ansatz wurde versucht, diese Limitationen zu überwinden, dazu
wurde eine neuartige Tetracyclin-regulierbare Expressionskassette (NTA) zusammen mit der
Arbeitsgruppe von Dr. Hauser (GBF/jetzt Helmholtz-Zentrum für Infektionsforschung)
eingesetzt. Tetracyclin-regulierbare Expressionssysteme (tet-off, bzw. tet-off) wurden für die
konditionale Genregulation in Zell-Linien und transgenen Mäusen entwickelt (Gossen und
Bujard, 1992; Furth et al., 1994; Lewandowski, 2001; Corbel und Rossi, 2002), um die
Limitationen zu überwinden, die mit der konditionalen Genregulation auf der Basis von
Metall- oder Steroid-sensitiven Promotoren bestanden (Mayo et al., 19982; Lee et al., 1981;
Miller et al., 1989; Pursel et al., 1989). Das originale Tet-System besteht aus zwei
Expressionskassetten, einem Transaktivator-Konstrukt und einem Transaktivator-regulierten
33
H

Konstrukt, die in zwei Mauslinien etabliert und dann durch Verpaarung in einem Genom
kombiniert werden (Lewandowski, 2001). Da der Zeitaufwand für die Verkreuzung von zwei
Nutztierenlinen wesentlich höher ist als bei der Maus, wurde hier ein Ansatz gewählt, der
beide funktionellen Elemente auf einem Konstrukt vereinigt und somit nur die Erstellung
einer transgene Linie erfordert (Kues et al., 2006a). Dazu wurde ein bicistronisches Konstrukt
entworfen (Abb. 14), bei dem eine mRNA gebildet wird, die einen Komplementregulator
(hCD59 oder hDAF) und den Tet-Transaktivator (NTA-RCA) kodiert. Durch die basale
Expression des Konstruktes kommt es dann zu einer autoregulativen Hochregulation der
Expression; die Transgenexpression ist durch Zugabe von Tetracyclin oder Doxycyclin
abstellbar, bzw. regulierbar (Abb. 14). Als eigentliche Transgene wurden die humanen
Komplentregulatoren CD59, bzw. DAF jeweils in das erste Cistron kloniert. Es wurden also
zwei NTA-Konstrukte mit den Kombinationen CD59-tTA und DAF-tTA verwendet. Der
Vorteil dieser Konstrukte gegenüber den Orginalsystem (Gossen und Bujahr, 1992) besteht
darin, dass nur ein Transgenkonstrukt in das Genom eingebracht wird und die Verpaarung
von zwei Linien entfällt.
+
Tet-O
p tTA
TATA box
RCA Transactivator
RCA IRES tTA pA
34
-
Dox
Inactivated
exogenous Dox
Abb. 14. Autoregulative bicistronische Expressionskassette (NTA).
Der tetracyclin-regulierte Promoter besteht aus sieben Tet-Operator-Sequenzen und einem minimalen Promoter
mit einer TATA-Box. Die bicistronische Kassette wird durch eine IRES-Sequenz getrennt, das erste Cistron
kodiert einen RCA (entweder CD59 oder DAF) und das zweite Cistron den Transaktivator. Nach Transkription
führt der tTA durch Bindung an den eigenen Promoter zu einer autoregulativen Hochregulation, durch Zugabe
von Doxycyclin wird der tTA inaktiviert (verändert aus Kues et al., 2006a).
Die Funktionalität der NTA-Kassette wurde durch Transfektion in murine NIH-3T3 Zellen
und in porcine Swine testis epithelium (STE)-Zellen getestet Dabei konnte sowohl in
(AAA) n

Zellpopulationen als auch in Einzelzellklonen eine volle Aktivität der NTA-Kassette
beobachtet werden, dass heisst durch basale Transkription konnte eine Hochregulation der
humanen Komplementregulatoren CD59, bzw. DAF erzielt werden. Die Transgenexpression
war durch Tetracyclin-Supplementation des Zellkulturmediums reversibel abstellbar (Kues et
al., 2006a).
Insgesamt wurden 10 transgene Linien (hemizygot) von Schweinen mit diesem Konstrukt
über Injektion der linearisierten DNA in Zygotenvorkerne erstellt und charakterisiert (Tab. 3;
Kues et al., 2006a, Niemann und Kues, 2007). Dabei zeigte sich, das in den hemizygoten
Linien die NTA-Kassette nahezu komplett stillgelegt vorlag (gene silencing); also trotz
Vorhandenseins des Transgens im Genom keine Transkription erfolgte. Gene silencing wird
auch in Mauslinien beobachtet, dass allerdings 10 unabhängige Linien mit unterschiedlichen
Kopienzahlen des Transgens (1-3) und unterschiedlichen Integrationsorten eine (nahezu)
komplettes gene silencing aufwiesen, deutet daraufhin, dass entweder das Konstrukt selbst
diesen Effekt hervorrief, oder in Schweinen deutlich sensitivere Mechanismen zum Erkennen
und Stilllegen von Fremd-DNA als in Mäusen aktiv sind. Die Expression der NTA-Kassette
konnte in hemizygoten Tieren nur in der Skelettmuskulatur gefunden werden, und zwar waren
offenbar zufallsmäßig einzelne Fasern in der feingeweblichen Untersuchung Transgen-positiv
(Abb. 15B). Auffallend war, dass dieses Muster bei 9 von den untersuchten Linien vorlag
(Tab.3), linienabhängig waren 5-20% der Muskelfasern hCD59 oder hDAF positiv. Die
positiven Fasern waren dabei durchgehend stark positiv angefärbt (Kues et al., 2006a).
Tab. 3: Transgenexpression in Schweinen mit einer und zwei NTA-Kassetten
Transgene Schweine mit einer NTA-Kassette Transgene Schweine mit zwei NTA-Kassetten
DAF-NTA CD59-NTA DAF-NTA x CD59-NTA
L12 L13 L14 L15 L16 L17 L19 L20 L21 L22 L13 x L20 (n = 7) L15 x L20 (n = 2)
DAF CD59 DAF CD59
Herz - - - - - - - - - - - + - -
Leber - - - - - - - - - - - ++ - -
Lunge - - - - - - - - - - - + - -
Niere - - - - - - - - - - - + - -
Pankreas - - - - - - - - - - - ++ - -
Skel. Muskel - ++ + + + + + ++ + + ++ ++++ + ++
Thymus - - - - - - - - - - n.d. n.d. n.d. n.d.
Lymphozyten - - n.d. n.d. n.d. n.d. n.d. - n.d. n.d +* ++* - -
Fibroblasten n.d. - n.d. n.d. n.d. n.d. n.d. - n.d. n.d. - + n.d. n.d.
Zusammengefasste Expressionsdaten aus Northern blot, Immunhistologie und FACS-Messungen; (+)-Zeichen zeigen Expressionshöhe an, (-) keine
Expression detektierbar, (n.d.) nicht untersucht und (*) nach Mitogenstimulation.
Primäre Fibroblasten aus hemizygoten Tieren exprimierten kein Transgen, auch nach
Transfektion mit einem tTA-Konstrukt wurde keine Expression gefunden. Entsprechende
35

Befunde wurden nach Injektion des tTA-Plasmids in die Skelettmuskulatur gemacht. Dagegen
konnte in Mitogen-stimulierten Lymphozyten die Expression von hCD59 und hDAF
eindeutig gezeigt werden (Kues et al., 2006a).
Durch Fütterung mit Doxycyclin war die Expression in den Muskelfasern abgestellbar. Durch
Resequenzierung der Konstrukte aus genomischer DNA der transgenen Tiere, konnte
ausgeschlossen werden, dass die beobachteteten Expressionsmuster durch Deletion von
regulativen Sequenzen hervorgerufen wurden.
Ansätze, die transgenen Linien auf Transgen-Homozygotie zu verpaaren, waren nicht
erfolgreich. Offenbar aufgrund eines bereits hohen Inzuchtgrades im vorhandenen Bestand
führten Geschwisterverpaarungen zu sehr kleinen Würfen (0-3 Ferkel) mit lebensschwachen
Ferkeln. Daher wurden Tiere aus Linien mit NTA-CD59 und NTA-DAF-Transgenen
verpaart. In den normal großen Würfen wurden in etwa die erwarteten Verhältnisse von 25 %
Nachkommen mit beiden Kassetten, 50% mit einer Kassette und 25% Wildtyp gefunden
(Kues et al., 2006a). Bei Tieren mit zwei NTA-Kassetten wurde linien-abhängig die
Hochregulation von einer oder beider Kassetten gefunden (Tab. 3; Kues et al., 2006a;
Niemann und Kues, 2007). Dabei kam es einer Ausweitung der exprimierenden Zellen, so
wurden regelmäßig bis zu 100 % positive Skelettmuskelfasern gefunden, und in zahlreichen
anderen Organen, wie Leber, Haut, Herz und Niere lagen positive Zellen vor (Abb. 15A, C).
In den NTA-doppelttransgenen Tieren wurde eine Doxycyclin-abhängige Transgenexpression
gefunden (Abb. 16). Nach oraler Applikation von 3.3 mg Doxycyclin pro kg Lebendgewicht
und Tag wurde bereits nach 2 Tagen eine massive Reduktion der bicistronischen Transkripte
gefunden. In Abb. 16 wurden von drei doppelt-transgenen Geschwistertieren eines mit einem
Placebo und zwei mit Doxycyclin gefüttert. Die gewählte Doxycyclin-Dosis von 3.3 mg/
Kilogramm Lebendgewicht und Tag wurde aufgrund der Literaturangaben für die
Doxycyclin-Transgenregulation bei Mäusen (Furth et al., 1994; Kistner et al., 1996; Zhu et
al., 2001) extrapoliert; sie liegt deutlich unter der für Schweine empfohlenen antimikrobiell
wirksamen Dosis von 12 mg/kg und Tag. Die Transgenexpression in transgenen Schweinen
blieb nach dem Absetzen der Doxycyclin-Gabe für mindestens 50 Tage abgeschaltet, bevor
eine Reexpression messbar ist (Abb. 16). Eine mögliche Erklärung ist, dass Doxycyclin
offenbar effektiv in Knochen zwischengespeichert und dann zeitverzögert in den Kreislauf
zurückgeführt werden kann (Stepensky et al., 2003). In transgenen Mäusen wurden
unterschiedliche Wirksamkeiten von Doxycyclin in Abhängigkeit vom Mausstamm
beschrieben (Robertson et al., 2002). In nachfolgenden Dosis-Wirksamkeitsuntersuchungen
36

ei doppelttransgenen Schweine wurde die zweimalige Gabe einer Doxycyclin-Dosis von 0,6
mg/kg als ausreichend für eine sichere Expressionsregulation gefunden (nicht gezeigt).
Abb. 15. Transgen-Expression in einfach und doppelttransgenen Schweinen (NTA).
A) Northern blot mit CD59-Sonde; (1, 2, 3), Muskelbiopsien von NTA-CD59/NTA-DAF doppelttransgenen
Tieren; (4,5,6), Muskelbiopsien von NTA-CD59 einzeltransgenen Tieren; (7, 8) wt-Kontrollen; (9, 10) Positiv-
Kontrollen von CMV-CD59 transgenen Tieren. In den Proben aus einzeltransgenen NTA-Tieren (4, 5, 6) ist die
CD59-Expression erst nach längerer Expositionszeit sichtbar.
B) Immunhistologischer Nachweis von CD59 und DAF in einzeltransgenen Tieren (NTA) im Skelettmuskel.
Einzelne Muskelfasern sind angefärbt. Oberer Reihe Muskellängsschitte, untere Reihe Muskelquerschnitte. In
anderen Organen wurden keine Zellen mit Transgenexpression gefunden.
C) Immunhistologischer Nachweis von CD59 und DAF in doppeltransgenen Tieren. In doppeltransgenen Tieren
aus Linie 13 mit Linie 20-Verpaarungen ist die Muskulatur komplett positiv für CD59 gefärbt (M.) in Leber
(Le.), Lunge (Lu.) und Pankreas (P.) sind einzelne Zellen positiv. Dagegen ist DAF nur in einzelnen
Muskelfasern nachweisbar. In doppelttransgenen Tieren aus der Verpaarung L15 mit L20 (unterster Reihe, M.)
ist die Expression von CD59 und DAF auf einzelne Muskelfasern beschränkt, wobei einige Faser nur CD59-
Expression aufweisen (Pfeile, bzw. gestrichelte Kreise) (mod. aus Kues et al., 2006a).
Die Analyse auf DNA-Methylierung durch Bisulfitsequenzierung in Promoterbereichen der
NTA-Konstrukte ergab, das einzeltransgene Tiere eine nahezu komplette Methylierung an
CpG-Dinukleotiden aufwiesen, während in den Promoterbereichen der doppeltransgenen
Tieren eine ca. 50% Reduktion der Methylierung gefunden wurde. In Zellklonen, Maus 3T3
und porcinen STE-Zelllinien, waren die Promotorsequenzen methylierungsfrei. Offenbar wird
die NTA-Kassette während der Ontogenese stillgelegt (gene silencing); dieses manifestiert
37

sich einer DNA-Methylierung der Promotorsequenzen. In den doppelttransgenen Tieren kann
dieses Silencing unterdrückt werden; offenbar kann durch den autoregulativen Charakter der
Expressionskontrolle das Silencing verhindert werden. Möglicherweise geschieht dies direkt
durch die Bindung des tTA, was in Abhängigkeit von der basalen Expressionshöhe ein
Silencing bestimmter Integranten dauerhaft verhindern würde. Gegenwärtig laufen Versuche,
durch weitere Verpaarung mehr als zwei NTA-Kassetten in einem Tier zu kombinieren. Das
hier gefundene bimodale Expressionsmuster wurde mittlerweile auch in Zell-Linien für
bicistronische Konstrukte beschrieben (May et al., 2008).
Abb. 16. Konditionale Transgenexpression im Schwein
Drei NTA-doppelttransgenen Geschwistertieren wurde über 6 Tage ein Placebo oder Doxycyclin (3.3 mg/kg)
gefüttert. Zu verschiedenen Zeitpunkten wurden Muskelbiopsien genommen und im Northern blot auf die
Expression von hCD59, hDAF und des porcinen ß-Actin (ACTB)-Gens untersucht (aus Kues et al., 2006a).
Die Bedeutung der NTA-transgenen Tiere liegt im wesentlichen in den neuen Einblicken in
die Regulation von Gensequenzen im Säugergenom. In diesem Tiermodell konnte ein
stillgelegtes Transgen erstmals wieder reaktiviert werden. Durch die Verpaarung zu
doppelttransgenen Tieren wird offenbar in einem kritischen Entwicklungsfenster das
Silencing der Transgene verhindert. Die detaillierte Identifikation der beteiligten
Mechanismen und zeitlichen Abläufe in weitergehenden Untersuchungen wird für eine
optimierte Transgenese, insbesondere in Nutztieren von entscheidender Bedeutung sein.
38

5.0 Zusammenfassung
In der vorliegenden Arbeit wurden experimentelle Ansätze zur Transgenese von Nutztieren
durchgeführt. Aus primären Fibroblastenkulturen von Nutztieren wurden Stammzellen
(FSSCs) abgeleitet, die wesentliche Vorteile für eine genetische Modifikation haben und die
Effizienz des somatischen Kerntransfers erhöhen können. In transgenen Embryonen wurde
mit einer synthetischen siRNA ein allel-spezifischer Gene knock-down gezeigt. Es wurden
transgene Schweine mit konditionaler Expressionskontrolle (tet-off) erstellt und detailliert
charakterisiert. Dabei zeigten Tiere aus den hemizygoten Linien ein nahezu komplettes
Silencing der Transgen-Kassetten. Durch die Verpaarung zu doppelttransgenen Tieren
konnten die Transgenkassetten reaktiviert werden. Dabei konnten die NTA-Kassetten von
allen vier untersuchten Integrationsorten reaktiviert werden, die Reaktivierung war dabei in
linien-spezifischen Kombinationen möglich. Damit wurde erstmalig eine wirksame
konditionale Expressionskontrolle im Nutztier gezeigt; und es wurde nachgewiesen, dass
epigenetische Mechanismen, insbesondere die DNA-Methylierung, mit der konditionalen
Expression interferieren können. Dieser Befund ermöglicht ein wichtiges
grundlagenwissenschaftliches Verständnis der Genomregulation in Nutztieren und fügt sich in
das gegenwärtige Modell der Reprogrammierung und des Neusetzens von
Methylierungsmustern in der frühen Embryogenese ein. Für verbesserte Ansätze zur
Transgenese sind die hier erhobenen Befunde von wichtiger Bedeutung.
39

6.0 Literaturverzeichnis
Adelson, D.L. 2008. Insights and applications from sequencing the bovine genome.
Reproduction, Fertility and Development 20:54-60.
Anger, M., Kues, W.A., Klima, J., Mielenz, M., Motlik, J., Carnwath, J.W. and Niemann, H.
2003 Cloning and cell cycle-specific regulation of Polo-like kinase in porcine fetal
fibroblasts. Molecular Reproduction and Development 65, 245-253.
Avery, O.T., MacLeod, C.M., McCarty, M. 1944. Studies on the chemical nature of the
substance inducing transformation of pneumococcal types. J. Exp. Med. 79, 137-158.
Bach, F. H. 1998. Xenotransplantation: Problems and prospects. Annu. Rev. Med. 49, 301-
310.
Bennett, S.T., Barnes C., Cox, A., Davies, L, Brown, C. 2005. Toward the 1,000 dollars
human genome. Pharmacogenomics 6, 373-82.
Bird, A. 1992. The essentials of DNA methylation. Cell. 70, 5-8.
Brackett, B.G., Baranska, W., Sawicki, W., Koprowski, H. 1971.Uptake of heterologous
genome by mammalian spermatozoa and its transfer to ova through fertilization. Proc Natl
Acad Sci U S A. 68, 353-7.
Brem, G., Brenig, B., Goodman, H. M., Selden, R. C., Graf, F.,Kruff, B., Springmann, K.,
Hondele, J., Meyer, J., Winnacker, E.L. & Kr.ausslich, H. 1985. Production of transgenic
mice, rabbits and pigs by microinjection into pronuclei. Zuchthygiene 20, 251—252.
Brophy, B., Smolenski, G., Wheeler, T., Wells, D., L'Huillier, P., and Laible, G. 2003. Cloned
transgenic cattle produce milk with higher levels of b-casein and k-casein. Nat.
Biotechnol. 21, 157–162.
Caligari, F., Marzesco, A.M., Kittler, R. et al., 2004. Tissue-specific RNAi in postimplantation
mouse embryos using directional electroporation and whole embryo culture.
Differentiation 72, 92-102.
Capecchi, M.R. 1989. The new mouse genetics: altering the genome by gene targeting.
Trends Genetics 5, 70-76.
Cibelli, J. B., Stice, S. L., Golueke, P. L., Kane, J. J., Jerry, J., Blackwell, C., Ponce de Leon,
F. A., and Robl, J. M. 1998. Transgenic bovine chimeric offspring produced from somatic
cell-derived stem like cells. Nat. Biotechnol. 16, 642-646.
Chan, A. W., Homan, E. J., Ballou, L. U., Burns, J. C., and Bremel, R. D. 1998. Transgenic
cattle produced by reverse-transcribed gene transfer in oocytes. Proc. Natl. Acad. Sci.
USA 95, 14028-14033.
Chandler, L.A., Jones, P.A. 1988. Hypomethylation of DNA in the regulation of gene
expression. Dev Biol 5, 335-49.
40

Chang, H.Y., Chi, J.T., Dudoit, S., et al., 2002. Diversity, topographic differentiation and
positional memory in human fibroblasts. Proc. Natl. Acad. Sci. USA 99, 12877-11882.
Chou, C.Y., Horng, L.S., Tsai, H.J., 2001. Uniform GFP-expression in transgenic medaka
(Oryzias latipes) at the F0 generation. Transgenic Res 10, 303-315.
Clements, J. E., Wall, R. J., Narayan, O., Hauer, D., Schoborg, R., Sheffer, D., Powell, A.,
Carruth, L. M., Zink, M. C., and Rexroad, C. E. 1994. Development of transgenic sheep
that express the visna virus envelope gene. Virology 200, 370-380.
Clop, A., Marcq, F., Takeda, H., Pirottin, D., Tordoir, X., Bibé, B. 2006. A mutation creating
a potential illegitimate microRNA target site in the myostatin gene affects muscularity in
sheep. Nature Genetics 38, 813-8.
Connell-Crowley, L., Elledge, S.J., Harper, J.W. 1998. G1 cyclin-dependent kinases are
sufficient to initiate DNA synthesis in quiescent human fibroblasts. Curr. Biol 8, 65-68.
Cozzi, E., and White, D. J. G. 1995. The generation of transgenic pigs as potential organ
donors for humans. Nat. Med. 1, 964–966.
Cozzi, E., Tucker, A.W., Langford, G.A. et al., 1997. Characterization of pigs transgenic for
human decay –accelerating factor. Transplantation 64,1383-1390.
Cui, X.S., Li, X.Y., Jeong, Y.J., Jun, J.H. Kim, N.H. 2006. Gene expression of cox5a, 5b or
6b1 and their roles in preimplantation mouse embryos. Biol Reprod. 72, 601-610.
Dai, Y., Vaught, T. D., Boone, J., Chen, S.H., Phelps, C. J., Ball, S., Monahan, J. A., Jobst,
P.M., McCreath, K. J., Lamborn, A. E., Cowell-Lucero, J. L., Wells, K. D., Colman, A.,
Polejaeva, I. A., and Ayares, D. L. 2002. Targeted disruption of the alpha1,3galactosyltransferase
gene in cloned pigs. Nat. Biotechnol. 20, 251–255.
Dallas, A. and Vlassow, A. 2006 RNAi: A novel antisense technology and its therapeutic
potential. Med. Sci. Monit.12, RA67-74.
Damak, S., Jay, N.P., Barrel, G.K., Bullock, D.W. 1996. Improved woll production in
transgenic sheep expressing insulin-like growth factor 1. Biotechnology 14, 185-188.
Denning, C., Burl, S., Ainslie, A., Bracken, J., Dinnyes, A., Fletcher, J., King, T., Ritchie, M.,
Ritchie, W. A., Rollo, M., de Sousa, P., Travers, A., Wilmut, I., and Clark, A. J. 2001.
Deletion of the alpha(1,3)galactosyl transferase (GGTA1) gene and the prion protein (PrP)
gene in sheep. Nat. Biotechnol. 19, 559-562.
Deppenmeier, S., Bock, O., Mengel, M., Niemann, H., Kues, W., Lemme, E., Wirth, D,
Wonigeit, K., and Kreipe, H. 2006. Health status of transgenic pig lines expressing human
complement regulator protein CD59. Xenotransplantation 13, 345-356.
De Sousa, P.A., King, T., Harkness, L., Young, L.E., Walker, S.K., Wilmut, I. 2001.
Evaluation of gestational deficiencies in cloned sheep fetuses and placentae. Biol Reprod.
65, 23-30
41

Dieckhoff, B., Karlas, A., Hofmann, A., Kues, W. A., Petersen, B., Pfeifer, A., Niemann, H.,
Kurth, R., and Denner, J. 2006. Inhibition of porcine endogenous retroviruses (PERV) in
primary porcine cells by RNA interference using lentiviral vectors. Arch. Virol. 152, 629-
634.
Dieckhoff, B., Petersen, B., Kues, W.A., Kurth, R., Niemann, H., Denner, J. 2008.
Knockdown of procine endogenous retrovirus (PERV) expression by PERV-specific
shRNA in transgenic pigs. Xenotransplantation 15, 36-45
Dodart, J.C., May, P. Overview on rodent models of Alzheimer's disease. Curr Protoc
Neurosci. 2005 Nov;Chapter 9:Unit 9.22.
Du, Y., Kragh, P.M., Zhang, X., Purup, S., Yang, H., Bolund, L., Vajta, G. 2005. High overall
in vitro efficiency of porcine handmade cloning (HMC) combining partial zona digestion
and oocyte trisection with sequential culture. Cloning Stem Cells 7, 199-205.
Echelard, Y., Ziomek, C., Meade, H. 2006. Production of recombinant therapeutic proteins in
the milk of transgenic animals. BioPharm Intern. 2, 1-6.
Eggan, K., Baldwin, K., Tackett, M., Osborne, J., Gogos, J., Chess, a., Axel, R., Jaenisch, R.,
2004. Mice cloned from olfactory sensory neurons. Nature 428, 44-49.
Eilertsen, K.J., Floyd, Z., Gimble, J.M..2008. The epigenetics of adult (somatic) stem cells.
Crit Rev Eukaryot Gene Expr. 18, 189-206
Elbashir, S.M., Harborth, J., Lendeckel, W., Yalcin, A., Weber, K. Tuschel, T. 2001.
Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells.
Nature 411, 494-498.
Fire, A., Xu , S., Montgomery, M.K., Kostas, S.A., Driver, S.E., Mello, C. 1998. Potent and
specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature
391, 809-811.
Food and Drug Administration USA 2003. FDA statement regarding Glofish.
http://www.fda.gov/bbs/topics/NEWS/2003/NEW00994.html.
Furth, P.A., Onge, L., Böger, H., Gruss, P., Gossen, M., Kistner, A., Bujard, H.,
Hennighausen, L. 1994. Temporal control of gene expression in transgenic mice by a
tetracycline-responsive promoter. Proc. Natl. Acad. Sci USA 91, 9302-9306.
Glover, D.M. (Eds). 1985. DNA cloning. A practical approach. Vols. 1-2. IRL Press, 1985.
Götz, J., Probst, A., Ehlers, E., Hemmings, B., Kues, W. 1998. Delayed embryonic lethality in
mice lacking protein phosphatase 2a catalytic subunit C alpha. Proc. Natl. Acad. Sci. USA
95, 12370-12375.
Götz, J., Kues, W. 1999. The role of PP2A catalytic subunit C alpha in embryogenesis:
Evidence from sequence analysis and localization studies. Biol Chem. 380, 1117-1120.
42

Golding, M.C., Long, C.R., Carmell, M.A., Hannon, G.J., Westhusin, M.E. 2006. Suppression
of prion protein in livestock by RNA interference. Proc. Natl. Acad. Sci. USA 103, 5285-
5290.
Gong, W., Wan, H., Tay, T.L., Wang, H., Chen, M., Yan, T. 2003 Development of transgenic
fish for ornamental and bioreactor by strong expression of fluorescent proteins in the
skeletal muscle. Biochemical and Biophysical Research Communications 308, 58-63.
Golovan, S. P., Meidinger, R. G., Ajakaiye, A., Cottrill, M., Wiederkehr, M. Z., Barney, D. J.,
Plante, C., Pollard, J. W., Fan, M. Z., Hayes, M. A., Laursen, J., Hjorth, J. P., Hacker, R.
R., Phillips, J. P., Forsberg, C. W. 2001. Pigs expressing salivary phytase produce lowphosphorus
manure. Nat. Biotechnol. 19, 741–745.
Goodstadt, L., Ponting, C.P.. Phylogenetic reconstruction of orthology, paralogy, and
conserved synteny for dog and human. PLoS Computational Biology 2006; 2:e133.
Grosse-Hovest, L., Muller, S., Minoia, R., Wolf, E., Zakhartchenko, V., Wenigerkind, H.,
Lassnig, C., Besenfelder, U., Müller, M., Lytton, S. D., Jung, G., and Brem, G. (2004).
Cloned transgenic farm animals produce a bispecific antibody for T cell-mediated tumor
cell killing. Proc. Natl. Acad. Sci. USA 101, 6858-6863.
Gossen, M., Bujard, H. 1992. Tight control of gene expression in mammalian cells by
tetracycline-responsive promoters. Proc Natl Acad Sci U S A. 89, 5547-51
Gossen, M., Freundlieb, S., Bender, G., Müller, G., Hillen, W., Bujard, H..
1995.Transcriptional activation by tetracyclines in mammalian cells. Science 268, 1766-9.
Grobet, L., Martin, L.J., Poncelet, D., Pirottin, D., Brouwers, B., Riquet, J., et al. 1997. A
deletion in the bovine myostatin gene causes the double-muscled phenotype in cattle.
Nature Genetics 17, 71-4.
Gu, H., Marth, J.D., Orban, P.C., Mossmann, R., Rajewsky, K. 1994. Deletion of a DNA
polymerase ß gene segment in T cells using cell type-specific gene targeting. Science 265,
103-106.
Habermann, F.A. Wuensch, A., Sinowatz, F. Wolf, E. 2007. Reporter genes for
embryogenesis research in livestock species. Theriogenology 68, S116-S124.
Hammer, R. E., Pursel, V. G., Rexroad, C. E. Jr., Wall, R. J., Bolt, D. J., Ebert, K. M.,
Palmiter, R. D., Brinster, R. L. 1985. Production of transgenic rabbits, sheep and pigs by
microinjection. Nature 315, 680–683.
Han, X., Amar, S., 2002. Identification of genes differentially expressed in cultured human
periodontal ligament fibrobasts vs. human gingival fibroblast by DNA microarray
analysis. J. Dent. Res. 81, 399-405.
Haskell, R. E., and Bowen, R. A. 1995. Efficient production of transgenic cattle by retroviral
infection of early embryos. Mol. Reprod. Dev. 40, 386-390.
Hayflick, L. 1965. The limited in vitro proliferation of human diploid cells. Exp. Cell Res 37;
614-636.
43

Heby, O. 1995. DNA methylation and polyamines in embryonic development and cancer. Int
J Dev Biol. 39, 737-57.
Hochedlinger, K., Jaenisch, R. 2002. Monoclonal mice generated by nuclear transfer from
mature B and T donor cells. Nature 415, 1035-1038.
Hölker, M., Petersen, B., Hassel, P., Kues, W.A., Lemme, E., Lucas-Hahn, A., Niemann, H.
2005. Duration of in vitro maturation of recipient oocytes affects blastocyst development of
cloned porcine embryos. Cloning and Stem Cells 7, 34-43.
Hofmann, A., Kessler, B., Ewerling, S., Weppert, M., Vogg, B., Ludwig, H., Stojkovic, M.,
Boelhauve, M., Brem, G., Wolf, E., and Pfeifer, A. 2003. Efficient transgenesis in farm
animals by lentiviral vectors. EMBO Rep. 4, 1054-1060.
Hofmann, A., Zakhartchenko, V., Weppert, M.,, Sebald, H., Wenigerkind, H., Brem, G.,
Wolf, E., and Pfeifer, A. 2004. Generation of transgenic cattle by lentiviral gene transfer
into oocytes. Biol. Reprod. 71, 405-409.
Hogan, B., Constantini, F., Lacy, E. 1986. Manipulating the mouse embryo. A laboratory
manual. Cold Spring Habor Laboratory.
Holley, R.W., Kiernan, J.A., 1968. “Contact inhibition” of cell division in 3T3 cells. Proc.
Natl. Acad. Sci. USA 60, 300-304.
Hornen, N., Kues, W.A., Carnwath, J.W., Lucas-Huhn, A., Petersen, B., Hassel, P., Niemann,
H. 2007. Production of viable pigs from fetal somatic stem cells. Cloning and Stem Cells 9,
364-73.
Iqbal, K. Kues, W.A., and Niemann, H. 2007. Gene knock down of maternal and embryonic
expressed GFP in murine embryos by the injection of a short interfering RNA (siRNA).
Biochem Biophys Res Commun 358, 727-732.
Jackson, D.A., Symons, R.H., Berg, P. 1972. Biochemical method for inserting new genetic
information into DNA of Simian Virus 40: circular SV40 DNA molecules containing
lambda phage genes and the galactose operon of Escherichia coli. Proc Natl Acad Sci U S
A. 69, 2904-9.
Jaenisch, R., Mintz, B. 1974. Simian virus 40 DNA sequences in healty mice derived from
preimplantation blastocysts injected with viral DNA. Proc. Natl. Acad. Sci. USA 71, 1250-
1254.
Jaenisch, R. 1976. Germ line integration and Mendelian transmission of the exogenous
Moloney leukemia virus. Proc Natl Acad Sci U S A. 73, 1260-4.
Johnson, I.S.. Human insulin from recombinant DNA technology. Science 219, 632-637.
Jorgensen, R.A., Atkinson, R.G., Forster, R.L., Lucas, W.J. 1998. An RNA-based information
superhighway in plants. Science 279, 1486-1487.
44

Kambadur, R., Sharma, M., Smith, T.P., Bass, J.J. 1997. Mutations in myostatin (GDF8) in
double-muscled Belgian Blue and Piedmontese cattle. Genome Research 7, 910-6.
Karlson, P., Doenecke, D., Koolman, J. 2005. Kurzes Lehrbuch der Biochemie für Mediziner
und Naturwissenschaftler. Georg Thieme Verlag Stuttgart, New York.
Kitagawa, M., Higashi, H., Suzuki, I.T., et al., 1994. A cylin-dependent kinase inhibitor,
butyrolactone I, inhibits phosphorylation of RB protein and cell cycle progression.
Oncogene 9, 2549-2557.
Koipally, J., Renold, A., Kim, J., Georgopoulos, K. 1999. Repression by Ikaros and Aiolos is
mediated through histone deacetylase complexes. EMBO J. 18, 3090-100.
Kolber-Simonds, D., Lai, L., Watt, S.R. et al. 2004. Production of alpha-1,3-
galactosyltransferase null pigs by means of nuclear transfer with fibroblasts bearing loss
of heterozygosity mutations. Proc. Natl. Acad. Sci. USA 101, 7335-7340.
Kues, W.A., Wunder, F. 1992. Heterogeneous expression patterns of mammalian potassium
channel genes in developing and adult rat brain. Eur. J. Neurosci. 4, 1296-1308.
Kues, W.A., Sakmann, B., Witzemann, V. 1995a. Differential expression patterns of five
AChR subunit genes in rat muscle during development. Eur. J. Neurosci. 7, 1376-1385.
Kues, W.A., Brenner, H., Sakmann, B., Witzemann, V. 1995b. Local neurotrophic repression
of gene transcripts encoding fetal AChRs at rat neuromuscular synapses. J. Cell Biol. 130,
949-957.
Kues, W.A., Anger, M., Carnwath, J.W., Paul, D., Motlik, J., Niemann, H. 2000. Cell cycle
synchronisation of porcine fetal fibroblasts. Effects of by serum deprivation and reversible
cell cycle inhibitors. Biol. Reprod. 62, 412-419.
Kues, W.A., Carnwath, J. W., Paul, D. and Niemann, H. 2002. Cell cycle synchronization of
porcine fetal fibroblasts by serum deprivation initiates a nonconventional form of
apoptosis. Cloning Stem Cells 4: 231-244.
Kues, W.A. and Niemann, H. 2004. The contribution of farm animals to human health.
Trends in Biotechnology 22, 286-294.
Kues, W. A., Petersen, B., Mysegades, W., Carnwath, J.W. and Niemann, H. 2005a. Isolation
of fetal stem cells from murine and porcine somatic tissue. Biology of Reproduction 72,
1020-1028.
Kues, W.A., Carnwath, J.W., Niemann, H. 2005b. From fibroblasts and stem cells:
Implications for cell therapies and somatic cloning. Reproduction, Fertility and
Development 17, 125-134.
Kues, W. A. Schwinzer, R., Wirth, D., Verhoeyen, E., Lemme, E., Herrmann, D., Barg-Kues,
B., Hauser, H., Wonigeit, H., and Niemann, H. 2006a. Epigenetic silencing and tissue
independent expression of a novel tetracycline inducible system in double-transgenic pigs
FASEB J 20, E1-E10, doi: 10.1096/fj.05-5415fje.
45

Kues, W.A., Hofmann, D.R., Carnwath, J.W., de Souza, F.P., Madeira, H.M.F. and Niemann,
H. 2006b. High incidence of single nucleotide polymorphisms in prion protein gene of
native Brazilian Caracu cattle. J. Anim. Breeding and Genetics 123, 326-330.
Kues, W.A., Rath, D., Niemann, H. 2008. Reproductive biotechnology goes genomics. CAB
Reviews: Perspectives in Agriculture, Veterinary Science, Nutrition and Natural Resources
3, No. 036
Kuroiwa, Y., Kasinathan, P., Choi, Y. J., Naeem, R., Tomizuka, K., Sullivan, E. J., Knott, J.
G., Duteau, A., Goldsby, R. A., Osborne, B. A., Ishida, I., and Robl, J. M. 2002. Cloned
transchromosomic calves producing human immunoglobulin. Nat. Biotechnol. 20, 889–
894.
Kuroiwa Y, Kasinathan P, Matsushita H, Sathiyaselan J, Sullivan EJ, Kakitani M, Tomizuka
K, Ishida I, Robl JM. 2004. Sequential targeting of the genes encoding immunoglobulinmu
and prion protein in cattle. Nat Genet. 36, 775-80.
Kuwaki, K., Tseng, Y. L., Dor, F. J., Shimizu, A., House, S. L., Sanderson, T. M., Lanceros,
C. J., Rabharasuth, D. D., Cheng, J., Moran, K., Hisashi, Y., Mueller, N., Yamadoa, K.,
Greenstein, J. L., Hawley, R. J., Patience,C., Awwad, M., Fishman, J. A., Robson, S. C.,
Schuurman, H. J, Sachs, D. H, and Cooper, D. K. 2005. Heart transplantation in baboons
usion a1,3-glactosyltransferase knock out pigs as donors: initial experiments. Nat. Med.
11, 29-31.
Lai, L., Kolber-Simonds, D., Park, K. W., Cheong, H. T., Greenstein, J. L., Im, G. S., Samuel,
M., Bonk, A., Rieke, A., Day, B. N., Murphy, C. N., Carter, D. B., Hawley, R. J., and
Prather, R. S. 2002. Production of alpha-1,3-galactosyltransferase knockout pigs by
nuclear transfer cloning. Science 295, 1089–1092.
Lai, L., Kang, J.X., Li, R., Wang, J., Witt, W.T., Yong, H.Y., Hao, Y., Wax, D.M., Murphy,
C.N., Rieke, A., Samuel, M., Linville, M.L., Korte, S.W., Evans, R.W., Starzl, T.E.,
Prather, R.S., and Dai, Y. 2006. Generation of cloned transgenic pigs rich in omega-3
fatty acids. Nature Biotechnol. 24, 435-436.
Lander, E.S. et al. 2001. Initial sequence and analysis of the human genome. Nature 409, 860-
921.
Lee, F., Mulligan, R., Berg, P., Ringold, G. 1991. Glucocorticoids regulate expression of
dihydrofolate reductase cDNA in mouse mammary tumour virus chimaeric plasmids.
Nature 294, 228-232.
Li, E. 2002. Chromatin modification and epigenetic reprogramming in mammalian
development. Nat Rev Genet. 3, 662-73.
Lindblad-Toh, K, Wade, CM, Mikkelsen, TS, Karlsson, EK, Jaffe, DB, Kamal, M. et al. 2005.
Genome sequence, comparative analysis and haplotype of the domestic dog. Nature 438,
803-819.
Lo, D., Pursel, V., Linton, P. J., Sandgren, E., Behringer, R., Rexroad, C., Palmiter, R. D., and
Brinster, R. L. 1991. Expression of mouse IgA by transgenic mice, pigs and sheep. Eur. J.
Immunol. 21, 1001-1006
46

Maatouk, D.M., Kellam, L.D., Mann, M.R., Lei, H., Li, E., Bartolomei, M.S., Resnick, J.L.
2006. DNA methylation is a primary mechanism for silencing postmigratory primordial
germ cell genes in both germ cell and somatic cell lineages. Development 133, 3411-8.
Mansour, S.L., Thomas, K.R., Capecchi, M.R. 1988. Disruption of the proto-oncogene int-2
in mouse embryo-derived stem cells: a general strategy for targeting mutations to nonselectable
genes. Nature. 336, 348-52.
Manzini, S., Vargiolu, A., Stehle, I.M., Bacci, M.L., Cerrito, M.G., Giovannoni, R., Zannoni,
A., Bianco, M. R., Forni, M., Donini, P., Papa, M., Lipps, H., and Lavitrano, M. (2006).
Genetically modified pigs produced with a nonviral episomal vector. Proc. Natl. Acad.
Sci. (USA) 103, 17672-17677.
May, T., Eccleston, L., Herrmann, S., Hauser, H., Goncalves, J., Wirth, D. 2008. Bimodal and
hysteretic expression in mammalian cells from a synthetic gene circuit. PloS One 3,
e2372.
Mayer, W., Niveleau, A., Walter, J., Fundele, R., Haaf, T. 2000a. Demethylation of the
zygotic paternal genome. Nature. 403, 501-2.
Mayer, W., Smith, A., Fundele, R., Haaf, T. 2000b. Spatial separation of parental genomes in
preimplantation mouse embryos. J Cell Biol. 148, 629-34.
Mayo, K.E., Warren, R., Palmiter, R.D. 1982. The mouse metallothionein-I gene in
transcriptionally regulated by cadmiun following transfection into human or mouse cells.
Cell 29, 99-108.
Maxam, A.M., Gilbert, W. 1977. A new method for sequencing DNA. Proc Natl Acad Sci U
S A. 74, 560-4
McCurry, KR, Kooyman, Kl, Diamond, LE et al., 1995. Transgenic expression of human
complement regulatory proteins in mice results in diminished complement deposition
during organ xenoperfusion. Transplantation 59, 1177-1183.
McGregor, C.G., Teotia, S.S., Byrne, G.W. et al. 2004. Cardiac xenotransplantation: progress
toward the clinic. Transplantation 78, 1569-1575.
McPherron, A.C., Lee, S.J. 1997. Double muscling in cattle due to mutations in the myostatin
gene. Proc Natl. Acad. Sci. USA 94, 12457-61.
Mellitzer, G., Hallonet, M., Chen, L., Ang, S.L. 2002. Spatial and temporal knock downs of
gene expression by electroporation of dsRNA and morpholinos into early periimplantation
embryos. Mech. Dev. 118, 57-63.
Miller, K.F., Bolt, D.J., Pursel, V.G., Hammer, R.E., Pinkert, C., Palmiter, R.D. 1989.
Expression of human or bovine growth hormone gene with a mouse metallothionein-1
promoter in transgenic swine alters the secretion of porcine growth hormone and insulilike
growth factor-I. J. Endocrinol. 120, 481-488.
47

Moulin, V., Garrel, D., Auger, F.A., et al., 1999. What´s new in human wound-healing
myofibroblasts? Curr. Top. Pathol. 93, 123-133.
Müller, M., Brenig, B., Winnacker, E. L., and Brem, G. 1992. Transgenic pigs carrying
cDNA copies encoding the murine Mx1 protein which confers resistance to influenza
virus infection. Gene 121, 263-270.
Müller, M, Brem, G. 1994 Transgenic strategies to increase disease resistance in livestock.
Reprod. Fert. Dev 6, 605-613.
Müller, U.T. 1999. Ten years of gene targeting: targeted mouse mutants, from vector design
to phenotype analysis. Mech Dev. 82, 3-21.
Mulligan, R.C., Howard, B.H., Berg, P. 1979. Synthesis of rabbit beta-globin in cultured
monkey kidney cells following infection with a SV40 beta-globin recombinant genome.
Nature 277, 108-14.
Nady, N., Min, J., Kareta, M.S., Chédin, F., Arrowsmith, C.H. 2008. A SPOT on the
chromatin landscape? Histone peptide arrays as a tool for epigenetic research. Trends
Biochem Sci. 2008 Jun 4.
Nganvongpanit, K., Müller, H., Rings, B., Gilles, M., Jennen, D., Hoelker, M., Tholen E.,
Schellander, D., Tesfaye, D. 2005. Mol. Reprod. Dev. 73, 153-163.
Niemann, H., Kues, W.A. 2000. Transgenic livestock: premises and promises. Anim. Reprod.
Sci. 60-61, 277-293.
Niemann, H., Kues, W.A. 2003. Application of transgenesis on livestock for agriculture and
biomedicine. Anim. Reprod. Sci. 79, 291–317.
Niemann, H., Kues, W.A., Carnwath, J. W. 2005. Transgenic farm animals: present and past.
Rev. Sci. Tech. OIE 24, 285-298.
Niemann, H, Kues, W.A. 2007. Transgenic farm animals – an update. Reproduction, Fertility
and Development 19, 762-770.
Niemann, H., Carnwath, J.W., Kues, W.A. 2007. Application of array technology to
mammalian embryos. Theriogenology 68S, S165-S177.
Nightingale, P, Martin, P. 2004. The myth of the biotech revolution. Trends Biotechnol 22,
564-569.
Nottle, M. B., Nagashima, H., Verma, P. J., Du, Z. T., Grupen, C. G., McIlfatick, S. M.,
Ashman, R. J., Harding, M. P., Giannakis, C., Wigley, P. L., Lyons, I. G., Harrison, D. T.,
Luxford, B. G., Campbell, R. G., Crawford, R. J., Robins, A. J. 1999. Production and
analysis of transgenic pigs containing a metallothionein porcine growth hormon gene
construct. In ‘Transgenic Animals in Agriculture’. (Eds J. D. Murray, G. B. Anderson, A.
M. Oberbauer, and M. M. McGloughlin) pp. 145-156. (CABI Publishing: New York, NY,
USA.)
48

Orban, PC, Chui, D, Marth, JD 1992. Tissue- and site-specific DNA recombination in
transgenic mice. Proc. Natl. Acad. Sci. USA 89, 6861-6865.
Palmiter, RD, Brinster, RL, Hammer, RE, Trumbauer, ME, Rosenfeld, MG, Birmberg, NC,
Evans, RM, 1982. Dramatic growth of mice that develop from eggs microinjected wit h
metallothionein-growth hormone fusion genes. Nature 300, 611-615.
Panarace, M., Agüero, J.I., Garrote, M. et al., 2006. How healthy are clones and their
progeny: 5 years of field experience. Theriogenology 67, 142-151.
Paradis, F., Vigneault, C., Robert, M.A., Sirard, M. 2005. RNA interference as a tool to study
gene fuction in bovine oocytes. Mol. Reprod. Dev. 70, 111-121.
Pedrail-Noy, G., Spadari, S., Miller-Faures, A., Miller, A.O.A., Kruppa, J., Koch, G. 19980.
Synchronsation of Hela by inhibition of DNA polymerase A with aphidicolin. Nucl. Acid
Res. 8, 377-387.
Pfeifer, A., Ikawa, M., Dayn, Y., Verma, I.M. 2002. Transgenesis by lentiviral vectors: lack
of gene silencing in mammalian embryonic stem cells and preimplantation embryos. Proc
Natl Acad Sci U S A. 99, 2140-5
Phelps, C. J., Koike, C., Vaught, T. D., Boone, J., Wells, K. D., Chen, S. H., Ball, S., Specht,
S. M., Polejaeva, I. A., Monahan, J. A., Jobst, P. M., Sharma, S. B., Lamborn, A. E.,
Garst, A. S., Moore, M., Demetris, A. J., Rudert, W. A., Bottino, R., Bertera, S., Trucco,
M., Starzl, T. E., Dai, Y., and Ayares, D. L. 2003. Production of alpha 1,3galactosyltransferase
deficient pigs. Science 299, 411–414.
Platenburg, G. J., Kootwijk, E. P., Kooiman, P. M., Woloshuk, S. L., Nuijens, J. H.,
Krimpenfort, P. J., Pieper, F. R., de Boer, H. A., and Strijker, R. (1994). Expression of
human lactoferrin in milk of transgenic mice. Transgenic Res. 3, 99-108.
Plusa, B., Frankenberg, S., Chalmers, A., Hadjantonakis, C.A., Moore, N., Papalopulu, V.E.,
Papaioannou, D.M., Glover, M., Zernicka-Goetz, M 2004. Downregulation of Par3 and
aPKC function directs cells towards the ICM in the preimplantation mouse embryo. J.
Cell Sci. 118, 505-515.
Pursel, V.G., Pinkert C.A., Miller ,K.F., Boldt, D.J., Campbell, R.G., Palmiter ,R.D., Brinster,
R.L., Hammer, R.E. 1989. Genetic engineering of livestock. Science 244, 1281-1288.
Pursel, V. 1998. Modification of production traits. In AnimalBreeding — Technology for the
21st Century, ed. Clark, A. J.,pp. 183—200, Overseas Publishers Association,
Amsterdam.
Pursel, V. G., Wall, R. J., Mitchell, A. D., Elsasser, T. H., Solomon, M. B., Coleman, M. E.,
Mayo, F., and Schwartz, R. J. 1999. Expression of insulin-like growth factor-1 in skeletal
muscle of transgenic pigs. In ‘Transgenic animals in agriculture’. (Eds J. D. Murray, G. B.
Anderson, A. M. Oberbauer and M. M. McGloughlin.) pp. 131-144. (CABI Publishing:
New York, NY, USA.)
Reed, S.I., 1997. Control of the G1/S transition. Cancer Surv 29, 7-23.
49

Reik, W. 2007. Stability and flexibility of epigenetic gene regulation in mammalian
development. Nature. 447: 425-32
Reh, W.A., Maga, E. A., Collette, N. M., Moyer, A., Conrad-Brink, J. S., Taylor, S. J.,
DePeters, E. J., Oppenheim, S., Rowe, J. D., BonDurant, R. H., Anderson, G. B., and
Murray, J. D. 2004. Hot topic: using a stearoyl-CoA desaturase transgene to alter milk
fatty acid composition. J. Dairy Sci. 87, 3510-3514.
Richt, J.A., Kasinathan, P., Hamir, A.N., Castilla, J., Sathiyaseelan, T. et al., 2007. Production
of cattle lacking prion protein. Nat Biotechnol. 25, 132-8
Robertson, A., Perea, J., Tomachova, T., Thomas, P.K., Huxley, C. 2002. Effects of mouse
strain, position of integration and tetracycline analogue on the tetracycline conditonal
system in transgenic mice. Gene 282, 65-72.
Robl, J. M., Wang, Z., Kasinathan, P., and Kuroiwa, Y. 2007. Transgenic animal production
and animal biotechnology. Theriogenology 67, 127-133
Rudolph, N. S. 1999. Biopharmaceutical production in transgenic livestock. Trends
Biotechnol. 17, 367–374.
Saeki, K., Matsumoto, K., Kinoshita, M., Suzuki, I., Tasaka, Y., Kano, K., Taguchi, Y.,
Mikami, K., Hirabayashi, M., Fashiwazaki, N., Hosoi, Y., Murata, N., and Iritani, A.
2004. Functional expression of a Delta12 fatty acid desaturase gene from spinach in
transgenic pigs. Proc. Natl. Acad. Sci. USA 101, 6361-6366.
Sanger, F., Donelson, J.E., Coulson, A.R., Kössel, H., Fischer, D. 1973.Use of DNA
polymerase I primed by a synthetic oligonucleotide to determine a nucleotide sequence in
phage fl DNA. Proc Natl Acad Sci U S A. 70, 1209-13
Sambrook, J, Frisch, EF, Maniatis, T. Molecular cloning. A laboratory manual. 2 nd Ed. Cold
Spring Habor Laboratory 1989.
Sanger, F., Nicklen, S., Coulson, A.R. 1977. DNA sequencing with chain-terminating
inhibitors. Proc Natl Acad Sci U S A. 74, 5463-7.
Sauer, B., Henderson, N. 1988. Site-specific DNA recombination in mammalian cells by the
Cre recombinase of bacteriophage P1. Proc Natl Acad Sci U S A. 85, 5166-70.
Sauer, B.1998. Inducible gene targeting in mice using the Cre/lox system. Methods 14, 381-
92.
Schätzlein, S., Lucas-Hahn, A., Lemme, E., Kues, W.A., Dorsch, M., et al., 2004. Telomere
length is reset during early embryogenesis. Proc. Natl.l Acad. Sci. USA 101, 8034-8038.
Scharschmidt, T.C., Segre, J.A.. 2008. Modeling atopic dermatitis with increasingly complex
mouse models. J Invest Dermatol. 128, 1061-4.
Schnieke, A. E., Kind, A. J., Ritchie, W. A., Mycock, K., Scott, A. R., Ritchie, M., Wilmut, I.,
Colman, A., and Campbell, K. H. 1997. Human factor IX transgenic sheep produced by
transfer of nuclei from transfected fetal fibroblasts. Science 278, 2130-2133.
50

Schuelke, M., Wagner, K.R., Stolz, L.E., Hübner, C., Riebel, et al. 2004. Myostatin mutation
associated with gross muscle hypertrophy in a child. New England Journal of Medicine
350: 2682-8.
Schultze, N., Burki, Y., Lang, Y., Certa, U., Bluethmann, H. 1996. Efficient control of gene
expression by single step integration of the tetracycline system in transgenic mice. Nat
Biotechnol. 14, 499-503.
Schultz, R.M., 2002. The molecular foundations of the maternal to zygotic transition in the
preimplantion embryo. Hum. Reprod. Update 8, 323-331.
Senawong, T., Peterson, V.J., Avram, D., Shepherd, D.M., Frye, R.A., Minucci, S., Leid, M..
2003. Involvement of the histone deacetylase SIRT1 in chicken ovalbumin upstream
promoter transcription factor (COUP-TF)-interacting protein 2-mediated transcriptional
repression. J Biol Chem. 278, 43041-50
Sharp, PA, 2001. RNA interference-2001. Genes Development 15, 485-490.
Soares, M.L., Haraguchi, S., Torres-Padilla et al., 2005. Functional studies of signalling
pathways in peri-implantation development of the mouse embryo by RNAi. BMC Dev.
Biol. 5, 1-11.
Stepensky, D., Kleinberg, L., Hoffman, A., 2003. Bone as an effect compartment . Clin.
Pharmacokinet, 42, 863-881.
St-Onge, L., Furth, P.A., Gruss, P.1996. Temporal control of the Cre recombinase in
transgenic mice by a tetracycline responsive promoter. Nucleic Acids Res. 24, 3875-7.
Svoboda, P., Stein, P., Hayashi, H., Schultz, R.M. 2000. Selective reduction of dormant
maternal mRNA in mouse oocytes by RNA interference. Development 127, 4147-4156.
Szabo, P.E., Huebner, K., Scholer, H., Mann, J.R. 2002. Allele-specific expression of
imprinted genes in mouse migratory primordial germ cell. Mech. Dev. 115, 157-160.
Taft RA. 2008. Virtues and limitations of the preimplantation mouse embryo as a model
system. Theriogenology 69, 10-16.
Tenenhaus Dann, C., Alvarado, A. L., Hammer, R. E., and Garbers, D. L. 2006. Heritable and
stable gene knockdown in rats. Proc. Natl., Acad. Sci. USA 103, 11246-11251.
Van den Hout, J. M., Reuser, A. J., de Klerk, J. B., Arts, W. F., Smeitink, J. A., and Van der
Ploeg, A. T. (2001). Enzyme therapy for Pompe disease with recombinant human aglucosidase
from rabbit milk. J. Inherit. Metab. Dis. 24, 266–274.
Van Reenen, C.G., Meuwissen, T.H.E., Hopster, H, Oldenbroek, K., Kruip, T.H., Blokhuis,
H.J. 2001. Transgenesis may affect farm animal welfare: a case for systemic risk
assessment. J. Anim Sci 79, 1763-1769.
Wall, RJ. 1996. Transgenic livestock: progress and prospects for the future. Theriogenology
45, 57-68.
51

Wall, R.J., Powell, A., Paape, M.J., Kerr, D.E., Bannermann, D.D., Pursel, V.G., Wells, K.D.,
Talbot, N., and Hawk, H. (2005). Genetically enhanced cows resist intramammary
Staphylococcus aureus infection. Nat. Biotechnology 23, 445-451.
Wall RJ, Shani M. 2008. Are animal models as good as we think? Theriogenology 69, 2-9.
Wang, X., Willenbring , H., Akkari, Y., et al., 2003. Cell fusion is the principal source of
bone-marrow-derived hepatocytes. Nature 422, 897-901.
Watson, J.D., Tooze, J, Kurtz, DT 1983. Recombinant DNA. A short course. Scientific
American Books 1983.
Wells, D.N., Misica, P.M., Day, T.A., Tervit, H.R. 1997. Production of cloned lambs from an
established embryonic cell line: a comparision between in vivo and in vitro-matured
cytoplasts Biol. Reprod. 57, 385-393.
Wianny, F., Zernicka-Goetz, M. 2000. Specific interference with gene function by doublestranded
RNA in early mouse development. Nat. Cell Biol 2, 70-75.
Wilmut, I. Schnieke, A. E., McWhir, J., Kind, A. J., and Campbell, K. H. 1997. Viable
offspring derived from fetal and adult mammalian cells. Nature 385, 810-813.
Wheeler, M. B., Bleck, G. T., and Donovan, S. M. 2001. Transgenic alteration of sow milk to
improve piglet growth and health. Reproduction 58 (Suppl.), 313-324.
Whitelaw, C. B., Radcliffe, P. A., Ritchie, W. A., Carlisle, A., Ellard, F. M., Pena, R. N.,
Rowe, J., Clark, A. J., King, T. J., and Mitrophanous, K.A. 2004. Efficient generation of
transgenic pigs using equine infectious anaemia virus (EIAV) derived vector. FEBS Lett.
571, 233-236.
Wolf, E, Schernthaner, W, Zakhartchenko, V, Prelle, K, Stojkovic, M, BremG 2000.
Transgenic technology in farm animals-progress and perspectives. Exp Physiol 85, 615-
625.
Yadav, P., Kues, W.A., Herrmann, D., Carnwath, J.W., Niemann, H. 2005. Bovine ICMs
express the Oct4 ortholog. Molecular Reproduction and Development 72, 182-190.
Yang XW, Gong S. An overview on the generation of BAC transgenic mice for neuroscience
research.Curr Protoc Neurosci. 2005 May
Yamada, K., Yazawa, K., Shimizu, A., Iwanaga, T., Hisashi, Y., Nuhn, M., O’Malley, P.,
Nobori, S., Vagefi, P. A., Patience, C., Fishman, J., Cooper, D. K., Hawley, R. J.,
Greenstein, J., Schuurman, H. J., Awwad, M., Sykes, M., and Sachs, D. H. 2005. Marked
prolongation of porcine renal xenograft survival in baboons through the use of α1,3galactosyltransferase
gene-knockout donors and the cotransplantation of vascularized
thymic tissue. Nature Med. 11, 32-34.
Yao, Y.L., Yang, W.M., Seto, E. 2001. Regulation of transcription factor YY1 by acetylation
and deacetylation. Mol Cell Biol. 21, 5979-91.
52

Yarranton, GT. 1992. Inducible vectors for expression in mammalian cells. Curr Opin
Biotechnol. 3, 506-11.
Yeom, Y.I., Fuhrmann, C.E., Ovitt, C.E., Brehm, A., Ohbo, K., Grosse, M., Huebner ,K.,
Scholer H.R., 1996. Germline regularory element of Oct4 specific for the totipotent cyle
of embryonal cell. Development 122, 881-984.
Ying, Q.L., Nichols, J., Evans, W.P., Smith, A.G. 2002. Changing potency by spontaneous
fusion. Nature 416, 545-548.
Yong-Guang, Y., Sykes, M. 2007. Xenotransplantation: current status and a perspective on
the future. Nat. Reviews Immunology.
Young LE, Sinclair KD, Wilmut I. 1998. Large offspring syndrome in cattle and sheep. Rev
Reprod. 3, 155-63
Zaidi, A., Schmoeckel, M, Bhatti, F et al., 1998. Life-supporting pig to primate renal xenotransplantation
using genetically modified donors. Transplantation 65, 1584-1590.
Zetterberg, A., Larsson, O., Wiman, K.G., 1995. What is the restriction point? Curr. Opin,
Cell Biol. 7, 835-842.
Zhong, R. 2007. Gal knockout and beyond. American J. Transplant. 7, 5-11.
Zhou, D., He, Q.S., Wang, C., Zhang, J., Wong-Staal, F. 2006. RNA interference and
potential applications. Curr Top Med Chem. 6, 901-11.
Zuelke, R. 1998.Transgenic modification of cows milk for value-added processing. Reprod
Fertil Dev. 10, 671-6.
53

7.0 Danksagungen
Prof. Dr. H. Niemann danke ich für die gewährte wissenschaftliche Freiheit.
Dr. J. Carnwath, Prof. K. Wonigeit (MHH), Dr. D. Wirth (HZI, Bs), Dr. H. Hauser (HZI, Bs)
und Dr. C. Wrenzycki (jetzt TiHo) danke ich für die intensiven Diskussionen. Dr. B.
Petersen, Dr. A. Lucas-Hahn, Dr. M. Hölker (jetzt Universität Bonn) und Dr. N. Hornen (jetzt
praktizierende Tierärztin) hatten entscheidenden Anteil an den Kerntransferversuchen.
Frau D. Herrmann hat in ausgezeichneter Weise die zahlreichen Proben aufgearbeitet; die
Zellkulturen wurden durch Frau W. Mysegades (jetzt stud. Veterinärmedizin), die Maus- und
Embryonenkulturversuche durch Frau E. Lemme und Frau K. Korsawe und die
Grosstierversuche durch Herrn K.-H. Hadeler technisch hervorragend unterstützt.
Für die photo- und printtechnische Unterstützung wird dem Photographen gedankt.
Für das zur Verfügungstellen von spezifischen Plasmiden und Zell-Linien wird Dr. M. Anger,
(Universität Oxford), Dr. J. Bode (HZI, Braunschweig), Dr. M. Buchholz (MPI, Dresden), Dr.
T. Cantz (MPI, Münster), Dr. K. Collins (Berkeley, Californien), Dr. E. Heinemann
(Whitehead Institute, Cambridge), Dr. Lipps, (Universität Witten), Dr. U. Martin (MHH,
Hannover), Dr. Ritter (Charite, Berlin), Dr. T. Saric (Universität Köln), Dr. V. Witzemann
(MPI, Heidelberg) und Dr. J.K. Zhu (University of California) ganz herzlich gedankt.
Für die finanzielle Förderung der DFG (Transregio 535) und des BMBF wird gedankt.
54

8.0 Darstellung des eigenen Anteils an den wissenschaftlichen Publikationen
Characterisierung primärer Zellen als Donorzellen für den Kerntransfer
Anger, M., Kues, W.A., Klima, J., Mielenz, M., Motlik, J., Carnwath, J.W. and Niemann, H.
2003 Cloning and cell cycle-specific regulation of Polo-like kinase in porcine fetal fibroblasts.
Molecular Reproduction and Development 65, 245-253.
a) Idee und Versuchsplanung Anger, M, Kues, W.A.
b) Versuchsdurchführung Anger, M., Kues, W.A., Klima, J. Mielenz, M.
c) Auswertung Anger, M., Kues, W.A.
d) Verfassen des Manuskriptes Anger, M., Kues, W.A., Motlik, J., Niemann, H.
Kues, W. A., Petersen, B., Mysegades, W., Carnwath, J.W. and Niemann, H. 2005a. Isolation
of fetal stem cells from murine and porcine somatic tissue.
Biology of Reproduction 72, 1020-1028
a) Idee und Versuchsplanung Kues, W.A.
b) Versuchsdurchführung Kues, W.A., Mysegardes, W.
c) Auswertung Kues, W.A., Niemann, H.
d) Verfassen des Manuskriptes Kues, W.A., Carnwath, J.W., Niemann, H.
Yadav, P., Kues, W.A., Herrmann, D., Carnwath, J.W., Niemann, H. 2005. Bovine ICMs
express the Oct4 ortholog.
Molecular Reproduction and Development 72, 182-190.
a) Idee und Versuchsplanung Kues, W.A., Niemann, H.
b) Versuchsdurchführung Yadav, P.
c) Auswertung Kues, W.A.
d) Verfassen des Manuskriptes Yadav, P., Kues, W.A., Niemann, H.
Dieckhoff B, Karlas A, Hofmann A, Kues WA, Petersen B, Pfeifer A, Niemann H, Kurth R,
Denner J. 2007. Inhibition of porcine endogenous retroviruses (PERVs) in primary porcine
cells by RNA interference using lentiviral vectors.
Archives of Virology 152, 629-34.
a) Idee und Versuchsplanung Denner, J
b) Versuchsdurchführung Dieckhoff, B.
c) Auswertung Dieckhoff, B., Kues, Denner, J.
d) Verfassen des Mauskriptes Denner, J; Kues, W.A.; Denner, J., Niemann, H.
55

DNA-Mikroinjektion und somatischer Kerntransfer
Schätzlein S., Lucas-Hahn, A., Lemme, E., Kues, W.A., Dorsch, M., Manns, M., Niemann,
H., Rudolph, K.H. 2004. Telomere length is reset during early embryogenesis.
Proceedings of the National Academy of Sciences of the USA 101, 8034-8038.
a) Idee und Versuchsplanung Niemann, H., Rudolph, K.H.
b) Versuchsdurchführung Schätzlein, S., Lucas-Hahn, A., Lemme, E., Kues, W.A.
c) Auswertung Rudolph, K.H., Schätzlein, S., Kues, W.A., Niemann, H.
d) Verfassen des Manuskriptes Rudolph, K.H., Schätzlein, S., Kues, W.A., Niemann, H.
Hölker, M., Petersen, B., Hassel, P., Kues, W.A., Lemme, E., Lucas-Hahn, A., Niemann, H.
2005. Duration of in vitro maturation of recipient oocytes affects blastocyst development of
cloned porcine embryos.
Cloning and Stem Cells 7, 34-43.
a) Idee und Versuchsplanung Niemann, H., Kues, W.A..
b) Versuchsdurchführung Hölker, M., Petersen, B.
c) Auswertung Hölker, M.., Kues, W.A., Niemann, H.
d) Verfassen des Manuskriptes Hölker, M.; Kues, W.A., Niemann, H.
Kues, W.A., Schwinzer, R., Wirth, D., Verhoeyen, E., Lemme, E., Herrmann, D., Barg-Kues,
B., Hauser, H., Wonigeit, K., Niemann H. 2006 Epigenetic silencing and tissue independent
expression of a novel tetracycline inducible system in double-transgenic pigs.
FASEB J. 20, E1-E10, doi: 10.1096/fj.05-5415fje.
a) Idee und Versuchsplanung Kues, W.A., Niemann, H., Hauser, H., Wonigeit, K.
b) Versuchsdurchführung Kues, W.A., Schwinzer, R.
c) Auswertung Kues, W.A., Schwinzer, R.
d) Verfassen des Manuskriptes Kues, W.A., Niemann, H.
Deppenmeier, S., Bock, O., Mengel, M., Niemann, H., Kues, W., Lemme, E., Wirth, D,
Wonigeit, K., Kreipe, H. 2006. Health status of transgenic pig lines expressing human
complement regulator protein CD59.
Xenotransplantation 13, 345-356.
a) Idee und Versuchsplanung Wonigeit, K., Niemann, H., Kreipe, H.
b) Versuchsdurchführung Deppenmeier, S.
c) Auswertung Deppenmeier, S., Kues, W.A., Bock, O., Wonigeit. K
d) Verfassen des Manuskriptes Deppenmeier, S., Bock, O., Kues, W.A., Niemann, H.
Hornen, N., Kues, W.A., Carnwath, J.W., Lucas-Huhn, A., Petersen, B., Hassel, B.,
Niemann, H. 2007. Production of viable pigs from fetal somatic stem cells.
Cloning and Stem Cells 9, 364-73.
a) Idee und Versuchsplanung Kues, W.A., Niemann, H.
b) Versuchsdurchführung Hornen, N.
c) Auswertung Hornen, N., Kues, W.A.
d) Verfassen des Manuskriptes Hornen, N., Niemann, H., Kues, W.A.
56

Iqbal, K, Kues, W.A., Niemann, H. 2007. Parent of origin dependent gene-specific knock
down in mouse embryos.
Biochemical Biophysical Research Communications 358, 727-732.
a) Idee und Versuchsplanung Kues, W.A.
b) Versuchsdurchführung Iqbal, K.
c) Auswertung Iqbal, K, Kues, W.A.
d) Verfassen des Manuskriptes Kues, W.A., Niemann, H.
Dieckhoff, B., Petersen, B., Kues, W.A., Kurth, R., Niemann, H., Denner, J. 2008.
Knockdown of porcine endogenous retrovirus (PERV) expression by PERV-specific shRNA
in transgenic pigs .
Xenotransplantation 15, 36-45.
a) Idee und Versuchsplanung Denner, J.
b) Versuchsdurchführung Dieckhoff, B., Petersen, B., Kues, W.A.,
c) Auswertung Dieckhoff, B.
d) Verfassen des Manuskriptes Dieckhoff, B., Kues, W.A., Niemann, H., Denner, J.
Übersichtsartikel: Transgene Nutztiere, Stammzellen und DNA-Array Analysen
Niemann, H., and Kues, W.A. 2003. Application of transgenesis in livestock for agriculture
and biomedicine.
Animal Reproduction Science 79, 291-317.
a) Idee Niemann, H., Kues, W.A.
b) Umsetzung Niemann, H., Kues, W.A.
c) Verfassen des Manuskriptes Niemann, H., Kues, W.A.
Kues, W.A. and Niemann, H. 2004. The contribution of farm animals to human health.
Trends in Biotechnology 22, 286-294.
a) Idee Kues, W.A., Niemann, H.
b) Umsetzung Kues, W.A., Niemann, H.
c) Verfassen des Manuskriptes Kues, W.A., Niemann, H.
Kues, W.A., Carnwath, J.W., Niemann, H. 2005b. From fibroblasts and stem cells:
Implications for cell therapies and somatic cloning.
Reproduction, Fertility and Development 17, 125-134.
a) Idee Kues, W.A., Niemann, H.
b) Umsetzung Kues, W.A., Niemann, H.
c) Verfassen des Manuskriptes Kues, W.A., Carnwath, J.W., Niemann, H.
57

Niemann H, Kues W, Carnwath JW. 2005. Transgenic farm animals: present and future.
OIE Scientific and Technical Reviews (Rev. Sci. Tech. Off. Int. Epiz.) 24, 284-298.
a) Idee Niemann, H.
b) Umsetzung Kues, W.A., Niemann, H.
c) Verfassen des Manuskriptes Niemann H, Kues W, Carnwath JW
Niemann, H, Kues, W.A. 2007. Transgenic farm animals – an update.
Reproduction, Fertility and Development 19, 762-770.
a) Idee Kues, W.A., Niemann, H
b) Umsetzung Kues, W.A., Niemann, H.
c) Verfassen des Manuskriptes Kues, W.A., Niemann, H.
Niemann, H., Carnwath, J.W., Kues, W.A. 2007. Application of array technology to
mammalian embryos.
Theriogenology 68S, S165-S177.
a) Idee Niemann, H.
b) Umsetzung Kues, W.A., Niemann, H.
c) Verfassen des Manuskriptes Kues, W.A., Carnwath, J.W., Niemann, H.
Kues, W.A., Rath, D., Niemann, H. 2008. Reproductive biotechnology goes genomics.
CAB Reviews: Perspectives in Agriculture, Veterinary Science, Nutrition and Natural
Resources 3, No. 036, 1-18.
a) Idee Kues, W.A., Niemann, H.
b) Umsetzung Kues, W.A., Niemann, H.
c) Verfassen des Manuskriptes Kues, W.A., Rath, D., Niemann, H.
58

9. Abkürzungsverzeichnis
ACTB ß-Actin-Gen
AdoMet S-Adenosylmethionin
AVR akute vasculäre Abstoßung
BAC bakterielles artifizielles Chromosom
Bp Basenpaar
BSE bovine spongiforme Enzephalitis
CpG Cytosin-Guanin-Dinukleotid
CMV Cytomegalovirus
DNA-MT DNA-Methyltransferase
EMEA European Medicine Agency
ES embryonale Stammzelle
Fo Founder, transgenes Tier, das zur Gründung einer Linie genutzt wird
F1…n erste Generation einer transgenen Linie, …nte Generation
FACS fluorescence activated cell sorting
FDA Food and Drug Agency
G0, G1 Zellzyklusphase G0 (Ruhephase), G1 (gap1 der Interphase)
GDF8 Myostatin-Gen
GFP green fluorescent protein
GH Wachstumshormon
GMP good manufacturing practices
FSSC fetal somatic stem cell
hCD59 humaner Komplementregulator CD59
hDAF humaner Komplementregulator DAF, decay accelerating factor
IRES interne Ribosomenbindungsstelle
5mCpG 5-Methyl-CpG
mRNA messenger RNA
NTA bicistronische Kassette mit tTA als zweitem Cistron
Oct4/OCT4 octamer binding transcription factor 4
OG2 Oct4-GFP transgene Mauslinie 2
PA Polyadenylierungssequenz
pCMV
Promoter von CMV
PERV porcine endogene Retroviren
PRNP Prionprotein-Gen
ptTA tetracyclin-sensitiver Promoter, wird durch Bindung von tTA induziert
RCA regulator of complement activation, Komplementregulator
RISC RNA induced silencing complex
RNAi RNA-Interferenz
siRNA short interfering RNA
shRNA short hairpin RNA
SNP Einzelbasenpolymorphismus
SPF spezifisch Pathogen-frei
STE swine testis epithelial cell line
SV40 Simian Virus 40
tetO Tetracyclin-Operator
tet-off konditionale Genexpression, tTA wird durch Tetracyclin inaktiviert
tet-on konditionale Genexpression, mutierter tTA wird durch Tetracyclin aktiviert
tg transgen; transgenes Tier
tTA tetracycline dependent transactivator
wt wildtype; nicht-transgenes Tier
59

10. Anhang: Nachdruck der eigenen Publikationen
In chronologischer Abfolge
60

Abstract
Animal Reproduction Science 79 (2003) 291–317
Application of transgenesis in livestock for
agriculture and biomedicine
Heiner Niemann ∗ , Wilfried A. Kues
Department of Biotechnology, Institut für Tierzucht Mariensee, FAL,
31535 Neustadt, Germany
Received 13 November 2002; received in revised form 27 January 2003; accepted 3 February 2003
Microinjection of foreign DNA into pronuclei of a fertilized oocyte has predominantly been
used for the generation of transgenic livestock. This technology works reliably, but is inefficient
and results in random integration and variable expression patterns in the transgenic offspring.
Nevertheless, remarkable achievements have been made with this technology. By targeting expression
to the mammary gland, numerous heterologous recombinant human proteins have been
produced in large amounts which could be purified from milk of transgenic goats, sheep, cattle
and rabbit. Products such as human anti-thrombin III, -anti-trypsin and tissue plasminogen
activator are currently in advanced clinical trials and are expected to be on the market within
the next few years. Transgenic pigs that express human complement regulating proteins have
been tested in their ability to serve as donors in human organ transplantation (i.e. xenotransplantation).
In vitro and in vivo data convincingly show that the hyperacute rejection response
can be overcome in a clinically acceptable manner by successful employing this strategy. It is
anticipated that transgenic pigs will be available as donors for functional xenografts within a
few years. Similarly, pigs may serve as donors for a variety of xenogenic cells and tissues. The
recent developments in nuclear transfer and its merger with the growing genomic data allow
a targeted and regulatable transgenic production. Systems for efficient homologous recombination
in somatic cells are being developed and the adaptation of sophisticated molecular tools,
already explored in mice, for transgenic livestock production is underway. The availability of these
technologies are essential to maintain “genetic security” and to ensure absence of unwanted side
effects.
© 2003 Elsevier B.V. All rights reserved.
Keywords: Nuclear transfer; Pronuclear DNA injection; Xenotransplantation; Recombinant proteins; Gene
targeting
∗ Corresponding author. Tel.: +49-5034-871-148; fax: +49-5034-871-101.
E-mail address: niemann@tzv.fal.de (H. Niemann).
0378-4320/$ – see front matter © 2003 Elsevier B.V. All rights reserved.
doi:10.1016/S0378-4320(03)00169-6

292 H. Niemann, W.A. Kues / Animal Reproduction Science 79 (2003) 291–317
1. Introduction: animal breeding and biotechnology
Breeding of livestock has a long standing and very successful tradition. It began with
domestication by which man habituated animals to live in his proximity. Using the available
methodology man has propagated useful populations of animals. The selection was predominantly
done on the basis of the phenotype and specific traits. A scientifically based animal
breeding has existed for approximately 50 years on the basis of the increasing knowledge
in population genetics and statistics. From the early beginning, this approach incorporated
biotechnological procedures for which artificial insemination (AI) is the preeminent example.
In cattle AI is employed in all countries with advanced breeding programs. Recently,
significant increases in AI-application are also observed in swine where currently approximately
50% of the sows are artificially inseminated. This technology allows for a more
efficient exploitation of the genetic potential of valuable sires and their propagation in a
given population, frequently on a truly international scale. In the 1980s, embryo transfer
technology has been transferred from an experimental stage to commercial application. This
technology allowed for the first time a better exploitation of the genetic potential of the female
in livestock breeding. As of today, >530,000 bovine embryos are transferred annually
worldwide of which half are used upon freezing and thawing. In the other livestock species
only very few embryos are transferred on a yearly basis (Thibier, 2001). The efforts of animal
breeders and the application of artificial insemination, embryo transfer and further biotechnological
procedures have resulted in the well known and remarkable increases in performances
of livestock production. However, four major limitations have to be considered:
1. The genetic progress reaches only 1–3% per year and is thus relatively slow.
2. It is hardly or not possible to separate desired traits from non-desired traits.
3. A targeted transfer of genetic information between different species has not been possible.
4. Difficult adaptation to local conditions.
Biotechnological procedures which have been under development during the past 20 years
opened the perspectives to overcome the limitations listed above. Today, the term “biotech-
Fig. 1. Generation of transgenic pigs for xenotransplantation. (A) Minigene construct for microinjection, PCMV:cytomegalovirus
immediate early promoter, hCD59: human CD59 (regulator of complement) cDNA, PA: polyadenylation
site, PvuI and AspI: flanking restriction enzyme sites. (B) DNA microinjection into one pronucleus of a
porcine zygote. Prior to microinjection the zygote was centrifuged to separate the dark lipids from the cytoplasmatic
fraction to allow optic identification of the pronuclei. (C) Transgenic founder animal identified by Southern
blotting of an ear sample. (D) Organ-specific expression of hCD59 protein in an F1-offspring animal determined
by Western blotting with a specific monoclonal antibody. (E) Cell surface expression of hCD59 in porcine primary
cells as determined by flow cytometry. Grey shadowed curves demonstrated presence of hCD59 by usage of a monoclonal
antibody, white curves indicate background values by usage of an isotype matched control antibody. (F)
Functional expression of human CD59 on transgenic porcine cells as demonstrated by cytotoxicity assay. Porcine
cells were incubated with heat treated human serum and a dilution series of human complement. Specific lysis of
porcine cells were measured by chromium release. (G) Ex vivo perfusion of porcine kidneys from F1-animals with
human blood. Nearly all transgenic porcine kidneys could be perfused for 4 h, whereas non-transgenic control
kidneys failed soon after onset of perfusion due to hyperacute rejection. Mean survival times were 207.5 min for
transgenic and 57.5 min for wildtype kidneys (P < 0.005) (Data from Niemann et al., 2001).

H. Niemann, W.A. Kues / Animal Reproduction Science 79 (2003) 291–317 293
nology in livestock” comprises an arsenal of reproductive-biological and molecularbiological
procedures. Reproductive biology includes: artificial insemination (AI), estrous
synchronization, regulation of parturition, embryo transfer (ET), cryopreservation of gametes
and embryos, sexing of sperm and embryos, in vitro production of embryos (IVP,
including: in vitro maturation (IVM), in vitro fertilization (IVF) and in vitro culture (IVC)),
embryo bisection, nuclear transfer (NT, cloning), microinjection technology (DNA, RNA,

294 H. Niemann, W.A. Kues / Animal Reproduction Science 79 (2003) 291–317
Antisense). Molecular genetics comprise: genome analysis (sequencing, mapping, polymorphisms),
molecular diagnostics (genetic defects (MHS, malignant hyperthermia syndrome;
Dumps, deficiency of uridine monophosphate synthetase; Blad, bovine leucocyte adhesion
deficiency), genetic descent, genetic diversity), functional genomics (expression patterns,
interactions of genes), transgenics (additive gene transfer, knockout).
Livestock biotechnology has an interdisciplinary character and comprises elements from
anatomy, gynecology and obstetrics, endocrinology and physiology, andrology, ultrasoundtechnology,
biochemistry, cell biology and molecular biology. The further development and
refinement of bio- and gene technology with the goal to achieve commercial exploitation is
considered to be an important tool to cope with future challenges in livestock production.
A prominent example for biotechnological procedures with significant effects in animal
production is the transgenic technology. Gene transfer is defined as the introduction of a
protein coding DNA fragment into the host genome with the goal that the foreign DNA
contributes to the protein synthesis of the host organism, e.g. the transgenic animal. Usually
gene transfer involves gene constructs which are artificially combined DNA fragments
consisting of regulatory and protein coding sequences. DNA microinjection and nuclear
transfer are the two feasible technical approaches to generate transgenic livestock.
Microinjection involves injection of several thousands of DNA copies into pronuclei of
zygotes; zygotes are transferred into recipients and offspring is screened for integration and
expression of the foreign DNA (Fig. 1A–D). Although this procedure is reliable, it is inefficient
(1–4% transgenic offspring/transferred microinjected zygotes), results in random
integration into the host genome and variable expression due to position effects (Pursel and
Rexroad, 1993; Wall, 1996). In addition, it is time-consuming and requires substantial intellectual,
financial and material resources (Seidel, 1993). Attributed to the enormous amounts
of resources needed for transgenic livestock production, the costs for one expressing transgenic
animal are extraordinary high. It has been calculated that one expressing transgenic
mouse requires average expenses of 121 US$, whereas one expressing transgenic pig would
amount to 25,000 US$, one transgenic sheep 60,000 US$ and one transgenic cow 546,000
US$ (Wall et al., 1992). Transgenic production in cattle can only be practical through in
vitro production of embryos. From a total of more than 36,500 microinjected zygotes ≈2300
developed to blastocysts, upon transfer 28% resulted in pregnancy and 18 transgenic calves
could be identified. To improve efficiency of the procedure the embryos were biopsied and
analyzed by PCR for the presence of the transgene (Eyestone, 1999). The early detection of
transgenesis in preimplantation embryos has been shown to be feasible, however, efficiency
is limited due to an early incidence of mosaicism (Lemme et al., 1994). The propagation
of the transgenic trait in a given cattle population can be accomplished through in vitro
production techniques by using semen from a transgenic bull for in vitro fertilization and
collecting oocytes by means of ultrasound-guided follicular aspiration from transgenic female
founder animals and their subsequent use in IVF (Eyestone, 1999). Details of the
microinjection technology and the potential applications of transgenic livestock have been
extensively reviewed (Rexroad, 1992; Wall et al., 1992; Pursel and Rexroad, 1993; Niemann
et al., 1994, 2002a; Wall, 1996; Murray, 1999).
Despite the inherent limitations, microinjection has allowed commercial exploitation of
transgenic technology with animals for biomedical purposes and even for few agricultural
traits. Substantial progress in livestock transgenesis has been made through application of

H. Niemann, W.A. Kues / Animal Reproduction Science 79 (2003) 291–317 295
somatic nuclear transfer. It is anticipated that the merger of nuclear transfer with molecular
tools, such as targeted genetic modification and conditional gene expression already
explored in mice, will provide another boost to livestock transgenesis (Niemann and Kues,
2000).
2. Current status of animal transgenesis
2.1. Transgenic animals with agricultural traits
An Australian group has generated transgenic pigs bearing an hMt-pGH construct that can
tightly be regulated by zinc feeding. The transgenic animals show significant improvements
in economically important traits such as growth rate, feed conversion and bodyfat–muscle
ratio (Nottle et al., 1997, 1999). Transgenic sheep carrying a keratin-IGF-I construct show
expression in the skin and the clear fleece was about 6.2% greater in transgenic versus
non-transgenic animals (Damak et al., 1996a,b). In both projects no adverse effects of
the transgene on health or reproduction were observed. Another interesting application
could be enhanced disease resistance (Müller and Brem, 1991). A mouse model in which
recombinant monoclonal antibodies, which neutralize the transmissable gastroenteritis virus
(TGV), are secreted into milk, provided passive protection against gastroenteric infections to
the pups (Castilla et al., 1998). The verification of this model in pigs is promising. Recently,
transgenic pigs expressing a bacterial phytase gene under the transcriptional control of a
salivary gland-specific promoter were shown to have improved phosphate uptake (Golovan
et al., 2001). The inserted phytase gene was almost exclusively expressed in the salivary
gland and enabled the pigs to digest phosphorus in phytate, which could then be metabolized
by the intestine. These animals require significantly fewer inorganic phosphate supplements,
release substantially reduced phosphorus levels in manure and thus reduce environmental
pollution. By transgenic expression of bovine alpha-lactalbumin in the mammary gland of
sows, lactation performance was improved with respect to milk composition, milk yields and
piglet growth (Wheeler et al., 2001). The increased survival of piglets at weaning provides
significant benefits to animal welfare and the producer.
2.2. Transgenic animals in biomedicine
2.2.1. Gene pharming
By targeting expression to the mammary gland via the use of mammary gland-specific
promoter elements, large amounts of numerous heterologous recombinant proteins have
been produced. In the bovine mammary gland of transgenic cows at least two different
pharmaceutical proteins have been produced, in the caprine mammary gland five proteins,
in the ovine system four proteins, in the pig two and in transgenic rabbits seven proteins
(Rudolph, 1999). These could be purified from milk of transgenic rabbits, sheep, goats and
cattle. The biological activity of the recombinant proteins was assessed and the therapeutic
effects have been characterized (Rudolph, 1999; Meade et al., 1999). Human lactoferrin has
recently been reported to be produced in large amounts in the mammary gland of transgenic
cows (van Berkel et al., 2002). Products such as anti-thrombin III (ATIII), -anti-trypsin

296 H. Niemann, W.A. Kues / Animal Reproduction Science 79 (2003) 291–317
Table 1
Status of selected recombinant pharmaceutical proteins produced in the mammary gland of transgenic livestock
with regard to clinical testing/registration
Donor species Product Clinical trial Treatment of Expected on
market
Company
Sheep -AT Phase II/III -AT-deficiency;
cystic fibrosis
2006 PPL/GTC
Goat TPA Phase II/III Coronary clots 2006 GTC
Goat AT III Phase III Heparin-resistance 2004 GTC
Rabbit -Glucosidasea Phase II/III Pompe’s disease 2004 Pharming
a Orphan drug registration.
(-AT) or tissue plasminogen activator (tPA) are currently in advanced clinical trials and
are expected to be on the market within the next few years (Ziomek, 1998; Rudolph, 1999)
(Table 1). On the basis of average expression levels, daily milk volumes and purification
efficiency, 5400 cows would be needed to produce the 100,000 kg human serum albumin
(HSA) that are required per year worldwide, 4500 sheep for the production of 5000 kg -AT,
100 goats for 100 kg of monoclonal antibodies, 75 goats for the 75 kg ATIII and two pigs
to produce 2 kg human clotting factor IX (Rudolph, 1999).
Although a variety of proteins has been produced in the mammary gland of transgenic
animals, not every protein can obviously be expressed at the desired high amounts. Erythropoietin
(EPO) could not be expressed in the mammary gland of transgenic cattle (Hyttinen
et al., 1994). We have shown that human clotting factor VIII cDNA constructs can be expressed
in the mammary gland of transgenic mice, rabbit and sheep. However, the recovery
rates of hFVIII protein were low and dependent on the donor, storage temperature and dilution
of milk samples. hFVIII was rapidly sequestered in ovine milk (Halter et al., 1993;
Espanion et al., 1997; Niemann et al., 1999; Hiripi et al., 2003). These latter results show
that the technology needs further improvements to achieve high level expression of extraordinary
large and complex regulated genes, such as hFVIII, although higher levels of hFVIII
were reported in transgenic swine (Paleyanda et al., 1997).
2.2.2. Xenotransplantation
2.2.2.1. Transplantation of solid organs. Approximately 250,000 people are currently
only living because of transplantation of an appropriate human organ (e.g. allotransplantation).
In most cases no alternative therapeutic treatment was available and the recipients
would have died without the organ transplantation. However, the enormous progress in organ
transplantation technology which today is the basis for a normal life of thousands of patients
has led to an acute shortage of appropriate organs, while the willingness to donate organs
has remained unchanged or is even slightly reduced. Estimations in the USA have revealed
that approximately 45,000 people, younger than 65 years need a heart transplant whereas
only 2000 human hearts are transplanted annually (Michler, 1996). In the USA, more than
74,000 people are awaiting organ transplants and a new person is added to the waiting list
every 14 min. Only 21,000 patients received a transplant in the year 2000 (Petit-Zeman,
2001). In Germany approximately 2400 kidneys, 730 livers, 540 hearts and 180 pancreas

H. Niemann, W.A. Kues / Animal Reproduction Science 79 (2003) 291–317 297
are transplanted annually. However, the demand is twice as high as these figures. This has
led to the sad and ethically challenging situation that several thousand patients die every
year who could have survived if appropriate organs would have been available.
To close this growing gap between demand and availability of appropriate organs, xenotransplantation
(=the transplantation of organs between discordant species e.g. from animals
to human) is considered as the solution of choice (Bach, 1998; Platt and Lin, 1998). The
pig seems to be the optimal donor animal because
• the organs have a similar size as human organs,
• porcine anatomy and physiology are not too different from those in humans,
• pigs have short reproduction cycles and large litters,
• pigs grow rapidly,
• maintenance is possible at high hygienic standards at relatively low costs,
• pigs are a domesticated species.
The process of evaluating transgenic pigs as potential donors for xenotransplants involves
a variety of complex steps and is extremely time-, labor- and resource-intensive.
Essential prerequisites for a successful xenotransplantation are:
1. Prevention of transmission of zoonoses from the donor animal to the human recipient.
This aspect gained particular significance since a few years ago it was shown that porcine
endogenous retroviruses (PERV) can be produced by porcine cell lines and can even infect
human cell lines (Patience et al., 1997). However, until today no infection has been
found in patients that had received various forms of living porcine tissues (e.g. islet cells,
insulin, skin, extracorporal liver) for up to 12 years (Paradis et al., 1999). Recent intensive
research revealed that PERV do not present a noticeable risk for recipients of xenotransplantation
provided all necessary precautions are made (Patience et al., 1998; Dinsmore
et al., 2000; Switzer et al., 2001; Martin et al., 2002). In addition, a strain of miniature
pigs has been identified which does not produce infective PERU (Oldmixon et al., 2002).
2. Compatibility of the donor organs in anatomy and physiology with the human organ
system, e.g. lifespan differences, growth rate, expected body weight.
3. Overcoming of the immunological rejection of the transplanted organ. The immunological
hurdles are as follows (White, 1996a):
(a) Hyperacute rejection response (HAR) occurs within seconds or minutes. In the case
of a discordant organ, e.g. from pig to human, naturally occurring antibodies react
with antigenic structures on the surface of the porcine organ and induce HAR
by activating the complement cascade which is achieved via the antigen–antibody
complex. Ultimately, this results in the formation of the membrane attack complex
(MAC). However, the complement cascade can be shut down at various points by
expression of regulatory genes which prevent the formation of MAC. Well known
regulators of the complement cascade are CD55 (=decay accelerating factor, DAF),
CD46 (=membrane cofactor protein, MCP) or CD59. MAC disrupts the endothelial
cell layer of the blood vessels which leads to lysis, thrombosis, loss of vascular
integrity and ultimately to rejection of the transplanted organ.
(b) Acute vascular rejection (AVR) occurs within days. Induced xenoreactive antibodies
are thought to be responsible for AVR. The endothelial cells of the graft’s

298 H. Niemann, W.A. Kues / Animal Reproduction Science 79 (2003) 291–317
microvasculature lose their anti-thrombic properties, attract leucocytes, monocytes
and platelets leading to anemia and organ failure.
(c) Cellular rejection occurs within weeks after transplantation. In this process the blood
vessels of the transplanted organ are damaged by T-cells which invade the intercellular
spaces and destroy the organ. This rejection is observed after allotransplantation
and normally is suppressed by administration of immunosuppressive drugs. These
have to be taken by the recipients for the rest of their lives.
(d) Chronic rejection is a complex immunological process resulting in the rejection of
the transplanted organ after several years. This process is slow and progressive and
its etiology is largely unknown. The only remaining therapeutic option is another
transplantation.
When employing a discordant donor species such as the pig, overcoming the HAR is the
preeminent goal. This cannot be achieved by administering high doses of an appropriate
immunosuppressive drug as these do not affect the complement regulated rejection process.
The most promising strategy to overcome the HAR is the synthesis of human complement
regulatory proteins in transgenic pigs (Cozzi and White, 1995; White, 1996b; Bach, 1998;
Platt and Lin, 1998). Following transplantation, the porcine organ would produce the complement
regulatory protein and can thus prevent the complement attack of the recipient.
Pigs transgenic for DAF have been generated and their hearts have been transplanted either
heterotopically, e.g. in addition to the recipient’s own organ or orthotopically (=life supportive)
into non-human primates. Upon heterotopic transplantation, the average survival
of the recipients reached a maximum of 40–90 days, whereas the non-transgenic control
organs were destroyed within a few minutes. The primates had to be treated with high doses
of immunosuppressive drugs to maintain survival of the xenotransplant. Following moderate
doses of immunosuppression survival rates of 20–25 days could be obtained (Bach
et al., 1997; Cozzi et al., 2000). Employing the genomic clone of hCD46 (MCP), transgenic
pigs showed a similar expression pattern for the transgene as found for the endogenous
gene of the patients. Survival of a hCD46 porcine heart upon transplantation to baboons
exceeded 23 days (Diamond et al., 2001). Similarly, transgenic expression of hCD59 was
compatible with an extended survival of porcine hearts following transfer into primates
(Fodor et al., 1994). Transplantation of hDAF-transgenic porcine kidneys was compatible
with an extended survival of the recipients. The physiological function of the kidneys was
maintained for up to 3–4 weeks (Zaidi et al., 1998) (Table 2). These data show that HAR
can be overcome in a clinically acceptable manner by successful employing this strategy
(Bach, 1998).
Prior to primate experiments, extremely labor and time-consuming research is required
to identify those transgenic animals with the most promising expression pattern of the transgene.
Four research groups with strong links to the pharmaceutical industry have reported
the generation of transgenic pigs with expression of human complement regulators. The
screening of transgenic lines with suitable expression profiles is still inefficient. Previously,
only one out of 30 lines showed an suitable expression pattern for xenotransplantation
(Cozzi et al., 2000). A more efficient selection of transgenic pigs with an optimized expression
pattern in two out of five tested lines was provided by employing the CMV promoter
(Niemann et al., 2001). They provide a useful tool for the study of basic immunological

H. Niemann, W.A. Kues / Animal Reproduction Science 79 (2003) 291–317 299
Table 2
Success rates of RCA-transgenic porcine organs upon transplantation to primate recipients
RCA Organ/kind of
transplant
Recipient Immunosuppression Survival
hDAF Heart/heterotopic Cynomologus +++ a ∼60 days
Heterotopic Cynomologus ++ b ∼90 days
Orthotopic Cynomologus +++ ∼10 days
Heterotopic Cynomologus + c ∼21 days
Kidney/orthotopic Cynomologus ++ ∼13 days
(maximum 35 days)
hCD59 Heart, heterotopic Baboon ++ ∼30 h
hCD46 Heart, heterotopic Baboon ++ ∼23 days
a Heavy immunosuppression.
b Moderate immunosuppression.
c Weak immunosuppression.
questions in xenotransplantation. Transgenic pigs that show high expression of hCD59 predominantly
in the heart, kidney and pancreas but also other target organs, were identified
and transgenic lines established (Fig. 1D and E). Transgenic endothelial cells and fibroblasts
were protected against complement mediated lysis (Fig. 1F). Perfusion studies using
isolated porcine kidneys employing human blood revealed a significant protective effect
against HAR (Fig. 1G). Orthotopic transplantation of a CMV-hCD59 transgenic porcine
kidney into cynomologous monkey was compatible with extended survival of >20 days.
Another promising strategy towards successful xenotransplantation is the knockout of
the antigenic structures on the surface of the porcine organ. These structures are known
as 1,3--gal-epitopes and are produced from the gene for the 1,3--galactosyltransferase.
Recently, the generation of piglets in which one allele of the -galactosyltransferase locus
had been knocked out, was reported (Lai et al., 2002; Dai et al., 2002). These animals
are now in breeding programs to obtain homozygous knockout animals. The usefulness of
organs from these pigs for xenotransplantation is currently being tested. The birth of piglets
with disruption of both allelic loci has recently been publicly announced.
The strength of the cellular response to xenografts can be so great that it is unlikely
to be fully controlled by immunosuppressive treatment and transgene expression. Further
improvements of the success in xenotransplantation might arise from the possibility of
inducing a permanent tolerance across xenogenic barriers (Greenstein and Sachs, 1997;
Auchincloss and Sachs, 1998). A promising strategy for long-term graft acceptance seems to
induce a permanent chimerism via intraportal injection of embryonic stem cell like structures
(Fändrich et al., 2002). Although xenotransplantation poses numerous further challenges to
research, it is expected that transgenic pigs will be available as organ donors within the next
5–10 years (Jones, 1996). Guidelines for the clinical application of porcine xenotransplants
are currently being developed in several countries or are already available (USA).
2.2.2.2. Use of xenogenic cells and tissue. Another promising area of application for transgenic
animals will be the supply of xenogenic cells and tissue. Several intractable diseases,
disorders and injuries are associated with irreversible cell death and/or aberrant cellular func-

300 H. Niemann, W.A. Kues / Animal Reproduction Science 79 (2003) 291–317
tion. Despite numerous attempts, primary human cells cannot yet be expanded well enough
in culture. In the future, human embryonic stem cells may serve as a source for specific differentiated
cell types that can be used in cell therapy. Xenogenic cells, in particular from the pig,
hold great promise with regard to a successful cell therapy for human patients (Edge et al.,
1998). These cells provide several significant advantages over other approaches, such as implantation
at the optimal therapeutic location (i.e. immunoprivileged sites such as the brain),
possibility for manipulation prior to transplantation to enhance cell function, banking and
cryopreservation, combination with different cell types in the same graft (Edge et al., 1998).
There are already numerous examples for successful application of xenogenic cell therapy.
Porcine islet cells have been transplanted to diabetic patients and were shown to be at
least partially functional over a limited period of time (Groth et al., 1994). Porcine fetal neural
cells were transplanted into the brain of patients suffering from Parkinson’s disease and
Huntington’s disease (Deacon et al., 1997; Fink et al., 2000). In a single autopsied patient
the graft survived for more than 7 months and the transplanted cells formed dopaminergic
neurons and glial cells. Pig neurons extended axons from the graft site into the host brain
(Deacon et al., 1997). Further examples for the potential use of porcine neural cells are
stroke and focal epilepsy (Björklund, 1991). Human, fetal neuronal cells have also been
employed as transplants into Parkinson’s and Huntington’s disease patients. The advantages
of porcine neural cells over their human counterparts are the abundant availability and
the option to introduce fail safe mechanisms via suicide genes. Olfactory ensheathing cells
(OECs) or Schwann cells derived from hCD59 transgenic pigs promoted axonal regeneration
in rat spinal cord lesion (Imaizumi et al., 2000). Thus, cells from genetically modified
pigs may serve as therapeutic measure to restore electrophysiologically functional axons
across the site of a spinal cord transsection. Xenogenic porcine cells may also be useful as
novel therapy for liver diseases. Upon transplantation of porcine hepatocytes to Watanabe
heritable hyperlipidemic (WHHL) rabbits (a model for familial hypercholesterolemia), the
xenogenic cells migrated out of the vessels and integrated into the hepatic parenchyma.
The integrated porcine hepatocytes provided functional LDL receptors and thus reduced
cholesterol levels by 30–60% for at least 100 days (Gunsalus et al., 1997).
A clone of bovine adrenocortical cells restored adrenal function upon transplantation to
adrenalectomized SCID mice. This finding shows that functional endocrine tissue can be
derived from a single somatic cell (Thomas et al., 1997). Bovine neuronal cells were collected
from transgenic fetuses, transplanted into the brain of rats and resulted in significant
improvements of symptoms of Parkinson’s disease (Zawada et al., 1998). Furthermore,
xenotransplantation of retinal pigment epithelial cells holds promise to treat retinal diseases
such as macular degeneration which is associated with photoreceptor losses. Porcine
or bovine fetal cardiomyocytes or myoblasts may provide a therapeutic approach for the
treatment of ischemic heart disease. Similarly, xenogenic porcine cells may be valuable for
the repair of skin or cartilage damage (Edge et al., 1998). In light of the emergence of more
efficient protocols for genetic modification of donor pigs and new powerful immunosuppressive
drugs, one can expect xenogenic cell therapy to evolve as an important therapeutic
option for the treatment of human diseases.
The above description demonstrates that although the challenges to generate a transgenic
animal with an optimized tailored expression pattern are enormous, within less than 20 years
transgenic livestock have emerged that provide valuable contributions to human health.

H. Niemann, W.A. Kues / Animal Reproduction Science 79 (2003) 291–317 301
With increasing knowledge about the genetic basis of agricultural traits and improvements
in the technology to generate transgenic animals, numerous further useful commercial
applications will be developed.
3. Improvements of transgenic technology
3.1. Inducible gene expression
A major advancement in transgenic technology would be tight control of transgene expression.
Control elements that are known to regulate the activity of transgenes are the metallothionein
promoter (see Nottle et al., 1999), heat shock promoter, or steroid responsive
elements. However, these have been used with limited success attributed to low induction
levels and physiological effects of the inducer elements (Yarranton, 1992). Significant improvements
of the temporal control of gene expression could be achieved by employing the
antibiotic tetracycline system (Gossen et al., 1995). This involves a transcriptional transactivator
which has been created by fusion of the VP16 activation domain with a mutant Tet
repressor from Escherichia coli. This transactivator requires the presence of tetracycline or
an analogue for DNA binding and transcriptional activation (Fig. 2). It has been shown that
Fig. 2. Schematic drawing of Tet-on system. In the original system two independent transgene constructs were
integrated in the genome. The transactivator gene is continuously transcribed and the inactive form of the transactivator
is translated. By exogenous addition (feeding) of a tetracycline analogue the transactivator becomes activated,
subsequently binds to the Tet-promoter and induces expression of the transgene. Removal of the compound leads
to transcriptional silencing of the transgene.

302 H. Niemann, W.A. Kues / Animal Reproduction Science 79 (2003) 291–317
Fig. 3. Conditional transgene expression in porcine muscle. (A) Transgenic pigs carrying a Tet-off expression
cassette show massive expression in skeletal muscle fibers. Muscle biopsies of a wildtype and a transgenic animal
were stained with a specific antibody against the transgene. Arrows indicate a positive muscle fiber. (B) Conditional
ablation of transgene expression. Expression levels of the transgene were determined in muscle biopsies before
and after feeding with doxycycline. In total, four animals were treated with doxycyline and showed identical
downregulation of expression.
the presence of a tetracycline analogue led to a burst of expression in cell lines and even
transgenic mice (Tet-on) (Gossen et al., 1995). This system can also be modified in a way
that the presence of tetracycline suppresses expression of the target gene (Tet-off). In this
system, tetracycline binds to the transactivator and shuts down expression of the transgene
(Furth et al., 1994). The original technology requires two constructs, which make it unfeasible
for application in livestock. However, it has been shown that fusion of both control
elements into one construct allows efficient and tight control of gene expression in vivo
(Schultze et al., 1996). In recent own work, the transgene expression in pigs, carrying a single
Tet-off gene construct, could be regulated by doxycycline feeding (Fig. 3, unpublished
data). Further studies will show the usefulness of this system for the conditional expression
of transgenes suitable in xenotransplantation.
3.2. Artificial chromosomes: YACs, BACs and MACs
Artificial chromosomes are DNA molecules of predictable structure which are assembled
in vitro from defined constituents that are similar to natural chromosomes. The first
artificial chromosomes have been constructed in yeast (Saccharomyces cerevisiae)(Fig. 4).
They include centromeres, telomeres, and origins of replication as essential components
(Brown et al., 2000). These yeast artificial chromosomes (YACs) can be introduced into
cell lines (Strauss et al., 1993). They carry much larger amounts of DNA than usually can
be employed in microinjection. Microinjection of a 450 kb genomic YAC harboring the

H. Niemann, W.A. Kues / Animal Reproduction Science 79 (2003) 291–317 303
Fig. 4. Schematic comparison of yeast and mammalian artificial chromosomes used for the generation of transgenic
animals. Injection of yeast or bacterial artificial chromosomes (YAC, BAC) into mammalian zygotes leads to
a random integration, since their structural chromosomal elements are not functional in mammalian cells. In
contrast, injection of mammalian artificial chromosomes results in the inheritance of these vectors as independent
chromosomal elements.
murine tyrosinase gene resulted in transgenic mice which showed position independent and
copy number dependent expression of the transgene. Albinism was rescued in transgenic
mice and rabbits (Schedl et al., 1992, 1993; Brem et al., 1996). A 210 kb YAC construct has
been microinjected into rat pronuclei and -lactoglobulin and human growth factor were
expressed in the mammary gland of transgenic rats (Fujiwara et al., 1997, 1999). Artificial
chromosomes can also be constructed in bacteria (BACs), which can be genetically modified
easier and even allow homologous recombination. Transgenic mice were generated via
pronuclear injection of BACs and germline transmission and proper expression of the transgene
was achieved (Yang et al., 1997). However, up to now, transgenic livestock has not been

304 H. Niemann, W.A. Kues / Animal Reproduction Science 79 (2003) 291–317
reported upon transfer of a YAC construct. This may be attributed to the inherent problems of
this technology, such as difficulties to isolate YAC DNA with sufficient purity and the inherent
instability with a tendency for deleting regions from the insert (Monaco and Larin, 1994).
Mammalian artificial chromosomes (MAC) have been engineered by employing endogenous
chromosomal elements from YACs or extra chromosomal elements from viruses or
BACs and P1 artificial chromosomes (PACs) (Vos, 1997). MACs with a size of 1–5 Mb were
formed by a de novo mechanism and segregated like normal chromosomes upon introduction
into cell lines (Ikeno et al., 1998). A human artificial chromosome (HAC) containing
the entire sequences of the human immunoglobulin heavy and light chain loci has been
introduced into bovine fibroblasts, which were then used in nuclear transfer. Transchromosomal
offspring were obtained that expressed human immunoglobulin in their blood.
This system could be a significant step forward in the production of therapeutic polyclonal
antibodies (Kuroiwa et al., 2002).
Satellite-DNA based artificial chromosomes (SATAC) are neochromosomes that are
formed by de novo amplification of pericentric heterochromatin yielding chromosomes
from 10 to 360 megabases. These can serve as chromosomal vectors for exogenous DNA
(Perez et al., 2000). Transgenic mice have been generated by microinjection of SATACs
into pronuclei of zygotes. The additional chromosome showed germline transmission over
three generations (Co et al., 2000). Microinjection of SATACs was also compatible with
the development of bovine embryos. Transgenic embryos could be identified by staining
for the presence of a reporter gene and FISH detection of the extra chromosome (Co et al.,
2000). Moreover, SATACs could be isolated and purified by flow cytometry due to their
high AT content.
However, all efforts to assemble MACs as functional vectors for foreign DNA have met
with limited success. Mini-chromosomes are considered to overcome the problems with
artificial chromosomes. In contrast to artificial chromosomes, mini-chromosomes possess a
defined structure, can be engineered to harbor large fragments of DNA and can go through
the vertebrate germline (Brown et al., 2000). Mini-chromosomes could play an important
role in the development of transchromosomal animals as models of human genetic disorders
such as trisomy 21 (Down’s syndrome) (Hernandez et al., 1999). Recently, mice have
been engineered that contain certain fragments of human chromosomes with each of the
immunoglobulin heavy chain and light chain gene. In these animals, the endogenous immunoglobulin
genes were deleted and the mice produced humanized antibodies (Tomizuka
et al., 2000). Further progress in this area will ultimately result in a variety of different
vector systems which can be used for large scale transgenesis in experimental animals,
agricultural livestock and crop plants.
4. Nuclear transfer and targeted genetic modification
4.1. Nuclear transfer technology: results and limitations
As microinjection has a number of significant shortcomings mentioned above, research
has focused on alternate methodologies for improving the generation of transgenic livestock.
These include sperm mediated DNA transfer (Gandolfi, 1998; Squires, 1999; Chang et al.,

H. Niemann, W.A. Kues / Animal Reproduction Science 79 (2003) 291–317 305
2002; Lavitrano et al., 2002), the intracytoplasmic injection (ICSI) of sperm heads carrying
foreign DNA (Perry et al., 1999, 2001), the use of retroviral vectors either by injection
or infection of oocytes or embryos (Haskell and Bowen, 1995; Chan et al., 1998; Cabot
et al., 2001) or the use of genetically modified donor cells from livestock in nuclear transfer
(Schnieke et al., 1997; Cibelli et al., 1998a; Baguisi et al., 1999; Park et al., 2001). Further improvements
may be derived from the adaptation of technologies that allow precise modifications
of the murine genome. These include targeted chromosomal integration by site-specific
DNA recombinases, such as Cre or FLP or homologous recombination that would enable
generation of transgenic animals with a gain (knockin) or a loss of function (knockout)
(Capecchi, 1989; Kilby et al., 1993). In light of the recent advances, somatic nuclear transfer
holds the greatest promise for significant improvements in the generation of transgenic livestock.
A major prerequisite is the availability of suitable primary cells or cell lines compatible
with techniques for precise genetic modifications either for gain or loss of function. Another
prerequisite is a significantly improved knowledge of gene sequences and organization of the
livestock genome, which currently is lagging much behind that of mouse and human. In the
latter, the putative 3 billion base pairs have been sequenced in the year 2001. Surprisingly, the
human genome only contained approximately 30–35,000 genes (Baltimore, 2001). However,
RNA editing and alternative splicing significantly augments the number of proteins
synthesized from a gene. Whereas only 250 out of the 6000 genes in Saccharomyces cerevisiae
contain introns, the vast majority of the estimated human genes are thought to contain
these structures (Graveley, 2001; Modrek and Lee, 2001). In contrast, in livestock species
only a minority of genes have been mapped and sequenced until now (Table 3). However, the
technology developed during deciphering the human genome will improve and accelerate
sequencing of genomes from other species (O’Brien et al., 1999). Even the currently limited
genetic information in livestock species allows the application of cDNA array technologies
and or high density DNA chips to obtain gene expression profiles of nearly any tissue of
interest. Improvements of RNA isolation and unbiased amplification of tiny amounts of
mRNA (picogram) enable to analyze even single embryos (Brambrink et al., 2002).
Reports on the generation of transgenic livestock (Schnieke et al., 1997; Cibelli et al.,
1998a; Park et al., 2001) via somatic nuclear transfer had raised great expectations about
this elegant approach to improve the generation of transgenic livestock. Fetal fibroblasts
were transfected in vitro, screened for transgene integration and then transferred into enucleated
oocytes. After fusion of both components and activation of the reconstituted nuclear
transfer complexes, blastocysts were transferred to synchronized recipients and gave rise
to transgenic offspring. Compared with the microinjection procedure in which screening
for transgenesis and optimal expression of the transgenes takes place at the level of the
offspring, cloning by nuclear transfer can accelerate the time-consuming transgenic production
by rapid screening in vitro and 100% transgenic offspring. The first commercial
data of the use of nuclear transfer to generate transgenic cattle show the feasibility of this
approach (Forsberg et al., 2001).
Offspring from nuclear transfer have been born in all major livestock species cattle,
sheep, goat and swine (Wilmut et al., 1997; Cibelli et al., 1998b; Baguisi et al., 1999;
Polejaeva et al., 2000; Betthauser et al., 2000). A variety of different cell types of embryonic,
fetal and somatic origin has been successfully employed as donors in nuclear transfer.
However, the overall efficiency of nuclear transfer is low (Colman, 2000). Factors affecting

306 H. Niemann, W.A. Kues / Animal Reproduction Science 79 (2003) 291–317
Table 3
Whole genome sequencing
Species No. annotated genes Genome size
(×10 6 bp)
Sequencing
completed
Milestones in genome sequencing and size of selected genomes
Haemophilus influenca (bacteria) ∼1700 1.7 1995
Saccaromyces cerevisae (fungi) ∼6000 12.0 1996
Caenorhabditis elegans (nematodes) ∼18000 97.0 1998
Drosophila melanogaster (insects) ∼14000 137.0 2000
Arabidopsis thalia (plants) ∼25000 125.0 2000
Homo sapiensa (mammals) ∼35000 3300.0 2001
Diversity of genome sequencing approaches (10/2002)
Archaea Complete genomes of 16 species
Bacteria Complete genomes of 81 species
Eukaryota complete genomes of 9 species.
In addition the genomes of Homo
sapiens, Mus musculus, Rattus
norvegicus, Danio rerio and
some crop plants are mapped,
however gene annotation and/or
sequencing of untranscribed
regions is still in progress
Species Chromosome
number (haploid)
No. mapped
genes
Genome size
(×1000)
Human b 23 >30000 3.300
Mouse c 20 30000 2.450
Cattle c 30 ∼1000 ∼3.500
Sheep c 27 ∼500 ∼3.100
Pig c 19 ∼600 ∼2.400
Horse c 32 200 ∼4.000
a Gene annotation still in progress.
b February 2001 sequencing completed.
c Information for 2002.
the success of nuclear transfer are poorly defined and the average percentage of live offspring
does not exceed 1–3% of the transferred reconstituted embryos (Wakayama et al., 1998;
Wilmut et al., 2002). A better understanding of the underlying fundamental molecular
and cellular processes, such as cell cycle compatibilities between recipient cytoplasm and
donor nucleus (Campbell et al., 1996), cell cycle synchronization of the donor cells (Boquest
et al., 1999; Kues et al., 2000), reprogramming and the relevance of differentiation versus
totipotency is urgently needed. Upon serum deprivation or treatment with chemical cell
cycle inhibitors, the majority of porcine donor cells was synchronized at the presumptive
optimal cell cycle stage at G0/G1 without compromising their viability (Kues et al., 2000,
2002; Anger et al., 2003). This contributes substantially to standardize the nuclear transfer
procedures. In addition, methods have to be established that allow reliable determination

H. Niemann, W.A. Kues / Animal Reproduction Science 79 (2003) 291–317 307
of the capacity of a given nuclear transfer embryo to develop into a normal offspring. The
large offspring syndrome (LOS) including an increased peri- and postnatal mortality, is
found in offspring, predominantly from ruminants, derived from nuclear transfer embryos
(Wilmut et al., 1997; Young et al., 1998; Kato et al., 1998). These unwanted side effects
need to be overcome prior to an eventual commercial exploitation. Aberrations of the well
orchestrated pattern of gene expression are thought to be involved in the high incidence of
LOS. A primary mechanism may be alterations in the methylation of genes, including those
that are subject to imprinting (Young et al., 1998; Niemann and Wrenzycki, 2000; Niemann
et al., 2002b).
4.2. Embryonic and adult cell lines
The fundamental tools for loss-of-function transgenics in the mouse are the availability
of embryonic stem cells (ES cells), homologous recombination and the high probability
with which ES cells give rise to germline contribution after injection into host blastocysts.
This provides a powerful approach to introduce specific genetic changes into the murine
genome (Evans and Kaufman, 1981; Martin, 1981). The essential characteristics of ES cells
include derivation from the preimplantation embryo (inner cell mass cells), undifferentiated
and indefinitive proliferation in vitro and the developmental potential to differentiate into
all cell types under appropriate conditions.
Besides ES cells, embryonic germ (EG) and embryonic carcinoma (EC) cells have been
established in the mouse model. EG cells are isolated from cultured primordial germ cells
(PGC) (Matsui et al., 1992; Resnick et al., 1992) and share several characteristics with
ES cells, including morphology, pluripotency, and the capacity for germline transmission.
Similar to ES cells, EG cells express alkaline phosphatase and Oct-4 and can be aggregated
to form embryoid bodies.
The ultimate criterion for true totipotent stem cell lines is the contribution to the germline
in chimeras or starting a new development upon nuclear transfer. ES or EG-like cell lines
have been isolated from sheep, goat, pig and cattle (Wheeler, 1994; Anderson, 1999). Porcine
and bovine cell lines were capable to contribute to chimera formation upon injection into
appropriate host blastocysts (Wheeler, 1994; Shim et al., 1997; Piedrahita et al., 1998; Cibelli
et al., 1998a). However, no germline transmission has been reported so far. True totipotent
stem cell lines might require specific culture conditions, growth factor supplements and
probably a specific genetic background, as only few mouse strains are suitable for ES cell
line isolation (Hogan et al., 1994).
Recent experiments in mice have revealed that adult cells from the hematopoetic lineage
possess a greater plasticity than previously assumed (Jiang et al., 2002). Besides
long-term proliferation in vitro, these mesenchymal derived cells express embryonic markers,
such as Oct-4, rex and telomerase and can be differentiated into several cell types
in vitro and in vivo. Upon injection into blastocysts, chimeric mice could be generated,
which showed a high percentage of chimerism in nearly all organs. Similar cells were
isolated from the hematopoetic system of rats and even humans, suggesting that mesenchymal
stem cells could also be a useful source of research and application in livestock
species.

308 H. Niemann, W.A. Kues / Animal Reproduction Science 79 (2003) 291–317
4.3. Homologous recombination and nucleus donor cell strains
Homologous recombination in murine ES cells is the most straightforward approach to
eliminate gene function and is therefore the preferred method to establish a null genotype.
Several strategies for gene targeting in murine ES cells have been developed (Kühn
et al., 1995; Mayford et al., 1997). More than 1000 knockout strains have been created
via gene targeting in embryonic stem cells (mouse knockout and mutation database
http://www.biomednet.com). The potential for a knockout technology in livestock production
is highlighted by the discovery that several beef cattle breeds, like Belgian Blue
and Piedmontese, are accidentally homozygous for the mutated myostatin gene, which
is functionally inactive and could be referred to as a natural knockout (McPherron and
Lee, 1997; Kambadur et al., 1997; Grobet et al., 1997). The similarity in phenotypes
of myostatin mutated cattle and myostatin null mice (McPherron et al., 1997) is striking
and suggests that myostatin could be a useful target for genetic modification in farm
animals.
Nuclear transfer techniques promise to circumvent the need for true totipotent cells for
the generation of loss-of-function transgenic livestock. The future challenge for the production
of transgenic livestock is the isolation and handling of primary cell cultures, either
from somatic or embryonic origin (Schnieke et al., 1997; Cibelli et al., 1998b; Kues
et al., 1998). These could be used for sophisticated genetic modifications, clonal selection
and subsequently for nuclear transfer. Gene targeting in somatic cells of livestock
has important applications in combination with nuclear transfer (Fig. 5). Recent progress
in the generation of gene targeted livestock clearly shows the significant potential of this
field. An efficient and reproducible targeting protocol in fetal fibroblasts by which the
transgenic construct -lactoglobulin--anti-trypsin was placed at the ovine 1 precollagen
locus was described and the production of live sheep upon nuclear transfer was reported
(McCreath et al., 2000). The recombinant -AT was highly expressed in the mammary
gland. However, the proportion of embryonic and fetal losses was significantly increased
in pregnancies with targeted NT derived sheep and porcine embryos. The first piglets, carrying
a knockout for one allele of the -galactosyltransferase gene did not show gross
abnormalities (Lai et al., 2002; Dai et al., 2002). By performing two rounds of targeting
in cell culture, both alleles can be knocked out and time-consuming breeding will
be avoided in future (Fig. 5). Exploiting the targeting technology would allow to produce
large amounts of human serum albumin (HSA) when inserted at the BSA locus in
transgenic cattle. A knockout of the PrP gene locus could render cattle non-susceptible
to BSE. Disease models in large animals would be another promising application models
for targeted transgenesis. The pig is obviously a good model for human eye disease
(Petters et al., 1997; Theuring et al., 1997) and sheep could be a good model for cystic
fibrosis.
4.4. Conditional mutagenesis and region-specific knockouts
The above findings demonstrate the power of gene targeting, but they also point to a need
for additional genetic techniques when precise genetic modifications are desired. Gene
knockouts per se have no spatial or temporal restriction. As the targeted gene product

H. Niemann, W.A. Kues / Animal Reproduction Science 79 (2003) 291–317 309
Fig. 5. Schematic drawing of gene targeting in livestock. Gene targeting of somatic primary cells by homologous
recombination employing a promoterless targeting vector. Optionally, cell clones with the desired targeting event
could be screened for loss of heterozygosity and subsequently be employed in nuclear transfer.
is absent for the entire life of the animal in all cells, it is difficult to assign a phenotype
to a specific knockout as a mutant organism may compensate for the loss of a gene
product or the knockout may have complex, secondary effects, depending on the genetic
background (Gerlai, 1996), or may even result in embryonic lethality. A powerful
tool for the design of genetic switches and for accelerating the creation of genetically
modified animals, is the Cre site-specific DNA recombinase of bacteriophage P1 (Sauer,
1998). A single 38 kDa Cre protein is required to catalyze recombination between two
loxP recognition sites, which are 34 bp DNA sequences. Recombination can occur between
directly repeated loxP sites on the same molecule to excise the intervening DNA
sequence, irrespective of whether the recognition sites are located on a plasmid or an
mammalian chromosome (Sauer and Henderson, 1988). The combination of tissue-specific
promoter elements with Cre DNA recombinase, enables a gene to be knocked out of a
restricted cell type or tissue (Orban et al., 1992; Gu et al., 1994). In principle, recombinase
mediated recombination should allow gene replacement, e.g. the exchange of the
reading frames of milk proteins with the sequences of genes encoding pharmaceutical
proteins.

310 H. Niemann, W.A. Kues / Animal Reproduction Science 79 (2003) 291–317
5. Perspectives and outlook
The merger of the recent advancements in the reproductive technologies with the tools
of molecular biology opens the horizon for a completely new era in animal production.
However, major prerequisites will be the continuous refinement of reproductive biotechnologies
and a rapid increase of livestock genome mapping. This would permit exploitation
the great potential of bio- and gene technology with regard to a diversified animal production.
One attractive example could be dairy production (Bawden et al., 1994). Apart from
conventional dairy products, it could be possible to produce fat-reduced or even fat-free
milk via knockout of enzymes involved in lipid metabolism, to increase curd and cheese
production by enhancing expression of the casein gene family in the mammary gland, to
increase efficiency of the production for creamers and liquor by increasing the proportion
of -casein in milk, to create “hypoallergic” milk by knockout of the -lactoglobulin gene,
to generate lactose-free milk via knockout of -lactalbumin which is the key molecule in
milk sugar synthesis, to produce small infant milk in which human lactoferrin is abundantly
available or to produce milk with a highly improved hygienic standard via an increased level
of lysozyme or other anti-microbiological substances in the udder. Lactose free-milk could
render dairy products ready for consumption by a large proportion of the world’s population
who do not possess the active enzyme lactase in their intestine. In addition, calculations
have revealed that reduction of the fat level in milk from the current level of 3.8–2% would
permit an increase in the proportion of roughage in the feed from 55 to more than 80% and
concomitantly to a significant reduction in the concentrated feed (Yom and Bremel, 1993).
This would reduce the price and cost of animal nutrition. Such targeted production is also
imaginable for other areas of animal production. However, one has to take into account that
commercial application of this technology for agricultural traits will likely not be possible
before the next decade. The biomedical area will see the first commercial application before
the year 2010 (Table 4).
On a broader scale, bio- and gene technology as mentioned above will be important tools
to cope with the challenges in animal production in the years ahead. In light of the worldwide
problems in the management of a proper environment and resources, biotechnology
can contribute to quantitative and qualitative increases in food production, cost reduction,
Table 4
Projections for field application of transgenic livestock a
Year
Biomedical traits
Recombinant pharmaceutical proteins 2005
Xenotransplantation of solid organs
Agricultural traits
>2008
Dairy products >2010
Meat and meat products >2008
Wool products >2005
a Application will likely be different between USA and Europe because of the controversial debate on genetic
engineering in Europe.

H. Niemann, W.A. Kues / Animal Reproduction Science 79 (2003) 291–317 311
environmental protection, maintenance of genetic resources and improvements in animal
welfare as well as the above mentioned diversified production. However, it should be kept
in mind that putative biomedical applications like xenotransplantation or usage of transgenic
farm animals for food production will require strict standards on “genetic security”
and reliable and sensitive methods for the molecular characterization of the “products”.
A major contribution towards this goal will come from DNA chips or arrays establishing
“fingerprint” profiles at the transcriptional and/or protein level and allowing in depth insight
into the proper function of a transgenic organism. Besides the technical problems,
public acceptance of recombinant products, organs or food has to be taken into account.
Additionally, welfare of the transgenic animals must be secured and pain or suffering due
to the genetic modification could not be tolerated (Fox, 1988; Hughes et al., 1996).
Acknowledgements
The authors express their sincere gratitude to Christa Knöchelmann for the careful preparation
of this manuscript.
References
Anderson, G.B., 1999. Embryonic stem cells in agricultural species. In: Murray, J.D., Anderson, G.B., Oberbauer,
A.M., McGloughlin, M.M. (Eds.), Transgenic Animals in Agriculture. CABI Publishing, New York, USA,
pp. 57–66.
Anger, M., Kues, W.A., Klima, J., Mielenz, M., Kubelka, M., Motlik, J., Esner, M., Dvorak, P., Carnwath, J.W.,
Niemann, H., 2003. Cell cycle based expression of Plk1 in synchronized porcine fetal fibroblasts, Mol. Reprod.
Dev. 65, 245–253.
Auchincloss Jr., H., Sachs, D.H., 1998. Xenogenic transplantation. Annu. Rev. Immunol. 16, 433–470.
Bach, F.H., 1998. Xenotransplantation: problems and prospects. Ann. Rev. Mol. 49, 301–310.
Bach, F.H., Ferran, C., Soares, M., Wrighton, C.J., Anrather, J., Winkler, H., Robson, S.C., Hancock, W.W., 1997.
Modification of vascular responses in xenotransplantation: inflammation and apoptosis. Nat. Med. 3, 944–948.
Baguisi, A., Behboodi, E., Melican, D., Pollock, J.S., Destrempes, M.M., Cammuso, C., Williams, J.L., Nims,
S.D., Porter, C.A., Midura, P., Palacios, M.J., Ayres, S.L., Denniston, R.S., Hayes, M.L., Ziomek, C.A., Meade,
H.M., Godke, R.A., Gavin, W.G., Overström, E.W., Echelard, Y., 1999. Production of goats by somatic cell
nuclear transfer. Nat. Biotechnol. 17, 456–461.
Baltimore, D., 2001. Our genome unveiled. Nature 409, 814–816.
Bawden, W., Passey, R.J., MacKinlay, A.G., 1994. The genes encoding the major milk specific proteins and their
use in transgenic studies and protein engineering. Biotechnol. Genet. Eng. Rev. 12, 89–137.
Betthauser, J., Forsberg, E., Augenstein, M., Childs, L., Eilertsen, K., Enos, J., Forsythe, T., Golueke, P., Koppang,
R., Lesmeister, T., Mallon, K., Mell, G., Misica, P., Pace, M., Pfister-Genskow, M., Strelchenko, N., Voelker,
G., Watt, S., Thompson, S., Bishop, M., 2000. Production of cloned pigs from in vitro systems. Nat. Biotechnol.
18, 1055–1059.
Björklund, A., 1991. Neural transplantation—an experimental tool with clinical possibilities. Trends Neurosci.
14, 319–322.
Boquest, A.C., Day, B.N., Prather, R.S., 1999. Flow cytometric cell cycle analysis of cultured porcine fetal
fibroblasts cells. Biol. Reprod. 60, 1013–1019.
Brambrink, T., Wabnitz, P., Halter, R., Klocke, R., Carnwath, J., Kues, W.A., Wrenzycki, C., Paul, D., Niemann,
H., 2002. Application of cDNA arrays to monitor mRNA profiles in single preimplantation mouse embryos.
Biotechniques 33, 376–378.

312 H. Niemann, W.A. Kues / Animal Reproduction Science 79 (2003) 291–317
Brem, G., Besenfelder, U., Aigner, B., Müller, M., Liebl, I., Schütz, G., Montoliu, L., 1996. YAC transgenesis in
farm animals: rescue of albinism in rabbits. Mol. Reprod. Dev. 44, 56–62.
Brown, W.R.A., Mee, P.J., Shen, M.H., 2000. Artificial chromosomes: ideal vectors? TIBTECH 18, 218–223.
Cabot, R.A., Kuhholzer, B., Chan, A.W., Lai, L., Park, K.W., Chong, K.Y., Schatten, G., Murphy, C.N., Abeydeera,
L.R., Day, B.N., Prather, R.S., 2001. Transgenic pigs produced using in vitro matured oocytes infected with a
retroviral vector. Anim. Biotechnol. 12, 205–214.
Campbell, K.H., McWhir, J., Ritchie, W.A., Wilmut, I., 1996. Sheep cloned by nuclear transfer from a cultured
cell line. Nature 380, 64–66.
Capecchi, M.R., 1989. The new mouse genetics: altering the genome by gene targeting. TIG 5, 70–76.
Castilla, J., Pintado, B., Sola, I., Sánchez-Morgado, J.M., Enjuanes, L., 1998. Engineering passive immunity in
transgenic mice secreting virus-neutralizing antibodies in milk. Nat. Biotechnol. 16, 349–354.
Chan, A.W.S., Homan, E.J., Ballou, L.U., Burns, J.C., Bremel, R.D., 1998. Transgenic cattle produced by
reverse-transcribed gene transfer in oocytes. Proc. Natl. Acad. Sci. USA 95, 14028–14033.
Chang, K., Qian, J., Jiang, M., Liu, Y.H., Wu, M.C., Chen, C.D., Lai, C.K., Lo, H.L., Hsiao, C.T., Brown, L., Bolen
Jr., J., Huang, H.I., Ho, P.Y., Shih, P.Y., Yao, C.W., Lin, W.J., Chen, C.H., Wu, F.Y., Lin, Y.J., Xu, J., Wang, K.,
2002. Effective generation of transgenic pigs and mice by linker based sperm-mediated gene transfer. BMC
Biotechnol. 2, 5.
Cibelli, J.B., Stice, S.L., Golueke, P.L., Kane, J.J., Jerry, J., Blackwell, C., Ponce de Leon, F.A., Robl, J.M., 1998a.
Transgenic bovine chimeric offspring produced from somatic cell-derived stem like cells. Nat. Biotechnol. 16,
642–646.
Cibelli, J.B., Stice, S.L., Golueke, P.L., Kane, J.J., Jerry, J., Blackwell, C., Ponce de Leon, F.A., Robl, J.M., 1998b.
Cloned calves produced from nonquiescent fetal fibroblasts. Science 280, 1256–1258.
Co, D.O., Borowski, A.H., Leung, J.D., Kaa van der, J., Hengst, S., Platenburg, G., Pieper, F.R., Perez, C.F., Jirik,
F.R., Drayer, J.I., 2000. Generation of transgenic mice and germline transmission of a mammalian artificial
chromosome introduced into embryos by pronuclear microinjection. Chrom. Res. 8, 183–191.
Colman, A., 2000. Somatic cell nuclear transfer in mammals: progress and applications. Cloning 1, 185–200.
Cozzi, E., White, D.J.G., 1995. The generation of transgenic pigs as potential organ donors for humans. Nat. Med.
1, 964–966.
Cozzi, E., Masroar, S., Soni, B., Vial, C., White, D.J., 2000. Progress in xenotransplantation. Clin. Neprol. 53,
13–18.
Dai, Y., Vaught, T.D., Boone, J., Chen, S.H., Phelps, C.J., Ball, S., Monahan, J.A., Jobst, P.M., McCreath, K.J.,
Lamborn, A.E., Cowell-Lucero, J.L., Wells, K.D., Colman, A., Polejaeva, I.A., Ayares, D.L., 2002. Targeted
disruption of the alpha 1,3-galactosyltransferase gene in cloned pigs. Nat. Biotechnol. 20, 251–255.
Damak, S., Jay, N.P., Barrell, G.K., Bullock, D.W., 1996a. Targeting gene expression to the wool follicle in
transgenic sheep. Biotechnology 14, 181–184.
Damak, S., Su, H., Jay, N.P., Bullock, D.W., 1996b. Improved wool production in transgenic sheep expressing
insulin-like growth factor 1. Biotechnology 14, 185–188.
Deacon, T., Schumacher, J., Dinsmore, J., Thomas, C., Palmer, P., Kott, S., Edge, A., Penney, D., Kassissieh, S.,
Dempsey, P., Isacson, O., 1997. Histological evidence of fetal pig neutral cell survival after transplantation into
a patient with Parkinson’s disease. Nat. Med. 3, 350–353.
Diamond, L.E., Quinn, C.M., Martin, M.J., Lawson, J., Platt, J.L., Logan, J.S., 2001. A human CD46 transgenic
pig model system for the study of discordant xenotransplantation. Transplantation 71, 132–142.
Dinsmore, L.E., Manhardt, C., Raineri, R., Jacoby, D.B., Moore, A., 2000. No evidence for infection of human
cells with porcine endogenous retrovirus (PERV) after exposure to porcine fetal neuronal cells. Transplantation
71, 132–142.
Edge, A.S.B., Gosse, M.E., Dinsmore, J., 1998. Xenogenic cell therapy: current progress and future developments
in porcine cell transplantation. Cell Transplant. 7, 525–539.
Espanion, G., Halter, R., Wrenzycki, C., Carnwath, J.W., Herrmann, D., Lemme, E., Niemann, H., Paul, D.,
1997. mRNA expression of human blood coagulation factor VIII (FVIII) gene constructs in transgenic mice.
Transgenics 2, 175–182.
Evans, M.J., Kaufman, M.H., 1981. Establishment in culture of pluripotential cells from mouse embryos. Nature
292, 154–156.
Eyestone, W.H., 1999. Production and breeding of transgenic cattle using in vitro embryo production technology.
Theriogenology 51, 509–517.

H. Niemann, W.A. Kues / Animal Reproduction Science 79 (2003) 291–317 313
Fändrich, F., Lin, X., Chai, G., Schulze, M., Ganten, D., Bader, M., Holle, J., Huang, D.S., Parwaresch, R.,
Zavazava, N., Binas, B., 2002. Preimplantation-stage stem cells induce long-term allogeneic graft acceptance
without supplementary host conditioning. Nat. Med. 8, 171–178.
Fink, J.S., Schumacher, J.M., Ellias, S.L., Palmer, E.P., Saint-Hilaire, M., Shannon, K., Penn, R., Starr, P.,
VanHoorne, C., Kott, H.S., Dempsey, P.K., Fischman, A.J., Raineri, R., Manhart, D., Dinsmore, J., Isacson, O.,
2000. Porcine xenografts in Parkinson’s disease and Huntington’s disease patients: preliminary results. Cell
Transplant. 2, 273–278.
Fodor, W.L., Williams, B.L., Matis, L.A., Madri, J.A., Rollins, S.A., Knight, J.W., Velander, W., Squinto, S.P.,
1994. Expression of a functional human complement inhibitor in a transgenic pig as a model for the prevention
of xenogenic hyperacute organ rejection. Proc. Natl. Acad. Sci. USA 91, 11153–11157.
Forsberg, E.J., Betthauser, J., Strelchenko, N., Golueke, P., Childs, L., Jurgella, R., Koppang, G., Mell, G., Pace,
M.M., Bishop, M., 2001. Cloning non-transgenic and transgenic cattle. Theriogenology 55, 269 (abstract).
Fox, M.W., 1988. Genetic engineering biotechnology: animal welfare and environmental concerns. Appl. Anim.
Behav. Sci. 20, 83–94.
Fujiwara, Y., Miwa, M., Takahashi, R., Hirabayashi, M., Suzuki, T., Ueda, M., 1997. Position-independent and
high-level expression of human alpha-lactalbumin in the milk of transgenic rats carrying a 210-kb YAC DNA.
Development 124, 3621–3632.
Fujiwara, Y., Miwa, M., Takahashi, R., Hirabayashi, M., Suzuki, T., Ueda, M., 1999. High-level expressing YAC
vector for transgenic animal bioreactors. Mol. Reprod. Dev. 52, 414–420.
Furth, P.A., Onge, L., Böger, H., Gruss, P., Gossen, M., Kistner, A., Bujard, H., Hennighausen, L., 1994. Temporal
control of gene expression in transgenic mice by a tetracycline-responsive promoter. Proc. Natl. Acad. Sci.
USA 91, 9302–9306.
Gandolfi, F., 1998. Spermatozoa, DNA binding and transgenic animals. Transgenic Res. 7, 147–155.
Gerlai, R., 1996. Gene-targeting studies of mammalian behavior: is it the mutation or the background genotype.
Trends Neurosci. 19, 177–181.
Golovan, S.P., Meidinger, R.G., Ajakaiye, A., Cottrill, M., Wiederkehr, M.Z., Barney, D.J., Plante, C., Pollard,
J.W., Fan, M.Z., Hayes, M.A., Laursen, J., Hjorth, J.P., Hacker, R.R., Phillips, J.P., Forsberg, C.W., 2001. Pigs
expressing salivary phytase produce low-phosphorus manure. Nat. Biotechnol. 19, 741–745.
Gossen, M., Freundlieb, S., Bender, G., Müller, G., Hillen, W., Bujard, H., 1995. Transcriptional activation by
tetracyclines in mammalian cells. Science 268, 1766–1769.
Graveley, B.R., 2001. Alternative splicing: increasing diversity in the proteomic world. Trends Genet. 17, 100–107.
Greenstein, J., Sachs, D.H., 1997. The use of tolerance for transplantation across xenogenic barriers. Nat.
Biotechnol. 15, 235–238.
Grobet, L., Martin, L.J., Poncelet, D., Pirottin, D., Brouwers, B., Riquet, J., Schoeberlein, A., Dunner, S., Menissier,
F., Massabanda, J., Fries, R., Hanset, R., Georges, M., 1997. A deletion in the bovine myostatin gene causes
the double-muscled phenotype in cattle. Nat. Genet. 17, 71–74.
Groth, C.G., Korsgren, O., Tibell, A., Tollemar, J., Möller, E., Bolinder, J., Östman, J., Reinholt, F.P., Hellerström,
C., Andersson, A., 1994. Transplantation of porcine fetal pancreas to diabetic patients. Lancet 344, 1402–1404.
Gu, H., Marth, J.D., Orban, P.C., Mossmann, H., Rajewsky, K., 1994. Deletion of a DNA polymerase gene
segment in T cells using cell type-specific gene targeting. Science 265, 103–106.
Gunsalus, J.R., Brady, D.A., Coulter, S.M., Gray, B.M., Edge, A.S.B., 1997. Reduction of serum cholesterol in
Watanabe rabbits by xenogenic hepatocellular transplantation. Nat. Med. 3, 49–53.
Halter, R., Carnwath, J., Espanion, G., Herrmann, D., Lemme, E., Niemann, H., Paul, D., 1993. Strategies to
express factor VIII gene constructs in the ovine mammary gland. Theriogenology 39, 137–149.
Haskell, R.E., Bowen, R.A., 1995. Efficient production of transgenic cattle by retroviral infection of early embryos.
Mol. Reprod. Dev. 40, 386–390.
Hernandez, D., Mee, P.J., Martin, J.E., Tybulewicz, V.L., Fisher, E.M., 1999. Transchromosomal mouse embryonic
stem cell lines and chimeric mice that contain freely segregating segments of human chromosome 21. Hum.
Mol. Genet. 8, 923–933.
Hiripi, L., Makovics, F., Baranyi, M., Paul, D., Carnwath, J.W., Bösze, Z., Niemann, H., 2003. Expression of active
human blood clotting factor VIII in the mammary gland of transgenic rabbits. DNA Cell Biol., 22, 41–45.
Hogan, B., Constantini, F., Lacy, E., 1994. Manipulating the Mouse Embryo: A Laboratory Manual. Cold Spring
Harbour Laboratory, Cold Spring Harbour Press, Plainview, NY.

314 H. Niemann, W.A. Kues / Animal Reproduction Science 79 (2003) 291–317
Hughes, B.O., Hughes, G.S., Waddington, D., Appleby, M.-C., 1996. Behavioural comparison of transgenic and
control sheep: movement order, behaviour on pasture and in covered pens, behaviour on pasture and in covered
pens. J. Anim. Sci. 63, 91–101.
Hyttinen, J.-M., Peura, T., Tolvanen, M., Aalto, J., Alhonen, L., Sinervirta, R., Halmekytö, M., Myöhänen, S.,
Jänne, J., 1994. Generation of transgenic dairy cattle from transgene-analyzed and sexed embryos produced in
vitro. Biotechnology 12, 606–608.
Ikeno, M., Grimes, B., Okazaki, T., Nakano, M., Saitoh, K., Hoshino, H., McGill, I., Cooke, H., Masumoto, H.,
1998. Construction of YAC-based mammalian artificial chromosomes. Nat. Biotechnol. 16, 431–439.
Imaizumi, T., Lankford, K.L., Burton, W.V., Fodor, W., Kocsis, J.D., 2000. Xenotransplantation of transgenic pig
olfactory ensheathing cells promotes axonal regeneration in rat spinal cord. Nat. Biotechnol. 18, 949–953.
Jiang, Y., Jahagirdar, B.N., Reinhardt, R.L., Schwartz, R.E., Keene, C.D., Ortiz-Gonzalez, X.R., Reyes, M., Lenvik,
T., Lund, T., Blackstad, M., Du, J., Aldrich, S., Lisberg, A., Low, W.C., Largaespada, D.A., Verfaillie, C.M.,
2002. Pluripotency of mesenchymal stem cells derived from adult marrow. Nature 418, 41–49.
Jones, I., 1996. 2010—a pig odyssey. Nat. Biotechnol. 14, 698–699.
Kambadur, R., Sharma, M., Smith, T.P., Bass, J.J., 1997. Mutations in myostatin (GDF8) in double-muscled
Belgian Blue and Piedmontese cattle. Genome Res. 7, 910–916.
Kato, Y., Tani, T., Sotomaru, Y., Kurokawa, K., Kato, J., Doguchi, H., Yasue, H., Tsunoda, Y., 1998. Eight calves
cloned from somatic cells of a single adult. Science 282, 2095–2098.
Kilby, N.J., Snaith, M.R., Murray, J.A.H., 1993. Site-specific recombinases: tools for genome engineering. TIG
9, 413–421.
Kues, W.A., Carnwath, J.W., Paul, D., Niemann, H., 1998. A DNA-vector-based selection strategy for totipotent
porcine cell lines. Theriogenology 49, 223 (abstract).
Kues, W.A., Anger, M., Carnwath, J.W., Paul, D., Motlik, J., Niemann, H., 2000. Cell cycle synchronization of
porcine fetal fibroblasts: effects of serum deprivation and reversible cell cycle inhibitors. Biol. Reprod. 62,
412–419.
Kues, W.A., Carnwath, J.W., Paul, D., Niemann, H., 2002. Cell cycle synchronization of porcine fetal fibroblasts
by serum deprivation initiates a nonconventional form of apoptosis. Cloning Stem Cells 4, 231–243.
Kühn, R., Schwenk, F., Aguet, M., Rajewsky, K., 1995. Inducible gene targeting in mice. Science 269, 1427–1429.
Kuroiwa, Y., Kasinathan, P., Choi, Y.J., Naeem, R., Tomizuka, K., Sullivan, E.J., Knott, J.G., Duteau, A.,
Goldsby, R., Osborne, B.A., Ishida, I., Robl, J., 2002. Cloned transchromosomic calves producing human
immunoglobulin. Nat. Biotechnol. 20, 889–894.
Lai, L., Kolber-Simonds, D., Park, K.W., Cheong, H.T., Greenstein, J.L., Im, G.S., Samuel, M., Bonk,
A., Rieke, A., Day, B.N., Murphy, C.N., Carter, D.B., Hawley, R.J., Prather, R.S., 2002. Production of
alpha-1,3-galactosyltransferase knockout pigs by nuclear transfer cloning. Science 295, 1089–1092.
Lavitrano, M., Bacci, M.L., Forni, M., Lazzereschi, D., Di Stefano, C., Fioretti, D., Giancotti, P., Marfe, G., Pucci,
L., Renzi, L., Wang, H., Stoppacciaro, A., Stassi, G., Sargiacomo, M., Sinibaldi, P., Turchi, V., Giovannoni,
R., Della Casa, G., Seren, E., Rossi, G., 2002. Efficient production by sperm-mediated gene transfer of human
decay accelerating factor (hDAF) transgenic pigs for xenotransplantation. Proc. Natl. Acad. Sci. USA 99,
14230–14235.
Lemme, E., Eckert, J., Carnwath, J.W., Niemann, H., 1994. Expression of 6WTK-LacZ gene construct in in
vitro produced bovine embryos following microinjection into pronuclei or cytoplasm. Theriogenology 41, 236
(abstract).
Martin, G.R., 1981. Isolation of a pluripotent cell line from early mouse embryos cultured in medium conditioned
by teratocarcinoma stem cells. Proc. Natl. Acad. Sci. USA 78, 7634–7638.
Martin, U., Tacke, S.J., Simon, A., Schröder, C., Wiebe, K., Lapin, B., Haverich, A., Denner, J., Steinhoff, G.,
2002. Absence of PERV specific humoral immune response in baboons after transplantation of porcine cells
of organs. Transplant. Int. 15, 361–368.
Matsui, Y., Zsebo, K., Hogan, B.L., 1992. Derivation of pluripotential embryonic stem cells from murine primordial
germ cells in culture. Cell 70, 841–847.
Mayford, M., Mansuy, I.M., Muller, R.U., Kandel, E.R., 1997. Memory and behavior: a second generation of
genetically modified mice. Curr. Biol. 7, 580–589.
McCreath, K., Howcroft, J., Campbell, K.H.S., Colman, A., Schnieke, A., Kind, A., 2000. Production of
gene-targeted sheep by nuclear transfer from cultured somatic cells. Nature 405, 1066–1069.

H. Niemann, W.A. Kues / Animal Reproduction Science 79 (2003) 291–317 315
McPherron, A.C., Lee, S.J., 1997. Double muscling in cattle due to mutations in the myostatin gene. Proc. Natl.
Acad. Sci. USA 94, 12457–12461.
McPherron, A.C., Lawler, A.M., Lee, S.J., 1997. Regulation of skeletal muscle mass in mice by a new TGF-beta
superfamily member. Nature 38, 83–90.
Meade, H.M., Echelard, Y., Ziomek, C.A., Young, M.W., Harvey, M., Cole, E.S., Groet, S., Smith, T.E., Curling,
J.M., 1999. Expression of recombinant proteins in the milk of transgenic animals. In: Fernandez, J.M., Hoeffler,
J.P. (Eds.), Gene Expression Systems. Academic Press, San Diego, USA, pp. 399–427.
Michler, R.E., 1996. Xenotransplantation: risks and prospects. Xeno 4, 21–26.
Modrek, B., Lee, C., 2001. A genomic view of alternative splicing. Nat. Genet. 30, 13–19.
Monaco, A.P., Larin, Z., 1994. YACs, BACs, PACs and MACs: artificial chromosomes as research tools. TIBTECH
12, 280–286.
Müller, M., Brem, G., 1991. Disease resistance in farm animals. Experientia 47, 923–934.
Murray, J.D., 1999. Genetic modification of animals in the next century. Theriogenology 51, 149–159.
Niemann, H., Kues, A.W., 2000. Transgenic livestock: premises and promises. Anim. Reprod. Sci. 60–61, 277–293.
Niemann, H., Wrenzycki, C., 2000. Alterations of expression of developmentally important genes in
preimplantation bovine embryos by in vitro culture conditions: implications for subsequent development.
Theriogenology 54, 21–24.
Niemann, H., Halter, R., Paul, D., 1994. Gene transfer in cattle and sheep: a summary perspective. In: Proceedings of
the Fifth World Congress on Genetics Applied to Livestock Production, vol. 21, Guelph, Canada, pp. 339–346.
Niemann, H., Halter, R., Carnwath, J.W., Herrmann, D., Lemme, E., Paul, D., 1999. Expression of human blood
clotting factor VIII in the mammary gland of transgenic sheep. Transgenic Res. 8, 237–247.
Niemann, H., Verhoeyen, E., Wonigeit, K., Lorenz, R., Hecker, J., Schwinzer, R., Hauser, H.J., Kues, W.A., Halter,
R., Lemme, E., Herrmann, D., Winkler, M., Wirth, D., Paul, D., 2001. CMV early promoter induced expression
of hCD59 in porcine organs provides protection against hyperacute rejection. Transplantation 72, 1898–1906.
Niemann, H., Döpke, H.H., Hadeler, K.G., 2002a. Production of transgenic ruminants by DNA microinjection.
In: Pinkert, C. (Ed.), Transgenic Animal Technology: A Laboratory Handbook, 2nd ed. Academic Press, San
Diego, USA, pp. 337–357.
Niemann, H., Wrenzycki, C., Lucas-Hahn, A., Brambrink, T., Kues, W.A., Carnwath, J.W., 2002b. Gene expression
patterns in bovine in vitro produced and nuclear transfer derived embryos and their implication for early
development. Cloning Stem Cells 4, 29–37.
Nottle, M.B., Nagashima, H., Verma, P.J., Du, Z.T., Grupen, C.G., Ashman, R.J., Macllfatrick, S., 1997.
Developments in transgenic techniques in pigs. J. Reprod. Fertil. Suppl. 52, 237–244.
Nottle, M.B., Nagashima, H., Verma, P.J., Du, Z.T., Grupen, C.G., McIlfatrick, S.M., Ashman, R.J., Harding, M.P.,
Giannakis, C., Wigley, P.L., Lyons, I.G., Harrison, D.T., Luxford, B.G., Campbell, R.G., Crawford, R.J., Robins,
A.J., 1999. Production and analysis of transgenic pigs containing a metallothionein porcine growth hormone
gene construct. In: Murray, J.D., Anderson, G.B., Oberbauer, A.M., McGloughlin, M.M. (Eds.), Transgenic
Animals in Agriculture. CABI Publishing, New York, USA, pp. 145–156.
O’Brien, S.J., Menotti-Raymond, M., Murphy, W.J., Nash, W.G., Wienberg, J., Stanyon, R., Copeland, N.G.,
Jenkins, N.A., Womack, J.E., Graves, J.A.M., 1999. The promise of comparative genomics in mammals.
Science 286, 458–481.
Oldmixon, B.A., Wood, J.C., Ericcson, T.A., Wilson, C.A., White-Scharf, M.E., Andersson, G., Greenstein, J.L.,
Schuurman, H.J., Patience, C., 2002. Porcine endogenous retrovirus transmission characteristics of an inbred
herd of miniature swine. J. Virol. 76, 3045–3048.
Orban, P.C., Chui, D., Marth, J.D., 1992. Tissue- and site-specific DNA recombination in transgenic mice. Proc.
Natl. Acad. Sci. USA 89, 6861–6865.
Paleyanda, R.K., Velander, W.H., Lee, T.K., Scandella, D.H., Gwazdauskas, F.C., Knight, J.W., Hoyer, L.W.,
Drohan, W.H., Lubon, H., 1997. Transgenic pigs produce functional human factor VIII in milk. Nat. Biotechnol.
15, 971–975.
Paradis, K., Langford, G., Long, Z., Heneine, W., Sandstrom P., Switzer, W.M., Chapman, L.E., Lockey, C., Onions,
D., The XEN 111 Study Group, Otto, E., 1999. Search for cross-species transmission of porcine endogenous
retrovirus in patients treated with living pig tissue. Science 285, 1236–1241.
Park, K.W., Cheong, H.T., Lai, L., Im, G.S., Kuhholzer, B., Bonk, A., Samuel, M., Rieke, A., Day, B.N., Murphy,
C.N., Carter, D.B., Prather, R.S., 2001. Production of nuclear transfer-derived swine that express the enhanced
green fluorescent protein. Anim. Biotechnol. 12, 173–181.

316 H. Niemann, W.A. Kues / Animal Reproduction Science 79 (2003) 291–317
Patience, C., Takeuchi, Y., Weiss, R.A., 1997. Infection of human cells by an endogenous retrovirus of pigs. Nat.
Med. 3, 282–286.
Patience, C., Patton, G.S., Takeuchi, Y., Weiss, R.A., McClure, M.O., Rydberg, L., 1998. No evidence of pig
DNA of retroviral infection in patients with short-term extracorporal connection of pig kidneys. Lancet 352,
699–701.
Perez, C., Jong de, G., Drayer, J., 2000. Satellite DNA-based artificial chromosomes—chromosomal vectors.
TIBTECH 18, 402–403.
Perry, A.C.F., Wakayama, T., Kishikawa, H., Kasai, T., Okabe, M., Toyoda, Y., Yanagimachi, R., 1999. Mammalian
transgenesis by intracytoplasmic sperm injection. Science 284, 1180–1183.
Perry, A.C., Rothman, A., de las Heras, J.I., Feinstein, P., Mombaerts, P., Cooke, H.J., Wakayama, T., 2001.
Efficient metaphase II transgenesis with different transgene archetypes. Nat. Biotechnol. 19, 1071–1073.
Petit-Zeman, S., 2001. Regenerative medicine. Nat. Biotechnol. 19, 201–206.
Petters, R.M., Alexander, C.A., Wells, K.D., Collins, E.B., Sommer, J.R., Blanton, M.R., Rojas, G.H.Y., Flowers,
W.L., Banin, E., Cideciyan, A.V., Jacobson, S.G., Wong, F., 1997. Genetically engineered large animal model for
studying cone photoreceptor survival and degeneration in retinitis pigmentosa. Nat. Biotechnol. 15, 965–970.
Piedrahita, J.A., Moore, K., Oetama, B., Lee, C.K., Scales, N., Ramsoondar, J., Bazer, F.W., Ott, T., 1998.
Generation of transgenic porcine chimeras using primordial germ cell-derived colonies. Biol. Reprod. 58,
1321–1329.
Platt, J.L., Lin, S.S., 1998. The future promises of xenotransplantation. In: Fishman, J., Sachs, D., Shaikh, R.
(Eds.), Xenotransplantation—Scientific Frontiers and Public Policy. Ann. New York Acad. Sci. 862, 5–18.
Polejaeva, I.A., Chen, S.H., Vaught, T.D., Page, R.L., Mullins, J., Ball, S., Dal, Y., Boano, J., Walker, S., Ayares,
D., Colman, A., Campbell, K.H.S., 2000. Cloned pigs produced by nuclear transfer from adult somatic cells.
Nature 407, 505–509.
Pursel, V.G., Rexroad Jr., C.E., 1993. Status of research with transgenic farm animals. J. Anim. Sci. 71, 10–19.
Resnick, J.L., Bixler, L.S., Cheng, L., Donovan, P.J., 1992. Long-term proliferation of mouse primordial germ
cells in culture. Nature 359, 550–551.
Rexroad Jr., C.E., 1992. Transgenic technology in animal agriculture. Anim. Biotechnol. 3, 1–13.
Rudolph, N.S., 1999. Biopharmaceutical production in transgenic livestock. TIBTECH 17, 367–374.
Sauer, B., 1998. Inducible gene targeting in mice using the Cre/lox system. Methods 14, 381–392.
Sauer, B., Henderson, N., 1988. Site-specific DNA recombination in mammalian cells by the Cre recombinase of
bacteriophage P1. Proc. Natl. Acad. Sci. USA 85, 5166–5170.
Schedl, A., Beermann, F., Thies, E., Montoliu, L., Kelsey, G., Schütz, G., 1992. Transgenic mice generated by
pronuclear injection of a yeast artificial chromosome. Nucleic Acids Res. 20, 3073–3077.
Schedl, A., Montoliu, L., Kelsey, G., Schütz, G., 1993. A yeast artificial chromosome covering the tyrosinase gene
confers copy number-dependent expression in transgenic mice. Nature 362, 258–261.
Schnieke, A.E., Kind, A.J., Ritchie, W.A., Mycock, K., Scott, A.R., Ritchie, M., Wilmut, I., Colman, A., Campbell,
K.H.S., 1997. Human factor IX transgenic sheep produced by transfer of nuclei from transfected fetal fibroblasts.
Science 278, 2130–2133.
Schultze, N., Burki, Y., Lang, Y., Certa, U., Bluethmann, H., 1996. Efficient control of gene expression by single
step integration of the tetracycline system in transgenic mice. Nat. Biotechnol. 14, 499–503.
Seidel Jr., G.E., 1993. Resource requirements for transgenic livestock research. J. Anim. Sci. 71, 26–33.
Shim, H., Gutierrez-Adan, A., Chen, L.R., BonDurant, R.H., Behboodi, E., Anderson, G.B., 1997. Isolation of
pluripotent stem cells from cultured porcine primordial germ cells. Biol. Reprod. 57, 1089–1095.
Squires, E.J., 1999. Status of sperm-mediated delivery methods for gene transfer. In: Murray, J.D., Anderson,
G.B., Oberbauer, A.M., McGloughlin, M.M. (Eds.), Transgenic Animals in Agriculture. CABI Publishing,
New York, USA, pp. 87–96.
Strauss, W.M., Dausman, J., Beard, C., Johnson, C., Lawrence, J.B., Jaenisch, R., 1993. Germ line transmission
of a yeast artificial chromosome spanning the murine 1 collagen locus. Science 259, 1904–1907.
Switzer, W.M., Michler, R.E., Shanmugan, V., Matthews, A., Hussain, A.I., Wright, A., Sandstrom, P., Chapman,
L., Weber, C., Safley, S., Denny, R.R., Navarro, A., Evans, V., Norein, A.J., Kwiatkowski, P., Heneine, W., 2001.
Lack of cross-species transmission of porcine endogenous retrovirus infection to nonhuman primate recipients
of porcine cells, tissues and organs. Transplantation 71, 959–965.
Theuring, F., Thunecke, M., Kosciessa, U., Tuern, J.D., 1997. Transgenic animals as models of neurodegenerative
disease in humans. TIBTECH 15, 320–325.

H. Niemann, W.A. Kues / Animal Reproduction Science 79 (2003) 291–317 317
Thibier, M., 2001. The animal embryo transfer industry in figures. IETS-Newsletter 19, 16–22.
Thomas, M., Northrup, R., Hornsby, P.J., 1997. Adrenocortical tissue formed by transplantation of normal clones
of bovine adrenocortical cells in scid mice replaces the essential functions of the animals’ adrenal glands. Nat.
Med. 3, 978–983.
Tomizuka, K., Shinohara, T., Yoshida, H., Uekima, H., Ohguma, A., Tanaka, S., Sato, K., Oshimura, M., Ishida,
I., 2000. Double trans-chromosomic mice: maintenance of two individual human chromosome fragments
containing Ig heavy and kappa loci and expression of fully human antibodies. Proc. Natl. Acad. Sci. USA 97,
722–727.
van Berkel, P.H., Welling, M.M., Geerts, M., van Veen, H.A., Ravensbergen, B., Salaheddine, M., Pauwels, E.K.,
Pieper, F., Nuijens, J.H., Nibbering, P.H., 2002. Large scale production of recombinant human lactoferrin in
the milk of transgenic cows. Nat. Biotechnol. 20, 484–487.
Vos, J.-M., 1997. The simplicity of complex MACs. Nat. Biotechnol. 15, 1257–1259.
Wakayama, T., Perry, A.C.F., Zuccotti, M., Johnson, K.R., Yanagimachi, R., 1998. Full-term development of mice
from enucleated oocytes injected with cumulus cell nuclei. Nature 394, 369–374.
Wall, R.J., 1996. Transgenic livestock: progress and prospects for the future. Theriogenology 45, 57–68.
Wall, R.J., Hawk, H.W., Nel, N., 1992. Making transgenic livestock: genetic engineering on a large scale. J. Cell.
Biochem. 49, 113–120.
Wheeler, M.B., 1994. Development and validation of swine embryonic stem cells: a review. Reprod. Fertil. Dev.
6, 563–568.
Wheeler, M.B., Bleck, G.T., Donovan, S.M., 2001. Transgenic alteration of sow milk to improve piglet growth
and health. Reprod. Suppl. 58, 313–324.
White, D., 1996a. Alteration of complement activity: a strategy for xenotransplantation. TIB 14, 3–5.
White, D., 1996b. hDAF transgenic pig organs: are they concordant for human transplantation. Xeno 4, 50–54.
Wilmut, I., Schnieke, A.E., McWhir, J., Kind, A.J., Campbell, K.H., 1997. Viable offspring derived from fetal and
adult mammalian cells. Nature 385, 803–810.
Wilmut, I., Beaujean, N., De Sousa, P.A., Dinnyes, A., King, T.J., Paterson, L.A., Wells, D.N., Young, L.E., 2002.
Somatic cell nuclear transfer. Nature 419, 583–586.
Yang, Y.W., Model, P., Heintz, N., 1997. Homologous recombination based modification in Escherichia coli and
germline transmission in transgenic mice of a bacterial artificial chromosome. Nat. Biotechnol. 15, 859–865.
Yarranton, G.T., 1992. Inducible vectors for expression in mammalian cells. Curr. Opin. Biotechnol. 3, 506–511.
Yom, H.-C., Bremel, R.D., 1993. Genetic engineering of milk composition: modification of milk components in
lactating transgenic animals. Am. J. Clin. Nutr. 58 (Suppl.), 299–306.
Young, L.E., Sinclair, K.D., Wilmut, I., 1998. Large offspring syndrome in cattle and sheep. Rev. Reprod. 3,
155–163.
Zaidi, A., Schmoeckel, M., Bhatti, F., Waterworth, P., Tolan, M., Cozzi, E., Chavez, G., Langford, G., Thiru, S.,
Wallwork, J., White, D., Friend, P., 1998. Life-supporting pig to primated renal xeno-transplantation using
genetically modified donors. Transplantation 65, 1584–1590.
Zawada, W.M., Cibelli, J.B., Chei, P.K., Clarkson, E.D., Golueke, P.J., Witta, S.E., Beil, K.P., Kane, J., Abel
Ponce de Leon, F., Jerry, D.J., Robl, J.M., Freed, C.R., Stice, S.L., 1998. Somatic cell cloned transgenic bovine
neurons for transplantation in Parkinson rats. Nat. Med. 4, 569–574.
Ziomek, C.A., 1998. Commercialization of proteins produced in the mammary gland. Theriogenology 49, 139–
144.

MOLECULAR REPRODUCTION AND DEVELOPMENT 65:245–253 (2003)
Cell Cycle Dependent Expression of Plk1 in
Synchronized Porcine Fetal Fibroblasts
MARTIN ANGER, 1 WILFRIED A. KUES, 2 JIRI KLIMA, 1 MANFRED MIELENZ, 2 MICHAL KUBELKA, 1
JAN MOTLIK, 1 MILAN ESNER, 3 PETR DVORAK, 3 JOSEPH W. CARNWATH, 2 AND HEINER NIEMANN 2 *
1 Institute of Animal Physiology and Genetics, Libechov, Czech Republic
2 Department of Biotechnology, Institute for Animal Science, Mariensee, Neustadt, Germany
3 Laboratory of Molecular Embryology, Mendel University, Brno, Czech Republic
ABSTRACT Enzymes of the Polo-like kinase
(Plk) family are active in the pathways controlling
mitosis in several species. We have cloned cDNA fragments
of the porcine homologues of Plk1, Plk2, and
Plk3 employing fetal fibroblasts as source. All three
partial cDNAs showed high sequence homology with
their mouse and human counterparts and contained the
Polo box, a domain characteristic for all Polo kinases.
The expression levels of Plk1 mRNA at various points
of the cell cycle in synchronized porcine fetal fibroblasts
were analyzed by both RT-PCR and the ribonuclease
protection assay. Plk1 mRNA was barely
detectable in G0 and G1, increased during S phase and
peaked after the G2/M transition. A monoclonal antibody
was generated against an in vitro expressed porcine
Plk1-protein fragment and used to detect changes
in Plk1 expression at the protein level. Plk1 protein
was first detected by immunoblotting at the beginning
of S phase and was highest after the G2/M transition.
In summary, the Plk1 expression pattern in the pig is
similar to that reported for other species. The absence
of Plk1 mRNA and protein appears to be a good marker
for G0/G1 and thus for the selection of donor cells for
nuclear transfer based somatic cloning. Mol. Reprod.
Dev. 65: 245–253, 2003. ß 2003 Wiley-Liss, Inc.
Key Words: Plk1; serum deprivation; cell cycle;
butyrolactonuI; aphidicolin
INTRODUCTION
Polo kinase was first identified in yeast and Drosophila
(Llamazares et al., 1991). The homologous molecule,
Polo-like kinase (Plk), was subsequently isolated
from higher vertebrates including, mouse (Clay et al.,
1993), human (Lake and Jelinek, 1993), and Xenopus
(Kumagai and Dunphy, 1996). All members of the Polo
kinase family contain two copies of a unique C-terminal
sequence, the ‘‘Polo box,’’ thought to be responsible for
the intracellular localization of the enzyme (Clay et al.,
1997; Lee et al., 1998). Two additional kinases belonging
to the Polo family but unique to vertebrates are called
Plk2 and Plk3 (Kauselmann et al., 1999; Holtrich et al.,
2000; Hudson et al., 2001; Nigg, 2001). Since there are no
homologues of Plk2 and Plk3 in lower eukaryotes,
ß 2003 WILEY-LISS, INC.
detailed knowledge about the role of the Polo kinases
relates to Plk1.
Plk1 is abundant in proliferating cells and tissues
including fetal tissues and certain types of human
cancer (Yuan et al., 1997; Wolf et al., 1997, 2000). In
cultured mouse cells, Plk1 mRNA is first detectable at
G1/S transition, with a peak at G2/M transition (Lake
and Jelinek, 1993; Uchiumi et al., 1997). Several studies
have demonstrated that Plk1 is critically involved in cell
cycle related activities. The kinase activity of Plk1 is
highest at G2/M and when it is phosphorylated during M
phase and timing of this activation is coincident with
activation of MPF (Golsteyn et al., 1995; Hamanaka
et al., 1995; Mundt et al., 1997). Indeed, it has been suggested
that activated Plk1 is involved in activation of
MPF and thus on mitotic entry (Roshak et al., 2000).
Plk1 activity regulates maturation of the spindle; is
involved in checkpoint monitoring of the integrity of
replicated DNA (Smits et al., 2000), and regulates
substrate specificity of the anaphase-promoting complex
(APC) (reviewed by Glover et al., 1996, 1998;
Golsteyn et al., 1996; Nigg, 1998, 2001). In late mitosis,
Plk1 appears to be involved in the control of cyclin B
proteolysis, thus initiating processes resulting in the
exit from mitosis (Abrieu et al., 1998; Descombes and
Nigg, 1998; Ferris et al., 1998; Kotani et al., 1998; Qian
et al., 1998; 1999; Karaiskou et al., 1999).
In the present study, we have cloned the porcine Plks
1, 2, and 3 and compared the mRNA expression levels of
these genes in synchronized murine and porcine fetal
fibroblasts throughout the cell cycle. In addition, a
monoclonal antibody against Plk1 was generated and
characterized. Expression of Plks in porcine cells had
not been reported previously. The data indicate that
Plk1 mRNA shows the most dramatic changes during
Grant sponsor: FIRCA; Grant number: R03-TW-05530-01; Grant
sponsor: German Ministry for Education and Research (BMBF);
Grant sponsor: Ministry of the Education Youth and Sport of the
Czech Republic; Grant number: LN00A065.
*Correspondence to: Prof., Dr. Heiner Niemann, Department of
Biotechnology, Institute for Animal Science, Mariensee, D-31535
Neustadt, Germany. E-mail: niemann@tzv.fal.de
Received 19 August 2002; Accepted 13 January 2003
Published online in Wiley InterScience (www.interscience.wiley.com).
DOI 10.1002/mrd.10289

246 M. ANGER ET AL.
cell cycle in porcine fetal fibroblasts. We further tested
the hypothesis that absence of Plk1 mRNA and protein
in nonproliferating cells and tissues (Kues et al., 2000),
i.e., cells in the G0 and G1 phase of the cell cycle,
provides a suitable marker to identify populations of
growth-arrested cells. To do this, expression levels of
Plk1 mRNA and protein were measured after fetal
calf serum (FCS) stimulation of serum deprived cells
for defined time intervals as well as in cells blocked
by either aphidicolin or aphidocolin and butyrolactone I
treatment. Determining Plk1 expression to define the
cell cycle stage is of great interest because these cells are
frequently employed as nucleus donor cells in somatic
cloning experiments (Onishi et al., 2000; Polejaeva et al.,
2000) and it had been suggested that it is beneficial to
block donor cells in G0 by serum deprivation (Wilmut
and Campbell, 1998; Lee and Piedrahita, 2002).
MATERIALS AND METHODS
Cell Culture, Cell-Cycle Synchronization,
and FACS Analysis
STO and HeLa cells were purchased from ATTCC
(American Type Culture Collection, Manassas VA),
bovine skin fibroblasts were a kind gift from Dr. Jiri
Kanka, mouse fetal fibroblasts were prepared according
to standard protocols (Hogan et al., 1994). Cells were
thawed and grown to 80% confluency in Dulbecco’s
Modified Eagle Medium (DMEM) plus 10% FCS (Sigma
Chemical Co., St. Louis, MO). Mouse fetal fibroblasts
were synchronized in G0/G1 by reduction of serum
content to 0.2% for 3 days followed by stimulation with
10% FCS 1, 11, 16, and 21 hr before harvesting. Porcine
primary fibroblasts were prepared as recently described
(Kues et al., 2000). All experiments were performed from
the same batch of fetal fibroblasts harvested after the
2nd passage, frozen and stored in liquid nitrogen until
use. For each series of experiments, fibroblasts were
thawed and grown to 80% confluency in DMEM plus
10% FCS (Sigma Chemical Co.). To obtain cell-cycle
expression profiles for Plk1, Plk2, and Plk3 mRNAs,
cells were synchronized by deprivation of FCS (0.2%) in
culture media for 3 days followed by stimulation with
10% FCS for 1, 4, 18, 21 hr. Nocodazole (Sigma Chemical
Co.) was used to obtain M phase synchronized cells.
Therefore, cells stimulated for 16 hr with 10% FCS were
synchronized by 16.5 mM Nocodazole for 8 hr. The following
synchronization protocols were used to measure
Plk1 expression in porcine fetal fibroblasts:
1. G0/G1 cells—obtained by reduction of FCS in the
culture media to 0.2% for 48 hr;
2. G1/S cells—obtained by stimulation of G0/G1 cells by
addition of fresh medium containing 10% FCS and
blocking at the beginning of S phase with 6 mM
aphidicolin (Sigma Chemical Co.), a DNA polymerase
inhibitor, for 14 hr;
3. G2/M cells—produced by washing G1/S cells with
PBS (to remove aphidicolin), followed by stimulation
with medium containing 10% FCS for 3 hr and finally
adding medium containing 10% FCS and 118 mM
butyrolactone I (Affinity, Exeter, UK), a cyclin dependent
kinase inhibitor, for 5 hr.
4. Partially synchronized cells—obtained by stimulating
G0/G1 cells with 10% FCS for 14 or 23 hr,
respectively.
DNA content was measured by FACS to confirm the
cell cycle stage and the efficiency of synchronization as
previously described (Kues et al., 2000).
Cloning of cDNA of Plks
Total RNA was prepared from fibroblasts with the
RNeasy Mini kit (Qiagen, Hilden, Germany) and 1 mgof
the total RNA was used as template for a reverse
transcription (RT) reaction. The RT reaction mix (40 ml
total volume) contained: 1 PCR buffer II (Perkin
Elmer, Billerica, MA); 5 mM MgCl 2 (Gibco-BRL,
Gaithersburg, MD); 1 mM dNTPs (USB Corporation,
Cleveland, OH); RNase inhibitor 20 U (Perkin Elmer);
MuLV RT 2.5 ml (Perkin Elmer); 2.5 mM oligo (dT)12–18
(Gibco-BRL). RT was carried out for 1 hr at 428C with
final denaturing for 5 min at 758C. An aliquot of 5 ml of
the RT reaction was used as a template for a 100 ml
PCR reaction. The primers (Table 1) were based on
regions of consensus between the human and mouse
Plk’s and modified by adding restriction sites for BamHI
and XhoI. The PCR reaction mixture (100 ml total
volume) contained: 1 Pfu polymerase reaction buffer
(Stratagene, La Jolla, CA); 0.2 mM dNTPs (USB
Corporation), cloned Pfu DNA polymerase (Stratagene)
2.5 U; primers 0.5 mM each (MWG Biotech AG,
Ebersberg, Germany). PCR temperature cycle: 948C
for 45 sec, 608C for 45 sec, 728C for 3 min, repeated for 29
cycles, final extension 728C for 10 min. PCR products
were gel purified and sub-cloned into the pGEM 1 -4Z
vector (Promega GmbH, Mannheim, Germany) by using
TA cloning strategy pGEM-T Easy kit (Promega GmbH)
and sequenced.
Semiquantitative RT-PCR
Procedures for RNA isolation and the RT reaction
were as described above for cloning except that priming
of the RT reaction was performed with random hexamers.
Relative changes in the abundance of Plk transcripts
were determined by a multiplex RT-PCR assay,
using either b-actin or GAPDH mRNA as internal
standards. Primers used for the quantification are listed
in Table 1. The PCR reaction mixture (20 ml) contained:
5 ml of the RT reaction as a template; 1 PCR buffer
(Gibco-BRL); 0.2 mM each dNTP (USB Corporation);
1.5 mM MgCl2 (Gibco-BRL); PCR primers 0.5 mM each
(MWG Biotech AG); Taq DNA polymerase 0.5 U (Gibco-
BRL). PCR temperature profile: initial denaturation at
948C for 1 min; then cycles of 948C for 15 sec; 608C for
30 sec; 728C for 1 min; and final elongation 728C for
5 min. Because of the abundance of GAPDH transcript,
the PCR mixture initially contained only Plk primers
and the GAPDH primers were added after the 5th PCRcycle
during a programmed hold at 728C. The total
number of PCR-cycles was 27 for Plk1 and 22 for

GAPDH. The number of cycles was optimized separately
for each gene during preliminary experiments to obtain
linear amplification of the template. Primers used
separately gave the same amount of product as in the
multiplex reaction. The control reactions for each PCR
included one tube without the cDNA template and
one tube with RNA that had not been exposed to RT.
The PCR products were separated on 1.5% agarose
gels (Gibco-BRL); stained with ethidium bromide; and
recorded using a Photometrics CCD camera. Densitometric
evaluation was performed using Image Master
1D Elite V3 (Amersham Pharmacia, Piscataway,
New Jersey).
mRNA Quantification by the
Ribonuclease Protection Assay
Linearized plasmid pGEM-4Z containing Plk1 or
GAPDH inserts was used as a template for sense and
antisense RNA probe synthesis with a MAXIscript TM
T3/T7 Kit (Ambion, Austin, TX). SP6 polymerase was
purchased from New England Biolabs (New England
Biolabs GmbH, Frankfurt am, Main, Germany). Probes
were labeled with [ 32 P]UTP (800 Ci/mmol, 20 mCi/ml)
(Amersham Pharmacia Biotech, Freiburg, Germany).
The length of protected fragments was 224 bp for
GAPDH and 458 bp for Plk1. After in vitro transcription,
full-length transcripts were purified from a polyacrylamide
gel. For each reaction, 1 mg of total RNA was used
for solution hybridization (RPA II kit, Ambion) with the
molar access of the probe determined for each probe
separately in preliminary experiments. Solution hybridization
was carried out at 428C overnight, subsequently
RNA/RNA hybrids were treated by RNase T1 and
protected fragments were separated on a 5% polyacrylamide
gel. The labeled fragments were detected by
autoradiography on a Kodak Biomax ML film (Sigma
Chemical Co.). Developed films were recorded with a
CCD camera and densitometrically analyzed with
Image Master 1D Elite V3 (Amersham Pharmacia).
TABLE 1. Sequences of Used Primers
Primers Product size (bp)
A (for cloning)
Plk1 sense GGG ATC CGG CGA AAG AGA TCC CGG AGG TCC TAG T
Plk1 antisense CCT CGA GTT ACG GCT GGC CAG CTC CTT GCA GCA
Plk2 sense GGG ATC CAT GTG GAA CCC CAA ATT ATC TTT
Plk2 antisense GCT CGA GTC AGC ACC GTC ACT TGA CTG ATG
Plk3 sense GGG ATC CGC ATC AAG CAG GTT CAT TAC G
Plk3 antisense GCT CGA GTG GGA AGC GAG GTA AGT ACA
B (for quantification)
Plk1 sense CTC CTG GAG CTG CAC AAG AGG AGG AA
Plk1 antisense TCT GTC TGA AGC ATC TTC TGG ATG AG 455
Plk2 sense CCG GAC AGA CTC TCT TCC AGC TGT T
Plk2 antisense GGT ACC CAA AGC CAT ATT TGT TGG A 538
Plk3 sense TGG AGA TGG GTT TGA AGA AGG T
Plk3 antisense TGG GGT TGT AGT GCA CCG TC 274
GAPDH sense GTT CCA GTA TGA TTC CAC CCA CGG CAA GTT
GAPDH antisense TGC CAG CCC CAG CAT CAA AGG TAG AAG AGT 763
b-Actin sense GTC GAC AAC GGC TCC GGC A
b-Actin antisense GTC AGG TCC CGG CCA GCC A 529
Plk: Polo-like kinase.
IDENTIFICATION OF POLO-LIKE KINASES IN PORCINE FIBROBLASTS 247
Production of Recombinant Plk1, Antibody
Generation, and Western Blotting
A 344 bp fragment of porcine Plk1 cDNA corresponding
to bases 730–1,074 of GeneBank sequence
AF339021 was subcloned into the pET30b (Novagen,
Madison, WI) bacterial expression vector. The recombinant
plasmid was introduced into competent E. coli
(BL21[DE3] LysS, Novagen). A single colony was selected
and inoculated into LB media containing kanamycin
and chloramphenicol (Sigma Chemical Co.). The bacteria
cells were cultured at 378C for 3 hr, then IPTG
(Sigma Chemical Co.) was added to a final concentration
of 0.3 mM. The bacteria were then cultured for 5 hr at
258C and finally, were harvested by centrifugation. The
recombinant protein was isolated by His Bind TM and
S Tag TM purification kits (Novagen).
For the production of monoclonal antibodies a standard
protocol was used (Harlow and Lane, 1988).
Briefly, female Balb/c mice were repeatedly immunized
with 30 mg purified soluble recombinant protein. Spleen
cells were fused with SP 2/0 mouse myeloma cells in 50%
PEG (Sigma Chemical Co.) and the resultant hybridomas
were selected and screened by ELISA and Western
blotting using the porcine Plk1 fusion protein and
porcine fetal fibroblast lysate. The supernatant from
clone PL-12 was used in this study.
Proteins were separated on 10% SDS–PAGE gels
and blotted onto PVDF membranes (Amersham) following
the protocol of Harlow and Lane (1988). Membranes
were blocked with 5% FCS dissolved in 20 mM Tris-
HCl, pH 7.6, 0.1% Tween-20, 137 mM sodium chloride
(TTBS) (all from Sigma Chemical Co.). Plk1 was detected
with 1:50 diluted hybridoma cell culture supernatant.
Goat anti-mouse antibodies coupled to horseradish
peroxidase (HRP) (Sigma Chemical Co.) were used as
secondary antibody. HRP activity was visualized by
chemiluminescence using the ECL Plus Western blotting
system (Amersham Pharmacia Biotech) and detected by
exposure to Kodak BioMax Light-1 film.

248 M. ANGER ET AL.
Statistical Analysis
The t-test was used to evaluate the observed differences
between groups. P values lower than 0.05 were
considered to be significant. All statistical analysis was
performed using KyPlot software.
RESULTS
Cloning of Porcine Plks 1, 2, and 3
Three partial Plk sequences, representing the porcine
homologous cDNAs of Plk1, Plk2, and Plk3, were isolated
from fetal fibroblasts by a RT-PCR approach.
Using BLAST (Tatusova and Madden, 1999), the
amino acid sequence of the cloned 1,579 bp fragment of
porcine Plk1 (GeneBank Acc. No. AF339021) was found
to be highly conserved to the published Plk1 sequences
of other eukaryotes (Fig. 1). The deduced amino acid
sequence of this fragment is 96% identical with human
Plk1 (AAA36659), 95% with mouse Plk1 (AAA16071),
82% with Xenopus Plx1 (AAC60017), and 51% with
Drosophila melanogaster Polo (NP_524179). BLAST
also identified two characteristic Plk domains employing
a search of the Conserved Domain Database
(Altschul et al., 1997). The first one is an N-terminal
serine/threonine protein kinase catalytic domain consisting
of the 252 amino acids located between positions
8 and 260 of the amino acid sequence essential for kinase
activity. The amino acid homology in this domain in
comparison with the corresponding serine/threonine
protein kinase catalytic domains of human, mouse,
Xenopus, and Drosophila Plk1 is 99, 98, 86, and 65%,
respectively, suggesting that it is slightly more conserved
than the rest of the sequence. The second
conserved domain is the C terminal Polo box distinguishing
the Polo kinases from other serine/threonine
protein kinases. Two Polo box sequences were located.
The first occurred between amino acids 372–435 and
the second was found between amino acids 470–523 of
porcine Plk1. Figure 1 shows the alignment of Plk1
kinases from porcine, human, mouse, Xenopus, and
Drosophila species; the serine/threonine kinase domain
and the Polo boxes are underlined.
The cloned fragment of porcine Plk2 is 952 bp long
(GeneBank Acc. No. AF348424) and the deduced amino
acid sequence had 316 amino acid residues. Among
vertebrates, the porcine Plk2 amino acid sequence had
99% identity with the homologous human sequence
(XP_041712), 97% with the mouse sequence (P53351),
and 78% with the Xenopus sequence (AAL30175). No
homologues were identified in nonvertebrate organisms.
The porcine Plk2 fragment contained a portion of
the serine/threonine kinase domain and a Polo box
identified by a search against the Conserved Domain
Database (Altschul et al., 1997).
The cloned fragment of Plk3 (GeneBank Acc.
No. AF348425) was 1,007 bp long and its deduced
amino acid sequence possessed 335 amino acids. The
porcine Plk3 fragment had 92, 86, 53% identical amino
acids with corresponding human (XP_046526), mouse
(AAC52191), and Xenopus (AAL30177) sequences. In
the region corresponding to the fragment sequenced
in this study, we found some regions of discontinuity
with those vertebrate homologues, which may affect its
function. For example, the murine sequence of Plk3
contained gaps of 17 amino acids when compared to
the porcine and human sequences. Like the other porcine
Plks, the porcine Plk3 contained a serine/threonine
kinase domain and the Polo box.
Cell Cycle Stage Specific Expression
of Plk1, Plk2, and Plk3
Initially, we analyzed the expression levels of Plk1,
Plk2, and Plk3 in murine and porcine fetal fibroblasts
(Figure 2A,B) during the cell cycle. Serum deprived cell
cultures were mitotically stimulated by addition of
10% FCS and the relative abundance of Plk transcripts
was determined. For each experiment a FACS analysis
was performed (Table 2). Plk2 and Plk3 mRNA levels
peaked rapidly within 1 hr of serum stimulation, whereas
the highest levels of Plk1 mRNA were found after
18–21 hr of stimulation. In porcine cell cultures, Plk1
mRNA showed the highest changes in expression levels
throughout the cell cycle. We further analyzed the
changes in the expression levels of Plk1 with our optimized
synchronization protocols to compare cells synchronized
by serum stimulation with cells synchronized
by specific inhibitors of cell cycle progression. The mRNA
levels of Plk1 were determined by RT-PCR analysis at
five points in the cell cycle (Fig. 3A). Samples were
obtained by serum deprivation of porcine fetal fibroblasts
(0.2% FCS) for 2 days to block the cells in G0 and then
releasing the block by the addition of 10% FCS. Cells
were harvested at G0/G1 (without serum stimulation)
and at 14 and 23 hr following serum stimulation. The
remaining two time points were obtained by releasing
the fibroblasts from G0 and blocking them at G1/S or G2/
M transition using aphidicolin and butyrolactone I (Kues
et al., 2000). The efficiencies of the cell cycle synchronisations
were measured by FACS analysis (Table 3). The
lowest levels of Plk1 mRNA were observed in G0 fibroblasts
(Fig. 3A). After serum stimulation, a significant
increase in Plk1 mRNA was evident at 14, and the
highest amount was detected at 23 hr (Fig. 3A). Expression
levels of Plk1 mRNA in cells reentering the cell
cycle following serum stimulation were compared with
fibroblasts at G1/S and at G2/M transition using
RT-PCR. These results were confirmed by RPA (Fig. 4).
The amount of Plk1 mRNA was significantly higher
(P 0.01) in cells entering S phase (stimulated with 10%
FCS for 14 hr) than in cells blocked at G1/S transition by
growth in 10% FCS followed by aphidicolin treatment
for 14 hr. Significantly higher Plk1 mRNA was found in
cells stimulated with FCS for 23 hr compared with cells
blocked at the beginning of S phase by aphidicolin or
stimulated for only 14 hr by FCS (P 0.05)
Expression of Plk1 Protein in
Course of Cell Cycle
A monoclonal antibody against porcine Plk1 was generated,
to determine, whether the cell cycle dependent

IDENTIFICATION OF POLO-LIKE KINASES IN PORCINE FIBROBLASTS 249
Fig. 1. Alignment of Polo-like kinase 1 (Plk1) sequences. The
deduced amino acid sequence of porcine Plk1 (AAK28550) aligned
with the homologous sequences of man (AAA36659), mouse
(AAA16071), Xenopus (AAC60017), and Drosophila (NP_524179).
transcript levels of Plk1 reflect different protein levels.
A recombinant Plk1 fragment (bases 730–1,074), that
showed the greatest divergence compared to porcine
Plk2 and Plk3 was used to immunize mice. The
The conserved residues are in black columns. The sequences of
the serine/threonine kinase catalytic domain (residues 8–260 of the
porcine sequence) and the Polo boxes (residues 372–435 and 470–523
of the porcine sequence) are underlined.
monoclonal antibody PL-12 was found to be specific for
Plk1 and identified a single band of apparently 68 kDa
on Western blots from porcine fetal fibroblasts (Fig. 3B).
PL-12 antibody did not show reactivity with Plk2 or Plk3

250 M. ANGER ET AL.
Fig. 2. Expression profiles of Plks in murine and porcine fetal
fibroblasts. A: Summarized Plk1, Plk2, and Plk3 mRNA expression
levels from three independent experiments with mouse fetal fibroblasts.
The black bars represent Plk1, gray bars represent Plk2 and
white bars represent Plk3. The error bar represents the SD value for
each experiment. B: Plk1, Plk2, and Plk3 mRNA expression levels from
a single experiment with porcine fetal fibroblasts. Semiquantitative
RT-PCR analysis was repeated three times for this experiment with
similar results.
(data not shown). Western blot analysis using the
antibody PL-12 showed that the cell cycle stage dependent
translation of the protein (Fig. 3B) followed the
same pattern as RT-PCR had revealed for transcription,
i.e., Plk1 was first detected at G1/S transition, increased
in cells entering S phase (after 14 hr of FCS stimulation),
and reached its highest level after G2/M transition when
cells were already in mitosis (after 23 hr of FCS stimulation).
We also tested the reactivity of the antibody with
cell lysates from different species and found that it
crossreacts with Plk1 from mouse STO fibroblasts,
human HeLa cells and bovine skin fibroblasts (Fig. 3C).
DISCUSSION
Plks appear to be crucially involved in cell cycle
regulation in several eukaryotic species (Nigg, 1998). In
the present study, we cloned and sequenced cDNA
fragments of porcine Plk1, Plk2, and Plk3. While our RT-
PCR cloning strategy did not allow to clone full-length
cDNA, 1,579 bp of sequence were obtained for porcine
Plk1; 952 bp for porcine Plk2; and 1,007 bp for porcine
Plk3. All three showed a high degree of sequence
homology with Plks from other species with the closest
similarity to their corresponding human Plks. We identified
two domains shared by all three cloned porcine
Plks, a catalytic domain typical for serine/threonine
kinases, and the Polo box domain, which is the hallmark
of all Polo kinases (Clay et al., 1997; Lee et al., 1998). The
highest conservation between pig, human, mouse, frog,
and fruit fly Plks was found in the catalytic and Polo box
domains.
Initial experiments on the cell cycle dependent expression
of Plk genes in mouse and porcine fetal
fibroblasts showed that the regulation of transcription
differs dramatically between Plk genes. Plk2 and Plk3
mRNA levels peaked rapidly within 1 hr of serum
stimulation of serum deprived cells, whereas the highest
Plk1 levels were found after 18–21 hr. In porcine fetal
fibroblasts, the greatest changes during the course of
TABLE 2. Effects of Serum Deprivation and Serum Stimulation on
the Percentages ( SD) of Cells in the Different Cell Cycle Stages
G0/G1 phase cells S phase cells G2/M phase cells
A. Mouse fetal fibroblasts a
3 days starved 86.3 6.1 4.7 2.3 9.0 3.7
1 hr stimulated 88.2 6.5 5.3 2.9 6.5 3.8
11 hr stimulated 76.5 5.4 12.9 2.0 10.2 6.0
16 hr stimulated 53.2 7.1 35.4 1.5 11.4 2.3
18 hr stimulated 45.4 5.1 31.2 1.8 23.4 1.7
21 hr stimulated 44.9 4.7 21.0 3.6 34.1 1.6
B. Porcine fetal fibroblasts b
3 days starved 83.62 5.5 10.88
1 hr stimulated 85.63 4.88 9.49
4 hr stimulated 81.69 6.82 11.49
18 hr stimulated 67.28 21.88 10.85
21 hr stimulated 38.11 50.43 11.46
Nocodazole 31.60 31.59 31.60
a Summarized FACS data of three independent experiments.
b FACS data of a single experiment.

IDENTIFICATION OF POLO-LIKE KINASES IN PORCINE FIBROBLASTS 251
Fig. 3. Plk1 expression in synchronized porcine fibroblasts. A:
mRNA expression in serum deprived (G0/G1), fetal calf serum (FCS)
stimulated (14 and 23 hr) and cells synchronized by aphidicolin (G1/S)
or butyrolactone I (G2/M). The gel picture shows representative results
of the semiquantitative multiplex RT-PCR. B: Plk1 protein expression
cell cycle were found for Plk1. To characterize Plk1
expression in more details, optimized cell cycle synchronization
protocols were employed. Under normal culture
conditions, 66% of the cells had a DNA content characteristic
of G0/G1 and a complete cell cycle lasted
approximately 22 hr. Serum starvation increased the
proportion of cells in G0/G1 to 80%. The aphidicolin
block protocol produced a population in which 78% of
cells were blocked at G1/S transition, being unable
to initiate DNA synthesis. FCS stimulation for 14 hr
after serum starvation resulted in a population of cells
in which 49% had DNA content characteristic of G1
and 38% had entered S phase. The protocol with
aphidicolin followed by butyrolactone I produced a
population in which 41% of the cells were blocked at
the G2/M transition and 38% were in G1. FCS stimulation
of starved cells for 23 hr produced a population in
which 81% of the cells were either in late M phase or
early G1. We previously reported that porcine fetal
fibroblasts released from blocking with aphidicolin
and/or butyrolactone I show no residual effect on
in synchronized porcine fetal fibroblasts. The Plk-1 protein was
detected by Western blotting with monoclonal antibody PL-12. Cells
were treated as was indicated above at RT-PCR analysis. C: Crossreactivity
of PL-12 antibody with Plk1 from mouse STO cells, human
HeLa cells and bovine skin fibroblasts (BF).
proliferation rates or on Plk1 mRNA expression (Kues
et al., 2000).
The human Plk1 promoter contains domains similar
to those found in the promoters of other cell cycle
regulated proteins, including cyclin A and cyclin B
which are known to be activated at G1/S transition
(Uchiumi et al., 1997). This is consistent with the
observation that cells blocked by aphidicolin at the
G1/S transition had considerably more Plk1 mRNA than
the starved cells in G0/G1. Our data for porcine fetal
fibroblasts are also consistent with those for cultured
mouse and human cells (Lake and Jelinek, 1993;
Golsteyn et al., 1994) and with results (Uchiumi et al.,
1997) in which various Plk1 promoter—luciferase transgene
constructs were employed in HeLa cells synchronized
by a double thymidine block. Cells initiated Plk1
transcription at the G1/S transition. These data from
human cells coincide with the expression profile of Plk1
in porcine fetal fibroblasts. Interestingly, cells released
from the aphidicolin block were able to complete S phase
in a significantly shorter time period than starved cells
TABLE 3. Cell Cycle Synchronization of Porcine Fetal Fibroblasts ( SD)
Treatment of cells G0/G1 phase cells S phase cells G2/M phase cells
Unsynchronized 24 hr 66.0 6.0 a
G0/G1 80.3 3.5 b
G1/S 77.7 5.1 a,b
14 hr FCS 49.0 8.7 c,d
G2/M 38.3 2.1 d
23 hr FCS 46.3 4.2 c
15.3 3.5 a
18.3 3.1 a
6.0 3.0 b
13.7 5.5 a
6.0 1.0 b
16.3 4.2 a
38.0 9.8 13.0 1.7 a
20.3 1.2 a,c
41.3 3.2 b
19.3 3.2 a,c
34.3 4.9 b
Summarized FACS data of three independent experiments. The variability between groups
was tested and the data within columns, which are significantly different are marked by
different superscripts. FCS, fetal calf serum.

252 M. ANGER ET AL.
Fig. 4. Comparative quantification of Plk1 transcripts employing
RT-PCR and RPA. Semiquantitative multiplex RT-PCR analysis was
repeated three times for each of three experiments and results are
summarized in gray bars. The black bars represent the three RPA
measurements of RNA obtained from single experiment. The RT-PCR
expression levels in all groups differ significantly (P 0.05) from each
other with the exception of groups 14 hr FCS and G2/M cells. In RPA
analysis, all groups were significantly different (P 0.05), except
groups 23 hr FCS and G2/M cells.
stimulated by FCS (unpublished observation). This
suggests that processes unrelated to DNA replication
itself are rate limiting in this phase of the cell cycle
and that they are able to proceed in the presence of
aphidicolin that inhibits the primer elongation step of
DNA replication.
Apparently Plk1 expression is a marker for dividing
cells. The protein was undetectable and the mRNA was
only barely detectable in serum deprived cells arrested
in G0/G1. The apparent background of S and G2/M
phase cells in serum deprived cultures seems to reflect
the fact that early passages of primary cells were used. It
is well described that initially primary cultures consist
of subpopulations that differ substantially in their
potential to divide (Rubin, 1998). The consequence is
that even at early passage numbers a certain percentage
of cells stops dividing in a stochastic manner and eventually
undergoes senescence. However, when the proportion
of cells in G0/G1 decrease during mitotic
stimulation, the amount of both Plk1 mRNA and protein
increased. Highest levels of Plk1 mRNA and protein
were found in populations with the highest proportion of
cells in mitosis; the two FCS stimulated populations and
the population blocked at the G2/M transition. Plk1
expression can be used to characterize the level of synchronization
in cells frequently used for a wide spectrum
of in vitro techniques, in particular somatic nucleus
transfer.
In the present experiments, the levels of Plk1 mRNA
determined by RT-PCR which is based on enzymatic
amplification of the target molecule were compared to
data obtained by RPA which is based on hybridization.
The results obtained by these two methods were nearly
identical. However, RPA requires more starting material
and more time than RT-PCR. Immunodetection of
Plk1 protein affords a third alternative for cell cycle
analysis. It also requires more material and time than
RT-PCR but obviously G0 cells contain no Plk1 protein
while early G1 cells contain residual Plk1 protein from
the previous cell cycle. Thus protein analysis is the most
accurate method for the identification of cells at G0
phase. For a rapid evaluation of synchronization efficiency
or the proliferation status of cultured cells,
especially when starting material is limited, RT-PCR
measurement of Plk1 expression is the method of choice.
In conclusion, results of the study reported here, indicate
that expression of Plk1 is a suitable marker for
determining cell cycle stage in porcine fetal fibroblasts
and may thus be a useful tool in the future improvement
of porcine somatic nuclear transfer.
ACKNOWLEDGMENTS
The authors thank Doris Herrmann and Lenka
Travnickova for excellent technical assistance in the
laboratory. We are grateful to Dr. Josef Fulka for discussion
and critical reading of manuscript. We also thank
Dr. Jiri Kanka for bovine skin fibroblasts.
REFERENCES
Abrieu A, Brassac T, Galas S, Fisher D, Labbe JC, Doree M. 1998. The
Polo-like kinase Plx1 is a component of the MPF amplification loop at
the G2/M-phase transition of the cell cycle in Xenopus eggs. J Cell Sci
111:1751–1757.
Altschul SF, Stephen F, Madden TL, Thomas L, Schäffer AA, Alejandro
A, Jinghui Zhang, Zheng Zhang, Webb Miller, Lipman David J. 1997.
Gapped BLAST and PSI-BLAST: A new generation of protein
database search programs. Nucleic Acids Res 25:3389–3402.
Clay FJ, McEwen SJ, Bertoncello I, Wilks AF, Dunn AR. 1993.
Identification and cloning of a protein kinase-encoding mouse gene,
Plk, related to the polo gene of Drosophila. Proc Natl Acad Sci USA
9011:4882–4886.
Clay FJ, Ernst MR, Trueman JW, Flegg R, Dunn AR. 1997. The mouse
Plk gene: Structural characterization, chromosomal localization, and
identification of a processed Plk pseudogene. Gene 198:329–339.
Descombes P, Nigg EA. 1998. The polo-like kinase Plx1 is required for
M phase exit and destruction of mitotic regulators in Xenopus egg
extracts. EMBO J 175:1328–1335.
Ferris DK, Maloid SC, Li CC. 1998. Ubiquitination and proteasome
mediated degradation of polo-like kinase. Biochem Biophys Res
Commun 18:340–344.
Glover DM, Ohkura H, Tavares A. 1996. Polo kinase: The choreographer
of the mitotic stage? J Cell Biol 135:1681–1684.
Glover DM, Hagan IM, Tavares AA. 1998. Polo-like kinases: A team
that plays throughout mitosis. Genes Dev 1224:3777–3787.
Golsteyn RM, Schultz SJ, Bartek J, Ziemiecki A, Ried T, Nigg EA. 1994.
Cell cycle analysis and chromosomal localization of human Plk1, a
putative homologue of the mitotic kinases Drosophila polo and
Saccharomyces cerevisiae Cdc5. J Cell Sci 107:1509–1517.
Golsteyn RM, Mundt KE, Fry AM, Nigg EA. 1995. Cell cycle regulation
of the activity and subcellular localization of PLK 1, a human protein
kinase implicated in mitotic spindle function. J Cell Biol 129:1617–
1628.
Golsteyn RM, Lane HA, Mundt KE, Arnaud L, Nigg EA. 1996. The
family of polo-like kinases. Prog Cell Cycle Res 2:107–114.
Hamanaka R, Smith MR, O’Connor PM, Maloid S, Mihalic K, Spivak
JL, Longo DL, Ferris DK. 1995. Polo-like kinase is a cell cycleregulated
kinase activated during mitosis. J Biol Chem 8:21086–
21091.
Harlow E, Lane D. 1988. Antibodies. A laboratory mannual. Woodburg,
NY. Cold Spring Harbor Laboratory.
Hogan B, Constantini F, Lacy E. 1994. Manipulating the mouse
embryo: A laboratory manual. Plainview, NY: Cold Spring Habour
Press.

IDENTIFICATION OF POLO-LIKE KINASES IN PORCINE FIBROBLASTS 253
Holtrich U, Wolf G, Yuan J, Bereiter-Hahn J, Karn T, Weiler M,
Kauselmann G, Rehli M, Andreesen R, Kaufmann M, Kuhl D,
Strebhardt K. 2000. Adhesion induced expression of the serine/
threonine kinase Fnk in human macrophages. Oncogene 5:4832–
4839.
Hudson JW, Kozarova A, Cheung P, Macmillan JC, Swallow CJ, Cross
JC, Dennis JW. 2001. Late mitotic failure in mice lacking Sak, a pololike
kinase. Curr Biol 11:441–446.
Karaiskou A, Jessus C, Brassac T, Ozon R. 1999. Phosphatase 2A and
polo kinase, two antagonistic regulators of cdc25 activation and MPF
auto-amplification. J Cell Sci 112:3747–3756.
Kauselmann G, Weiler M, Wulff P, Jessberger S, Konietzko U, Scafidi
J, Staubli U, Bereiter-Hahn J, Strebhardt K, Kuhl D. 1999. The pololike
protein kinases Fnk and Snk associate with a Ca(2þ)- and
integrin-binding protein and are regulated dynamically with
synaptic plasticity. EMBO J 18:5528–5539.
Kotani S, Tugendreich S, Fujii M, Jorgensen PM, Watanabe N, Hoog C,
Hieter P, Todokoro K. 1998. PKA and MPF-activated polo-like kinase
regulate anaphase-promoting complex activity and mitosis progression.
Mol Cell 13:371–380.
Kues WA, Anger M, Carnwath JW, Paul D, Motlik J, Niemann H. 2000.
Cell cycle synchronization of porcine fetal fibroblasts: Effects of
serum deprivation and reversible cell cycle inhibitors. Biol Reprod
62:412–419.
Kumagai A, Dunphy WG. 1996. Purification and molecular cloning of
Plx1, a Cdc25-regulatory kinase from Xenopus egg extracts. Science
6:1377–1380.
Lake RJ, Jelinek WR. 1993. Cell cycle- and terminal differentiationassociated
regulation of the mouse mRNA encoding a conserved
mitotic protein kinase. Mol Cell Biol 13:7793–7801.
Lee CK, Piedrahita JA. 2002. Inhibition of apoptosis in serum starved
porcine embryonic fibroblasts. Mol Reprod Dev 62:106–112.
Lee KS, Grenfell TZ, Yarm FR, Erikson RL. 1998. Mutation of
the polo-box disrupts localization and mitotic functions of the
mammalian polo kinase Plk. Proc Natl Acad Sci USA 9516:9301–
9306.
Llamazares S, Moreira A, Tavares A, Girdham C, Spruce BA, Gonzalez
C, Karess RE, Glover DM, Sunkel CE. 1991. Polo encodes a protein
kinase homolog required for mitosis in Drosophila. Genes Dev 12A:
2153–2165.
Mundt KE, Golsteyn RM, Lane HA, Nigg EA. 1997. On the regulation
and function of human polo-like kinase 1 PLK1: Effects of overexpression
on cell cycle progression. Biochem Biophys Res Commun
2392:377–385.
Nigg EA. 1998. Polo-like kinases: Positive regulators of cell division
from start to finish. Curr Opin Cell Biol 106:776–783.
Nigg EA. 2001. Mitotic kinases as regulators of cell division and its
checkpoints. Nat Rev Mol Cell Biol 2:21–32.
Onishi A, Iwamoto M, Akita T, Mikawa S, Takeda K, Awata T, Hanada
H, Perry AC. 2000. Pig cloning by microinjection of fetal fibroblast
nuclei. Science 18:1188–1190.
Polejaeva IA, Chen SH, Vaught TD, Page RL, Mullins J, Ball S, Dai Y,
Boone J, Walker S, Ayares DL, Colman A, Campbell KH. 2000.
Cloned pigs produced by nuclear transfer from adult somatic cells.
Nature 407:86–90.
Qian YW, Erikson E, Li C, Maller JL. 1998. Activated polo-like kinase
Plx1 is required at multiple points during mitosis in Xenopus laevis.
Mol Cell Biol 187:4262–4271.
Qian YW, Erikson E, Maller JL. 1999. Mitotic effects of a constitutively
active mutant of the Xenopus polo-like kinase Plx1. Mol Cell Biol
19:8625–8632.
Roshak AK, Capper EA, Imburgia C, Fornwald J, Scott G, Marshall LA.
2000. The human polo-like kinase, PLK, regulates cdc2/cyclin B
through phosphorylation and activation of the cdc25C phosphatase.
Cell Signal 12:405–411.
Rubin H. 1998. Cell aging in vivo and in vitro. Mech Ageing Dev
100:209–210.
Smits VA, Klompmaker R, Arnaud L, Rijksen G, Nigg EA, Medema RH.
2000. Polo-like kinase-1 is a target of the DNA damage checkpoint.
Nat Cell Biol 29:672–676.
Tatusova TA, Madden TL. 1999. Blast 2 sequences, a new tool for
comparing protein and nucleotide sequences. FEMS Microbiol Lett
15:247–250.
Uchiumi T, Longo DL, Ferris DK. 1997. Cell cycle regulation of the
human polo-like kinase PLK promoter. J Biol Chem 4:9166–9174.
Wilmut I, Campbell KH. 1998. Quiescence in nuclear transfer. Science
11:1611.
Wolf G, Elez R, Doermer A, Holtrich U, Ackermann H, Stutte HJ,
Altmannsberger HM, Rubsamen-Waigmann H, Strebhardt K. 1997.
Prognostic significance of polo-like kinase PLK expression in nonsmall
cell lung cancer. Oncogene 14:543–549.
Wolf G, Hildenbrand R, Schwar C, Grobholz R, Kaufmann M, Stutte
HJ, Strebhardt K, Bleyl U. 2000. Polo-like kinase: A novel marker of
proliferation: Correlation with estrogen-receptor expression in
human breast cancer. Pathol Res Pract 196:753–759.
Yuan J, Horlin A, Hock B, Stutte HJ, Rubsamen-Waigmann H,
Strebhardt K. 1997. Polo-like kinase, a novel marker for cellular
proliferation. Am J Pathol 1165–1172.

Telomere length is reset during early
mammalian embryogenesis
Sonja Schaetzlein*, Andrea Lucas-Hahn † , Erika Lemme † , Wilfried A. Kues † , Martina Dorsch ‡ , Michael P. Manns*,
Heiner Niemann †§ , and K. Lenhard Rudolph* §
*Department of Gastroenterology, Hepatology, and Endocrinology, and ‡ Institute for Animal Science, Hannover Medical School, 30625 Hannover, Germany;
and † Institute for Animal Science, Mariensee, Federal Agricultural Research Center, Höltystrasse 10, D-31535 Neustadt, Germany
Communicated by Neal L. First, University of Wisconsin, Madison, WI, April 5, 2004 (received for review January 15, 2004)
The enzyme telomerase is active in germ cells and early embryonic
development and is crucial for the maintenance of telomere length.
Whereas the different length of telomeres in germ cells and
somatic cells is well documented, information on telomere length
regulation during embryogenesis is lacking. In this study, we
demonstrate a telomere elongation program at the transition from
morula to blastocyst in mice and cattle that establishes a specific
telomere length set point during embryogenesis. We show that
this process restores telomeres in cloned embryos derived from
fibroblasts, regardless of the telomere length of donor nuclei, and
that telomere elongation at this stage of embryogenesis is telomerase-dependent
because it is abrogated in telomerase-deficient
mice. These data demonstrate that early mammalian embryos have
a telomerase-dependent genetic program that elongates telomeres
to a defined length, possibly required to ensure sufficient
telomere reserves for species integrity.
The enzyme telomerase is active in germ cells and during early
embryogenesis (1–5) and is crucial for the maintenance of
telomere length and germ cell viability in successive generations
of a species (6, 7). Telomere shortening limits the regenerative
capacity of cells and is correlated with the onset of cancer, aging,
and chronic diseases (8–12). The segregation of telomere length
from one generation to the next seems to be essential for normal
development and well being in mammals. In line with this
hypothesis, telomere shortening in telomerase knockout
(mTERC/ ) mice is correlated with a variety of phenotypes
including impaired organ regeneration, chromosomal instability,
and cancer (9, 13–16).
Telomere length segregation is ensured by the active elongation
and maintenance program in germ cells. Mature germ cells
possess significantly longer telomeres compared to somatic cells
(17), possibly because of telomere elongation during germ cell
maturation (18). In contrast to telomere elongation in germ cells,
little is known about telomere length regulation during embryogenesis.
Establishment of telomere length during embryogenesis
could determine telomere reserves in newborns. In newborn
mice derived from crossbreeding of late generation mTERC/ mice and mTERC/ mice, telomere function is rescued correlating
with the elongation of critically short telomeres (19).
Similarly, mice derived from intercrosses of mouse strains with
different telomere lengths show a telomerase-dependent elongation
of those telomeres derived from the strain with shorter
telomeres (20, 21). These observations can be explained only if
the telomeres are elongated during embryogenesis. In line with
this hypothesis, studies on cloned mice and cattle have revealed
telomere length restoration of cloned animals even when senescent
fibroblasts had been used as the donor cells (22–25). In
contrast, cloned sheep derived from epithelial cells had shorter
telomeres than control animals (26). Telomere length rescue in
cloned animals seems to depend on the used donor cell type (27).
Alternatively, rather than telomere restoration during embryogenesis,
cloned animals may be derived from the selective
propagation of cells with enhanced telomere reserves during the
cloning process andor early embryonic development, which
would be consistent with the low efficiency of somatic cloning.
If telomere restoration in fact occurs during preimplantation
development, it remains to be investigated whether this restoration
is related to the cloning process itself or represents a
general mechanism during embryogenesis to ensure the presence
of adequate telomere reserves for species integrity. To test
whether telomere length is regulated during embryogenesis, we
have analyzed telomere length at different stages of bovine and
mouse early development employing embryos derived from
somatic nuclear transfer, in vitro production (in vitro maturation,
fertilization, and culture), and conventional breeding. Results
show that telomere length is determined at morula to blastocyst
transition by a telomerase-dependent mechanism. Telomere
elongation is restricted to this stage of development and restores
telomeres of fibroblast-derived cloned embryos to normal
length.
Methods
Quantitative Fluorescence in Situ Hybridization (Q-FISH) on Interphase
Nuclei. Q-FISH was performed on interphase nuclei as described
on nuclei of adult and fetal fibroblasts (11, 28). Nuclei were
isolated by cell lysis with 0.075 M KCl and fixed in glacial
methanolacetic acid (3:1). Bovine adult and fetal fibroblasts
and a human transformed kidney cell line (Phoenix cells, a gift
from Gary Nolan, Stanford University, Stanford, CA) were
analyzed in parallel with Q-FISH and Southern blotting to
validate Q-FISH data. Results correlated closely between the
two methods. To ensure linearity of the Q-FISH method,
telomere length of liver cells from different generations of
telomerase-deficient mice were analyzed by Q-FISH showing the
expected decrease in telomere length from one generation to the
other (data not shown).
Telomere Restriction Fragment (TRF) Length Analysis. TRF were
determined in skin biopsies and blood samples (WBC) of cloned
and conventionally produced cattle as well as bovine in vitro
matured oocytes (see below) and bovine semen as controls. TRF
length analysis was done as described in ref. 28. The mean TRF
length was calculated by measuring the signal intensity in 10 squares
covering the entire TRF smear. All calculations were performed
with PCBAS and EXCEL (Microsoft) computer programs.
Telomeric Repeat Amplification Protocol. To measure telomerase
activity in early embryos, a telomeric repeat amplification protocol
assay was performed with a TRAPeze telomerase detection
kit (Intergen, Purchase, NY) according to recommendations
of the manufacturer.
Abbreviations: Q-FISH, quantitative fluorescence in situ hybridization; TRF, telomere restriction
fragment.
§ To whom correspondence should be addressed. E-mail: niemann@tzv.fal.de or rudolph.
lenhard@mh-hannover.de.
© 2004 by The National Academy of Sciences of the USA
8034–8038 PNAS May 25, 2004 vol. 101 no. 21 www.pnas.orgcgidoi10.1073pnas.0402400101

In Vitro Production of Bovine Embryos. Bovine embryos were
produced as described in refs. 29 and 30. Briefly, viable cumulus–
oocyte complexes derived from abattoir ovaries were matured in
vitro in groups of 15–20 in 100 l of TCM-199 supplemented with
10 IU of pregnant mare serum gonadotropin and 5 IU of human
chorionic gonadotropin (Suigonan, Intervet, Tönisvorst, Germany)
and 0.1% BSA (Sigma, A7030) under silicone oil in a
humidified atmosphere composed of 5% CO2 in air at 39°C for
24 h. Matured cumulus–oocyte complexes were fertilized in vitro
employing 1 10 6 sperm per ml of frozenthawed semen from
one bull with proven fertility in in vitro fertilization (29) during
a 19-h coincubation under the same temperature and gas conditions
as described for in vitro maturation. Presumptive zygotes
were cultured up to the morula stage (day 6 after insemination)
or blastocyst stage (day 8 after insemination) in synthetic oviduct
fluid medium supplemented with BSA, in a mixture of 5% O2,
90% N2, and 5% CO2 (Air Products, Hattingen, Germany) in
modular incubator chambers (ICN).
In Vivo Production of Bovine Embryos. In vivo grown bovine embryos
were collected from superovulated donor animals inseminated with
semen from the same bull as used for in vitro fertilization. Morulae
and blastocysts were nonsurgically recovered from the genital tract
of donors employing established protocols at days 6 and 8 after
artificial insemination, respectively (31).
Generation of Nuclear Transfer-Derived Embryos. Bovine fetal fibroblasts
were obtained from a 61-day female bovine fetus after
evisceration and decapitation. Adult fibroblasts were established
from ear skin biopsies of an adult female animal collected from a
local abattoir. The fibroblasts used for nuclear transfer in these
experiments were from passages 2–4 and were induced to enter a
period of quiescence (presumptive G0) by serum starvation for 2–3
days (0.5% FCS). Donor cells and cloned animals showed an
identical microsatellite pattern (not shown). For enucleation and
nuclear transfer, cytochalasin B (7.5 gml) was added to TCM-air.
For fusion, 0.285 M mannitol containing 0.1 mM MgSO4 and 0.05%
BSA was used. Embryos were reconstructed, and cloned offspring
were produced as described in ref. 32. Briefly, in vitro matured
oocytes were enucleated by aspirating the first polar body and the
metaphase II plate. The donor cells were pelleted and resuspended
in TCM-air and remained in this medium until insertion. A single
cell was sucked into a 30-m (outer diameter) pipette and was then
carefully transferred into the perivitelline space of the recipient
oocyte. Cell fusion was induced with 1–2 DCpulsesof0.7kVcm
for 30 s each generated by a Kruess electrofusion machine (CFA
400, Hamburg, Germany). At 27 h after onset of maturation, the
reconstructed embryos were chemically activated by incubation in
5 M ionomycin (Sigma) in TCM-199 for 5 min followed by a 3–4-h
incubation in 2 mM 6-dimethylaminopurine (Sigma) in TCM-199 at
37°C. After three washes, the embryos were cultured for 6 (morulae)
or 8 (blastocysts) days as described above. Morulae and
blastocysts were used in Q-FISH for determination of telomere
length.
Production of Mouse Embryos. Wild-type and telomerase knockout
(mTERC / , generation 2) females were killed on days 3
(eight-cell and morula stage) or 4 (blastocyst stage) of pregnancy.
Day 0.5 is the morning after insemination. The embryos
were collected from the oviducts or the uterus as described (33).
Statistical Programs. Student’s t test and GRAPHPAD INSTAT software
were used to calculate statistical significances and standard
deviations.
Lucas-Hahn, A., Lemme, E., Hadeler, K. G., Sander, H. G. & Niemann, H. (2002) Theriogenology
57, 433 (abstr.).
Fig. 1. Telomere length analysis of bovine germ cells and primary fibroblasts
used for cloning. (A) Distribution of the mean telomere length as determined
by Q-FISH in different nuclei of adult fibroblasts (total mean, 10.84 5.73 kb;
n 118), (B) fetal fibroblasts (total mean, 14.61 4.58 kb; n 40), and (C)
oocytes (total mean, 16.95 2.51 kb; n 13). (D and E) The length of TRFs was
determined by Southern blotting on DNA of bovine fetal fibroblasts, adult
fibroblasts, and semen. (D) Histogram on the mean value of TRF length as
determined in triplicate. Telomere length was significantly shorter in both
fibroblast cell lines (adult fibroblasts, 12.03 0.46 kb; fetal fibroblasts, 13.37
0.46 kb) used for cloning compared to bovine semen (15.83 0.41 kb) used for
in vivo or in vitro fertilization. (E) Representative radiograph of a Southern
blot showing the TRF smear of adult bovine fibroblasts and semen. Dotted line
in A–C indicates mean value.
All experiments were conducted according to the German
animal welfare law and comply with international regulations.
Results
Telomere Length in Bovine Preimplantation Embryos at the Morula
and Blastocyst Stage. We analyzed telomere length regulation
during early embryogenesis in bovine embryos and animals derived
from cloning or conventional production to elucidate whether the
embryo has a defined telomere-elongation program. Q-FISH (Fig.
1 A–C) and Southern blot (Fig. 1E) analysis revealed significantly
shorter telomeres in both adult and fetal fibroblasts that had been
used for somatic nuclear transfer compared to bovine oocytes and
semen serving as controls (Fig. 1 C and E). The telomere length of
the adult fibroblasts was shorter than that of fetal fibroblasts (Fig.
1 A, B, and D). Telomere length was analyzed in morula stages,
which are known to be telomerase negative or to possess minimum
telomerase activity (3–5). Q-FISH analysis revealed significantly
shorter mean telomeres in cloned morulae compared to their
counterparts derived from in vivo or in vitro fertilization (Fig. 2).
The finding of similar telomere lengths in morulae derived from in
vivo and in vitro fertilization ruled out the possibility that the in vitro
culture per se had a significant effect on telomere length (Fig. 2 A,
Schaetzlein et al. PNAS May 25, 2004 vol. 101 no. 21 8035
DEVELOPMENTAL
BIOLOGY

Fig. 2. Telomere length of cloned and fertilized bovine morulae by Q-FISH.
(A–D). Distribution of mean telomere length over all analyzed nuclei of
morulae (day 6 of embryonic development) derived from in vivo fertilization
(n 234) (A), in vitro fertilization (n 118) (B), cloning from adult bovine
fibroblasts (n 203) (C), and cloning from fetal bovine fibroblasts (n 134)
(D). (E) Mean value of the mean telomere lengths determined for individual
morulae derived by cloning from fetal fibroblasts (8.71 1.81 kb, n 8) or
adult fibroblasts (9.47 2.07 kb, n 6) from in vivo fertilization (12.42 1.37
kb, n 7) or in vitro fertilization (14.36 2.67 kb, n 4). The difference in
telomere length between morulae derived from in vivo and in vitro fertilization
was not significant. Dotted line in A–D indicates mean value.
B, and E). Telomeres were shorter in all groups of morulae
compared to donor cells or germ cells, indicating that there was no
significant selection in favor of cells with longer telomere reserves
during the cloning process.
Next, telomere lengths were analyzed in blastocysts derived from
in vitro fertilization or somatic cloning. In all groups, blastocysts had
significantly elongated telomeres relative to those at the morula
stage (Fig. 3), indicating that telomeres are elongated at this
particular stage of bovine embryogenesis. Similarly, a sequential
analysis of telomere length in embryos derived from a single in vitro
fertilization experiment showed significant telomere elongation in
Fig. 3. Telomere length of cloned and fertilized bovine blastocysts by
Q-FISH. (A) Representative photographs of telomere spots in nuclei of blastocysts
(day 8 of development) derived from cloning of adult and fetal
fibroblasts and in vitro fertilization. Magnification bar, 20 m. (B–D) Distribution
of mean telomere length over all analyzed nuclei of blastocysts derived
from in vitro fertilization (n 129) (B), cloning from fetal bovine fibroblasts
(n 192) (C), and cloning from adult bovine fibroblasts (n 126) (D). (E) Mean
value of the mean telomere lengths determined for individual blastocysts
derived from in vitro fertilization (19.53 4.6 kb, n 6) and from cloning
using fetal fibroblasts (17.3 2.66 kb, n 6) and adult fibroblasts (21.67 3.92
kb, n 5). Note that telomeres were elongated in all groups compared to the
morula stage and that in contrast to the differences in telomere length at the
morula stage, there was no significant difference between the different
groups of blastocysts. (F) A sequential analysis of telomere length in embryos
derived from a single in vitro fertilization experiment showed telomere
elongation at the morula–blastocyst transition, with an average of 15.8 3.1
kb for morula stages (n 6) and 28.7 7.4 kb for blastocyst stages (n 6).
Dotted line in B–D indicates mean value.
embryos of an identical genetic background at the morula–
blastocyst transition (Fig. 3F). In accordance with previous studies,
we did not detect telomerase activity at the morula stage. In
contrast, a strong up-regulation of telomerase was observed at the
blastocyst stage (3–5), indicating that telomere elongation correlated
with the timing of telomerase reactivation during embryogenesis.
Telomere lengths of bovine blastocysts were similar regardless
of whether they were derived from somatic cloning or in
vitro fertilization (Fig. 3). These data provide experimental evidence
for an embryo-specific telomere elongation program, which
leads to restoration of telomere length in both cloned embryos and
embryos produced by in vivo or in vitro fertilization.
In line with these observations, telomere length analysis on 1- to
2-year-old cloned cattle derived from fetal or adult donor cells
revealed a similar telomere length when measured in WBC or ear
biopsies compared to those of age-matched control animals (data
not shown). Because WBC are derived from the telomerasepositive
hematopoietic compartment, these data indicate that telomere
elongation in cloned cattle is restricted to a defined stage of
embryogenesis and does not result in abnormally long telomeres in
telomerase-positive compartments. The telomere length of WBC
and ear biopsies was comparable between clones derived from adult
or fetal fibroblasts, indicating that the cell source did not significantly
affect telomere length in the cloned offspring.
Telomere Elongation During Early Mouse Embryogenesis Is Telomerase-Dependent.
To test whether the observed telomere elongation
is a general mechanism in mammalian development and whether it
8036 www.pnas.orgcgidoi10.1073pnas.0402400101 Schaetzlein et al.

Fig. 4. Telomere length in embryos from mTERC / and mTERC / mice by
Q-FISH. (A) The distribution of mean telomere fluorescence units (fu) of all
analyzed nuclei from wild-type embryos at the 8-cellmorula stage (1118 484
fu, n 274) and at the blastocyst stage (1501 753 fu, n 681). (B) Mean value
of the mean telomere fluorescence intensity determined for individual embryos
at the 8-cellmorula stage (1,066 406 fu, n 32) and at the blastocyst stage
(1,350 565 fu, n31). (C) The distribution of mean telomere fu of all nuclei from
telomerase knockout embryos (mTERC / ) at the 8-cellmorula stage (1,060
503 fu, n 96) and at the blastocyst stage (949 388 fu, n 199). (D) Mean value
of the telomere fluorescence intensity determined for individual embryos at the
8-cellmorula stage (995 356 fu, n 14) and at the blastocyst stage (877 348
fu, n 10). Note that mTERC / embryos showed telomere elongation at morulablastocyst
transition, whereas embryos from telomerase-deficient mice
(mTERC / ) did not show a lengthening of telomeres but rather a slight decrease
in telomere length. (E and F) Representative photographs of telomere spots in
nuclei of mTERC / (E) and mTERC / (F) embryo at 8-cell stagemorula and
blastocyst stage of embryonic development. Magnification bar, 10 m. (G) Mean
value of the telomere fluorescence intensity determined for individual embryos
at the 8-cellmorula stage, blastocyst stage, day 8.510.5 (1,329 353 fu, n 5),
and day 13.5 (1,573 133 fu, n 5). Analysis revealed no significant increase in
telomere length at these postimplantation stages (P 0.05). Dotted line in A and
C indicates mean value.
is telomerase-dependent, we analyzed telomere length in early
embryogenesis of mTERC / and mTERC / mice. In agreement
with the findings from bovine embryos, the telomeres of
mTERC / embryos were significantly elongated at the blastocyst
stage compared to morulae and 8-cell stages (Fig. 4 A, B, and E).
1. Mantell, L. L. & Greider, C. W. (1994) EMBO J. 13, 3211–3217.
2. Wright, W. E., Piatyszek, M. A., Rainey, W. E., Byrd, W. & Shay, J. W. (1996)
Dev. Genet. 18, 173–179.
3. Xu, J. & Yang, X. (2000) Biol. Reprod. 63, 1124–1128.
4. Wright, D. L., Jones, E. L., Mayer, J. F., Oehninger, S., Gibbons, W. E. &
Lanzendorf, S. E. (2001) Mol. Hum. Reprod. 7, 947–955.
In contrast, in mTERC / embryos, telomeres were not elongated
during the morula–blastocyst transition (Fig. 4 C, D, and F),
indicating that telomerase activity is required for telomere elongation
at this stage of embryogenesis. To determine whether telomere
elongation is restricted to the morula–blastocyst transition or is a
continuous process during early development, we analyzed telomere
length of primary cultures of adherent growing cells derived
from embryos at days 8.5 (Theiler’s stage 13), 10.5 (Theiler’s stage
17), and 13.5 of mouse embryogenesis. Analysis revealed no
significant increase in telomere length at these postimplantation
stages compared with length at the morula–blastocyst transition
(Fig. 4G), indicating that telomere elongation during embryogenesis
is restricted to the morula–blastocyst transition.
Discussion
The discovery of telomere elongation at the morula–blastocyst
transition in embryos from two mammalian species as well as
embryos derived from either in vivo or in vitro fertilization and
even somatic nuclear transfer indicates a general program in
preimplantation development. Morula–blastocyst transition is a
critical step in preimplantation development, leading to first
differentiation into two cell lineages, the inner cell mass and the
trophoblast. This coincides with a dramatic change in morphology
from the compacted morula to the cavity-filled blastocyst
stage and is associated with massive changes in embryonic gene
expression (32). Our study shows that telomeres of cloned
embryos derived from fetal or adult fibroblasts are normalized
by the telomere elongation program at the morula–blastocyst
transition, indicating that this program resets telomere length to
a specific set point. Fibroblasts are a predominantly used donor
cell type in somatic nuclear transfer in farm animals. It remains
to be determined why telomere length in cloned embryos derived
from epithelial cell lines is not always restored (27).
Telomeres are not elongated in mTERC / mouse embryos,
indicating that the telomerase enzyme is required for telomere
elongation during early embryogenesis. These data coincide with
previous reports on haploinsufficiency of the telomerase RNA
component (TERC) in mTERC / mice, leading to offspring from
intercrosses of mouse strains with different telomere lengths (20,
21). However, because telomerase activation alone does not necessarily
result in telomere elongation in vitro (34), other factors such
as telomere binding proteins could be involved in telomere length
regulation at this stage of embryogenesis (35). Interestingly, the
telomere elongation program discovered in the present study
correlates with activation of telomerase at the same stage of human
embryogenesis (4). In bovine-cloned and parthenogenetic embryos,
telomerase activity followed the same pattern with a significant
up-regulation at the blastocyst stage (36). Telomere elongation
during embryogenesis could be critical to ensure normal telomere
length segregation from one generation to the next and could have
direct effects on regeneration, aging, and carcinogenesis during
postnatal life. A detailed understanding of this embryonic telomere-elongation
program could ultimately be important for the
use of cell transplantation and gene therapy approaches for the
treatment of degenerative disorders.
We thank Ande Satyanarayana for critical discussion and K.-G. Hadeler
for artificial insemination and bovine embryo flushing. Parts of this study
were supported through funding from the Deutsche Forschungsgemeinschaft
(Ni 25618-1). K.L.R. is supported by the Emmy–Noether Program
of the Deutsche Forschungsgemeinschaft (Ru 7452-1) and the
Deutsche Krebshilfe e.V. (10-1809-Ru1).
5. Betts, D. H. & King, W. A. (1999) Dev. Genet. 25, 397–403.
6. Hemann, M. T., Rudolph, K. L., Strong, M. A., DePinho, R. A., Chin, L. &
Greider, C. W. (2001) Mol. Biol. Cell 12, 2023–2030.
7. Liu, L., Blasco, M., Trimarchi, J. & Keefe, D. (2002) Dev. Biol. 249, 74–84.
8. Djojosubroto, M. W., Choi, Y. S., Lee, H. W. & Rudolph, K. L. (2003) Mol.
Cells 15, 164–175.
Schaetzlein et al. PNAS May 25, 2004 vol. 101 no. 21 8037
DEVELOPMENTAL
BIOLOGY

9. Rudolph, K. L., Chang, S., Lee, H. W., Blasco, M., Gottlieb, G. J., Greider, C.
& DePinho, R. A. (1999) Cell 96, 701–712.
10. Rudolph, K. L., Millard, M., Bosenberg, M. W. & DePinho, R. A. (2001) Nat.
Genet. 28, 155–159.
11. Satyanarayana, A., Wiemann, S. U., Buer, J., Lauber, J., Dittmar, K. E.,
Wustefeld, T., Blasco, M. A., Manns, M. P. & Rudolph, K. L. (2003) EMBO
J. 22, 4003–4013.
12. Cawthon, R. M., Smith, K. R., O’Brien, E., Sivatchenko, A. & Kerber, R. A.
(2003) Lancet 361, 393–395.
13. Rudolph, K. L., Chang, S., Millard, M., Schreiber-Agus, N. & DePinho, R. A.
(2000) Science 287, 1253–1258.
14. Lee, H., Blasco, M., Gottlieb, G., Horner, J. N., Greider, C. & DePinho, R.
(1998) Nature 392, 569–574.
15. Artandi, S. E., Chang, S., Lee, S. L., Alson, S., Gottlieb, G. J., Chin, L. &
DePinho, R. A. (2000) Nature 406, 641–645.
16. Samper, E., Flores, J. & Blasco, M. (2001) EMBO Rep. 2, 800–807.
17. de Lange, T., Shiue, L., Myers, R. M., Cox, D. R., Naylor, S. L., Killery, A. M.
& Varmus, H. E. (1990) Mol. Cell. Biol. 10, 518–527.
18. Achi, M. V., Ravindranath, N. & Dym, M. (2000) Biol. Reprod. 63, 591–598.
19. Hemann, M. T., Strong, M. A., Hao, L. Y. & Greider, C. W. (2001) Cell 107, 67–77.
20. Hathcock, K. S., Hemann, M. T., Opperman, K. K., Strong, M. A., Greider,
C. W. & Hodes, R. J. (2002) Proc. Natl. Acad. Sci. USA 99, 3591–3596.
21. Zhu, L., Hathcock, K. S., Hande, P., Lansdorp, P. M., Seldin, M. F. & Hodes,
R. J. (1998) Proc. Natl. Acad. Sci. USA 95, 8648–8653.
22. Wakayama, T., Shinkai, Y., Tamashiro, K. L., Niida, H., Blanchard, D. C.,
Blanchard, R. J., Ogura, A., Tanemura, K., Tachibana, M., Perry, A. C., et al.
(2000) Nature 407, 318–319.
23. Tian, X. C., Xu, J. & Yang, X. (2000) Nat. Genet. 26, 272–273.
24. Betts, D., Bordignon, V., Hill, J., Winger, Q., Westhusin, M., Smith, L. & King,
W. (2001) Proc. Natl. Acad. Sci. USA 98, 1077–1082.
25. Lanza, R. P., Cibelli, J. B., Blackwell, C., Cristofalo, V. J., Francis, M. K.,
Baerlocher, G. M., Mak, J., Schertzer, M., Chavez, E. A., Sawyer, N., et al.
(2000) Science 288, 665–669.
26. Shiels, P. G., Kind, A. J., Campbell, K. H., Waddington, D., Wilmut, I., Colman,
A. & Schnieke, A. E. (1999) Nature 399, 316–317.
27. Miyashita, N., Shiga, K., Yonai, M., Kaneyama, K., Kobayashi, S., Kojima, T.,
Goto, Y., Kishi, M., Aso, H., Suzuki, T., et al. (2002) Biol. Reprod. 66,
1649–1655.
28. Wiemann, S. U., Satyanarayana, A., Tsahuridu, M., Tillmann, H. L., Zender,
L., Klempnauer, J., Flemming, P., Franco, S., Blasco, M. A., Manns, M. P. &
Rudolph, K. L. (2002) FASEB J. 16, 935–942.
29. Wrenzycki, C., Herrmann, D., Keskintepe, L., Martins, A., Jr., Sirisathien, S.,
Brackett, B. & Niemann, H. (2001) Hum. Reprod. 16, 893–901.
30. Eckert, J. & Niemann, H. (1995) Theriogenology 43, 1211–1225.
31. Bungartz, L. & Niemann, H. (1994) J. Reprod. Fertil. 101, 583–591.
32. Niemann, H., Wrenzycki, C., Lucas-Hahn, A., Brambrink, T., Kues, W. A. &
Carnwath, J. W. (2002) Cloning Stem Cells 4, 29–38.
33. Hogan, B., Beddington, R., Costantini, F. & Lacy, E. (1994) Manipulating the
Mouse Embryo (Cold Spring Harbor Lab. Press, Plainview, NY).
34. Zhu, J., Wang, H., Bishop, J. M. & Blackburn, E. H. (1999) Proc. Natl. Acad.
Sci. USA 96, 3723–3728.
35. Loayza, D. & De Lange, T. (2003) Nature 424, 1013–1018.
36. Xu, J. & Yang, X. (2001) Biol. Reprod. 64, 770–774.
8038 www.pnas.orgcgidoi10.1073pnas.0402400101 Schaetzlein et al.

Review TRENDS in Biotechnology Vol.22 No.6 June 2004
The contribution of farm animals to
human health
Wilfried A. Kues and Heiner Niemann
Department of Biotechnology, Institut für Tierzucht, Mariensee, D-31535 Neustadt, Germany
Farm animals and their products have a longstanding
and successful history of providing significant contributions
to human nutrition, clothing, facilitation of
labour, research, development and medicine and have
thus been essential in improving life expectancy and
human health. With the advent of transgenic technologies
the potential of farm animals for improving
human health is growing and many areas remain to be
explored. Recent breakthroughs in reproductive technologies,
such as somatic cloning and in vitro embryo
production, and their merger with molecular genetic
tools, will further advance progress in this field. Here,
we have summarized the contribution of farm animals
to human health, covering the production of antimicrobial
peptides, dietary supplements or functional foods,
animals used as disease models and the contribution of
animals to solving urgent environmental problems and
challenges in medicine such as the shortage of human
cells, tissues and organs and therapeutic proteins.
Some of these areas have already reached the level of
preclinical testing or commercial application, others
will be further advanced only when the genomes of the
animals concerned have been sequenced and annotated.
Provided the necessary precautions are being
taken, the transmission of pathogens from animals to
humans can be avoided to provide adequate security.
Overall, the promising perspectives of farm animals and
their products warrant further research and development
in this field.
Farm animals have made significant contributions to
human health and well-being throughout mankind’s
history. The pioneering work of Edward Jenner with
cowpox in the 18th century paved the way for modern
vaccination programs against smallpox, as well as other
human and animal plagues. To date, more than 250 million
people have benefited from drugs and vaccines produced
by recombinant technologies in bacteria and various types
of mammalian cells and many more will benefit in the
future (New Medicines in Development for Biotechnology,
2002; www.phrma.org/newmedicines/biotech/). Further
examples of the significant contribution of farm animals
to human health are the longstanding use of bovine and
porcine insulin for treatment of diabetes as well as horse
antisera against snake venoms and antimicrobial peptides.
In addition, farm animals are models for novel
surgical strategies, testing of biodegradable implants and
sources of tissue replacements, such as skin and heart
valves.
Progress in transgenic technologies has allowed the
generation of genetically modified large animals for
applications in agriculture and biomedicine, such as the
production of recombinant proteins in the mammary gland
and the generation of transgenic pigs with expression of
human complement regulators in xenotransplantation
research [1]. Further promising application perspectives
will be developed when somatic cloning with genetically
modified donor cells is further improved and the genomes
of farm animals are sequenced and annotated. The first
transgenic livestock were born less than 20 years ago with
the aid of microinjection technology [2]. Recently the first
animals with knockout of one or even two alleles of a
targeted gene were reported (Table 1). Somatic nuclear
transfer has been successful in 10 species, but the overall
Table 1. Milestones (live offspring) in transgenesis and reproductive technologies in farm animals
Year Milestone Strategy Refs
1985 First transgenic sheep and pigs Microinjection of DNA into one pronucleus of a zygote [2]
1986 Embryonic cloning of sheep Nuclear transfer using embryonic cells as donor cells [91]
1997 Cloning of sheep with somatic donor cells Nuclear transfer using adult somatic donor cells [92]
1997 Transgenic sheep produced by nuclear transfer Random integration of the construct [93]
1998 Transgenic cattle produced from fetal fibroblasts and nuclear transfer Random integration of the construct [94]
1998 Generation of transgenic cattle by MMLV injection Injection of oocytes with helper viruses [95]
2000 Gene targeting in sheep Gene replacement and nuclear transfer [96]
2002 Trans-chromosomal cattle Additional artificial chromosome [15]
2002 Heterozygous knockout in pigs One allele of a-galactosyl-transferase knocked out [34,35]
2003 Homozygous gene knockout in pigs Both alleles of a-galactosyl-transferase knocked out [36]
2003 Transgenic pigs via lentiviral injection Gene transfer into zygotes via lentiviruses [97]
Corresponding author: Heiner Niemann (niemann@tzv.fal.de).
www.sciencedirect.com 0167-7799/$ - see front matter q 2004 Elsevier Ltd. All rights reserved. doi:10.1016/j.tibtech.2004.04.003

Review TRENDS in Biotechnology Vol.22 No.6 June 2004 287
Table 2. Efficiency of somatic cloning of mammals
Species Number of animals a
% Viable offspring Comments
Cattle ,3000 15–20 Up to 30% of the cloned calves showed abnormalities, such as increased birth weight
Sheep ,400 5–8 Same problems as with cattle clones
Goat ,400 3 Minor health problems reported
Mouse ,300 ,2 Some adult mice clones showed obesity and a reduced life span
Pig ,200 ,1 Some cloned piglets had reduced birth weights
Cat 1 ,1
Rabbit 6 ,1
Mule 1 ,1
Horse 1 ,1
Rat 2 ,1
a Estimated total numbers of mammals derived from somatic cloning since 1997.
efficiency is low and few cloned offspring have been born
worldwide (Table 2). Compared with microinjection of
DNA constructs into pronuclei of zygotes, somatic nuclear
transfer is superior for the generation of transgenic
animals (Table 3).
Here, we have summarized the contribution of farm
animals to human health covering (i) the production of
pharmaceuticals; (ii) production of xenografts for overcoming
the severe shortage of human organs and tissues;
(iii) the use of farm animals as disease models; (iv) the
production of dietary supplements or functional foods; and
(v) the contribution of farm animals to solving environmental
problems.
Farm animals for pharmaceutical production
Gene ‘pharming’: production of recombinant human
proteins in the mammary gland of transgenic animals
The conventional production of rare human therapeutic
proteins from blood or tissue extracts is an inefficient,
expensive, labour and time consuming process, which in
addition bears the risk of contamination with human
pathogens. The production of human therapeutic proteins
by recombinant bacteria or cell cultures has alleviated
these problems and has made several therapeutic proteins
available for patients. However, these recombinant systems
have several limitations. They are only suitable for
‘simple’ proteins, the amount of protein produced is
limited, and post-translational modifications are often
incorrect leading to immune reactions against the protein.
In addition, the technical prerequisites are challenging
and production costs are high.
Farm animals such as cattle, sheep, goats, pigs and
even rabbits [3,4] have several significant advantages for
the production of recombinant proteins over other systems,
including their potential for large-scale production,
Table 3. Advantages and disadvantages of two gene transfer methodologies a
correct glycosylation patterns and post-translational
modifications, low running costs, rapid propagation of
the transgenic founders and high expression stability.
These attractive perspectives led to the development of the
‘gene pharming’ concept, which has been advanced to the
level of commercial application [5]. The most promising
site for production of recombinant proteins is the mammary
gland, but other body fluids including blood, urine
and seminal fluid have also been explored [6]. The
mammary gland is the preferred production site mainly
because of the quantities of protein that can be produced
and the ease of extraction or purification of the respective
protein.
Based on the assumption of average expression levels,
daily milk volumes and purification efficiency, 5400 cows
would be needed to produce the 100 000 kg of human
serum albumin (HSA) that are required per year worldwide,
4500 sheep would be required for the production of
5000 kg a-antitrypsin (a-AT), 100 goats for 100 kg of
monoclonal antibodies, 75 goats for the 75 kg of antithrombin
III (ATIII) and two pigs to produce 2 kg human
clotting factor IX. All these values are calculated on a
yearly basis [3].
Large amounts of numerous heterologous recombinant
proteins have been produced by targeting expression to the
mammary gland via mammary gland-specific promoter
elements. Proteins were purified from the milk of
transgenic rabbits, pigs, sheep, goats and cattle. The
biological activity of the recombinant proteins was
assessed and therapeutic effects have been characterized
[3,7]. Products such as ATIII, a-AT or tissue plasminogen
activator (tPA) are advanced to clinical trials (Table 4) [5].
Phase III trials for ATIII have been completed and the
protein is expected to be on the market within the next 2–3
years. In February 2004 an application was submitted to
Microinjection Somatic nuclear transfer
Integration efficiency þ þþþ
Integration site Random Random or targeted
Gene deletion 2 þþþ
Construction size .50 kb (Artificial chromosomes) , 30–50 kb
Technical feasibility Technically demanding Technically demanding
Mosaicism þþþ 2
Expression screen in vitro þ þþþ
Expression pattern Variable Controlled, consistent
Multi-transgenics þ þþþ
a Abbreviations: 2, not possible; þ, weak advantage; þþ, moderate advantage; þþþ, strong advantage
www.sciencedirect.com

288
Table 4. Proteins produced in the mammary gland of transgenic farm animals a
Protein Developmental phase Production species Therapeutic application Potential market introduction date
AT III Phase III Goat Genetic heparin resistance 2005
TPA Phase II/III Goat Dissolving coronary clots . 2006
a-AT Phase II/III Goat and/or sheep Lung emphysema
Cystic fibrosis
. 2007
hFVIII Experimental Sheep Hemophilia A . 2008
HAS Phase I Cattle Blood substitute . 2008
Various antibodies Phase I/II Goat . 2007
a Abbreviations: a-AT, a-A1-antitrypsin; AT III, antithrombin III; hFVIII, human clotting factor VIII; HSA, human serum albumin; TPA, tissue plasminogen activator
the European Market Authorization to allow Atrynw, the
recombinant ATIII from the milk of transgenic dairy goats,
to enter the market as a fully registered drug. The enzyme
a-glucosidase from the milk of transgenic rabbits has
Orphan drug registration and has been successfully used
for the treatment of Pompe’s disease [8]. This is a rare
glycogen storage disorder, which is fatal in children under
2 years and currently application with recombinant
a-glucosidase is the only way to treat this metabolic defect.
Biologically active human lactoferrin has been produced in
large amounts in the mammary glands of transgenic cows
and will probably be developed as a biopharmaceutical for
prophylaxis and treatment of infectious diseases [9].
Guidelines developed by the Food and Drug Administration
(FDA) of the USA require monitoring of the
animals’ health, validation of the gene construct, characterization
of the isolated recombinant protein, as well as
performance of the transgenic animals over several
generations. This has been taken into account when
developing ‘gene pharming’, for example by using only
animals from prion disease-free countries (New Zealand)
and keeping the animals in very hygienic conditions.
Successful drug registration of Atrynw will demonstrate
the usefulness and solidity of this approach and will
accelerate registration of further products from this
process, as well as stimulate research and commercial
activity in this area.
When considering the ‘gene pharming’ concept, one has
to bear in mind that not every protein can be expressed at
the desired levels. Erythropoietin (EPO) could not be
expressed in the mammary gland of transgenic cattle [10]
and was even detrimental to the health of rabbits
transgenic for EPO [11]. We have shown that human
clotting factor VIII (hFVIII) cDNA constructs can be
expressed in the mammary gland of transgenic mice,
rabbits and sheep [1,12]. However, the yields of biologically
active recombinant hFVIII protein from ovine milk were
low because hFVIII was rapidly sequestered into ovine
milk. [13]. These results show that the technology needs
further improvements to achieve high-level expression
with large genes having complex regulation, such as that
coding for hFVIII, although higher levels of hFVIII have
been reported in transgenic swine [14]. With the advent of
transgenic crops that produce pharmacologically active
proteins, there is an array of recombinant technologies
available that will allow the most appropriate production
system for a specific protein to be targeted.
An interesting new development is the generation of
transchromosomal animals (Table 1). A human artificial
www.sciencedirect.com
Review TRENDS in Biotechnology Vol.22 No.6 June 2004
chromosome (HAC) containing the entire sequences of
the human immunoglobulin heavy and light chain loci
has been introduced into bovine fibroblasts, which
were then used in nuclear transfer. Transchromosomal
offspring were obtained that expressed human
immunoglobulin in their blood. This system could be
a significant step forward in the production of human
therapeutic polyclonal antibodies [15]. Further studies
will show whether the additional chromosome will be
maintained over future generations and how stable
expression will be.
Production of a new class of antibiotics: cationic antimicrobial
peptides
With increasing antibiotic resistance in bacterial species,
there is a growing need to develop new classes of antimicrobial
agents. Cationic anti-microbial peptides (AMP)
have many of the desired features [16] because they
possess a broad spectrum of activity, kill gram-positive and
gram-negative bacteria rapidly, are unaffected by classical
resistance genes and are active in animal models [17–19].
AMPs belong to the innate immune defense, which acts as
a first barrier ahead of humoral and cellular immune
systems, and neutralizes bacteria by interacting specifically
with their cell membranes. Their low transmembrane
potential of ,-100 mV, and the abundant anionic
phospholipids are essential for this selective interaction. It
is proposed that AMPs physically disintegrate the cell
membrane, and in addition can interact with several
intracellular target molecules [16]. More than 500 such
peptides have been discovered in plants, insects, invertebrates,
fish, amphibians, birds and mammals [16–20].
AMPs from livestock species would be superior antimicrobial
drugs because they would lack cytotoxic effects
that were found for insect peptides; the evolution of
resistance would not affect the human specific innate
immunity [20].
Prominent examples of cationic anti-microbial peptides
from farm animals already in advanced clinical trials
(Phases II–III) are Iseganan (derived from protegrin-1
peptide of pig leucocytes; Intrabiotics; http://intrabiotics.
com/) and MBI-594 (similar to indolicidin peptide from
bovine neutrophils; Micrologix, http://mbiotech.com/). To
date, there are no documented cases of antimicrobial
peptide-resistance for AMPs and combinatorial
approaches in peptides (20 possible amino acids in each
position) provide great potential for rational drug design
[21]. Recombinant production will keep the production
costs low.

Xenotransplantation of porcine organs to human
patients
Solid organs
Today .250 000 people are alive only because of the
successful transplantation of an appropriate human organ
(allotransplantation). On average, 75–90% of patients
survive the first year after transplantation and the
average survival of a patient with a transplanted heart,
liver or kidney is 10–15 years. This progress in organ
transplantation technology has led to an acute shortage of
appropriate organs, and cadaveric or live organ donation
cannot cover the demand in western societies. The 2001
figures from the United Network for Organ Sharing (www.
unos.org) in the USA show that the ratio of patients with
organ transplantation to those on the waiting list is ,1:4
(Table 5). A similar ratio is found in other countries such as
the UK, France and Germany. A new person is added to the
waiting list every 14 minutes. This has led to the sad and
ethically challenging situation in which several thousand
patients who could have survived if appropriate organs
had been available die every year.
To close the growing gap between demand and
availability of appropriate organs, porcine xenografts are
considered the solution of choice [22,23]. Today the
domesticated pig is considered the optimal donor animal
because (i) the organs are similar in size to human organs;
(ii) porcine anatomy and physiology are not too different
from that of humans; (iii) pigs have short reproduction
cycles and large litters; (iv) pigs grow rapidly;
(v) maintenance of high hygienic standards is possible at
relatively low costs; and (vi) transgenic techniques for
modifying the immunogenicity of porcine cells and organs
are well established.
The process of generating and evaluating transgenic
pigs as potential donors for xenotransplants involves a
variety of complex steps and is time-, labour- and resourceintensive.
Essential prerequisites for successful xenotransplantation
are:
(i) Overcoming the immunological hurdles.
(ii) Prevention of transmission of pathogens from the
donor animal to the human recipient.
(iii) Compatibility of the donor organs with the human
organ in terms of anatomy and physiology.
The immunological obstacles in a porcine-to-human
xenotransplantation are the hyperacute rejection
response (HAR), acute vascular rejection (AVR), cellular
rejection and potentially chronic rejection [24]. The HAR
Table 5. Overview of transplanted organs and demand for
organ transplantation (USA) a
Type of transplant Transplantations in 2001 Waiting patients
Kidney 14 152 52 772
Liver 5177 17 520
Pancreas 468 1318
Kidney/Pancreas 884 2520
Heart 2202 4163
Heart/Lung 27 209
Lung 1054 3799
Total 23 964 79 845
a Data from United Network for Organ Sharing, 2001 (www.unos.org).
www.sciencedirect.com
Review TRENDS in Biotechnology Vol.22 No.6 June 2004 289
occurs within seconds or minutes. In the case of a
discordant organ (e.g. in transplanting from pig to
human) naturally occurring antibodies react with antigenic
structures on the surface of the porcine organ and
induce HAR by activating the complement cascade via the
antigen–antibody complex. Ultimately, this results in the
formation of the membrane attack complex (MAC).
However, the complement cascade can be shut down at
various points by expression of regulatory genes that
prevent the formation of the MAC. Regulators of the
complement cascade are CD55 (decay accelerating factor,
DAF), CD46 (membrane cofactor protein, MCP) or CD59.
MAC disrupts the endothelial cell layer of the blood
vessels, which leads to lysis, thrombosis, loss of vascular
integrity and ultimately to rejection of the transplanted
organ [24].
Induced xenoreactive antibodies are thought to be
responsible for AVR, which occurs within days of a
transplantation of a xenograft; disseminated intravascular
coagulation (DIC) is a predominant feature of AVR.
Despite severe immunosuppressive treatment, a disturbed
thrombocyte function and DIC were observed in a pig-toprimate
xenotransplant model [25,26]. The endothelial
cells of the graft’s microvasculature loose their antithrombic
properties, attract leucocytes, monocytes and
platelets leading to anemia and organ failure. The
underlying mechanism for DIC and thrombotic microangiopathy
is thought to be activation of the endothelial
cells attributed to incompatibilities between human and
porcine coagulation factors [25]. At least three incompatibilities
between human and porcine coagulation systems
have been identified; the first is the failure of porcine
thrombomodulin (TM) to activate human anticoagulant
protein C, the second is that the porcine tissue factor
pathway inhibitor fails to inhibit human clotting factor Xa
and the third is that porcine von Willebrand factor (vWF)
binds and activates human platelets [26]. Human thrombomodulin
(hTM) and heme-oxygenase 1 (hHO-1) are
crucially involved in the etiology of DIC and might be good
targets for future transgenic studies to improve long-term
survival of porcine xenografts by creating multi-transgenic
pigs.
The cellular rejection occurs within weeks after
transplantation. In this process the blood vessels of the
transplanted organ are damaged by T-cells, which invade
the intercellular spaces and destroy the organ. This
rejection is observed after allotransplantation and is
normally suppressed by life-long administration of immunosuppressive
drugs [24].
When using a discordant donor species such as the pig,
overcoming the HAR and AVR are the preeminent goals.
The most promising strategy for overcoming the HAR is
the synthesis of human complement regulatory proteins
(RCAs) in transgenic pigs [22,23,27,28]. Following transplantation,
the porcine organ would produce the complement
regulatory protein and can thus prevent the
complement attack of the recipient. Pigs transgenic for
DAF or MCP have been generated by microinjection of
DNA constructs into pronuclei of zygotes. Hearts and
kidneys from these animals have been transplanted either
heterotopically, (in addition to the recipient’s own organ) or

290
Table 6. Success rates of RCA-transgenic porcine organs after transplantation to primate recipients a
RCA Organ/kind of transplant Recipient Immuno-suppression Survival (days)
hDAF Heart/heterotropic Cynomologus þþþ , 135
hDAF Heterotopic Cynomologus þþ , 90
hDAF Orthopic Baboon þþþ , 28
hDAF Kidney/orthotopic Cynomologus þþ , 90
hCD59 Kidney/orthotopic, heterotopic Cynomologus þþþ , 20
hCD46 Heart, heterotopic Baboon þþ , 23
a Abbreviations: þ, weak immunosuppression; þþ, moderate immunosuppression; þþþ, heavy immunosuppression; RCA, regulator of complement activity
orthotopically (life supportive) into non-human primates.
Survival rates reached 23–135 days with porcine xenografts
transgenic for one of the two complement regulators;
survival rates were heavily affected by the strength of
the immune-suppressive protocol (Table 6) [29–31].
Similarly, transgenic expression of hCD59 was compatible
with an extended survival of porcine hearts in a perfusion
model or following transfer into primates [32,33]. These
data show that HAR can be overcome in a clinically
acceptable manner by expressing human complement
regulators in transgenic pigs [22].
Another promising strategy towards successful xenotransplantation
is the knockout of the antigenic structures
on the surface of the porcine organ that cause HAR. These
structures are known as 1,3-a-gal-epitopes and are
primarily produced by activity of 1,3-a-galactosyltransferase
(a-gal). Piglets in which one allele of a-gal locus had
been knocked out by homologous recombination in
primary donor cells that were employed in nuclear
transfer were recently generated [34,35]. The birth of
four healthy piglets with disruption of both allelic loci for
a-gal has meanwhile also been published. Applying toxin A
from Clostridium difficile to cells that already carried one
deleted a-gal allele selected a cell clone, which carried an
inactivating point mutation on the second allele. This cell
clone was then used in nuclear transfer [36]. The
usefulness of these animals for xenotransplantation has
recently been reported [37].
Further improvements in the success of xenotransplantation
will arise from the possibility of inducing a
permanent tolerance across xenogenic barriers [38,39]. A
particularly promising strategy for long-term graft acceptance
is the induction of a permanent chimerism via
intraportal injection of embryonic stem cells [40].
Prevention of transmission of zoonoses from the donor
animal to the human recipient is crucial for clinical
application of porcine xenografts. This aspect gained
particular significance when a few years ago it was
shown that porcine endogenous retroviruses (PERV) can
be produced by porcine cell lines and can even infect
human cell lines in vitro [41]. However, until today no
infection has been found in patients that had received
various forms of living porcine tissues (e.g. islet cells,
insulin, skin, extracorporal liver) for up to 12 years [42].
Recent intensive research has shown that porcine
endogenous retroviruses probably do not present a risk
for recipients of xenotransplants provided all necessary
precautions are taken [43–46]. In addition, a strain of
miniature pigs has been identified that does not produce
infective PERV [47]. Although xenotransplantation poses
numerous further challenges to research, it is expected
www.sciencedirect.com
Review TRENDS in Biotechnology Vol.22 No.6 June 2004
that transgenic pigs will be available as organ donors
within the next five to ten years. Guidelines for the clinical
application of porcine xenotransplants are already available
in the USA and are currently being developed in
several other countries.
The ethical challenges of xenotransplantation have
been a matter of a worldwide intensive debate. A general
consensus has been reached that the technology is
ethically acceptable provided the individual well-being
does not compromise public health by producing and
transmitting new pathogens. Economically xenotransplantation
might be viable if the enormous costs caused
by patients suffering from severe kidney disease, needing
dialysis or those suffering from chronic heart diseases
could be avoided by a functional kidney or heart xenograft.
Xenogenic cells and tissue
Another promising area of application for transgenic
animals will be the supply of xenogenic cells and tissue.
Several intractable diseases, disorders and injuries are
associated with irreversible cell death and/or aberrant
cellular function. Despite numerous attempts, primary
human cells cannot yet be expanded well enough in
culture. In the future, human embryonic stem cells could
be a source for specific differentiated cell types that can be
used in cell therapy [48,49]. Xenogenic cells, in particular
from the pig, hold great promise for successful cell
therapies for human patients because cells can be
implanted at the optimal therapeutic location (i.e. immunoprivileged
sites, such as the brain), genetically or
otherwise modified before transplantation to enhance
cell function, banked and cryopreserved, or combined
with different cell types in the same graft [50].
Xenogenic cell therapy has been advanced to preclinical
studies. Porcine islet cells have been transplanted to
diabetic patients and were shown to be at least partially
functional over a limited period of time [51]. Porcine fetal
neural cells were transplanted into the brain of
patients suffering from Parkinson’s and Huntington’s
disease [52,53]. In a single autopsied patient the graft
survived for .7 months and the transplanted cells formed
dopaminergic neurons and glial cells. Pig neurons
extended axons from the graft site into the host brain
[52]. Further examples for the potential use of porcine
neural cells are in cases of stroke and focal epilepsy [54].
Olfactory ensheathing cells (OECs) or Schwann cells
derived from hCD59 transgenic pigs promoted axonal
regeneration in rat spinal cord lesion [55]. Thus, cells from
genetically modified pigs could restore electrophysiologically
functional axons across the site of a spinal cord
transsection. Xenogenic porcine cells could also be useful

as a novel therapy for liver diseases. On transplantation of
porcine hepatocytes to Watanabe heritable hyperlipidemic
(WHHL) rabbits (a model for familial hypercholesterolemia)
the xenogenic cells migrated out of the vessels and
integrated into the hepatic parenchyma. The integrated
porcine hepatocytes provided functional low density
lipoprotein (LDL) receptors and thus reduced cholesterol
levels by 30–60% for at least 100 days [56].
A clone of bovine adrenocortical cells restored adrenal
function upon transplantation to adrenalectomized severe
combined immunodeficient (SCID) mice indicating that
functional endocrine tissue can be derived from a single
somatic cell [57]. Bovine neuronal cells were collected from
transgenic fetuses, and when transplanted into the brain
of rats resulted in significant improvements in symptoms
of Parkinson’s disease [58]. Furthermore, xenotransplantation
of retinal pigment epithelial cells holds promise for
treating retinal diseases such as macular degeneration,
which is associated with photoreceptor losses. Porcine or
bovine fetal cardiomyocytes or myoblasts might provide a
therapeutic approach for the treatment of ischemic heart
disease. Similarly, xenogenic porcine cells might be
valuable for the repair of skin or cartilage damage [50].
In light of the emergence of significantly improved
protocols for genetic modification of donor animals and
new powerful immunosuppressive drugs xenogenic cell
therapy will evolve as an important therapeutic option for
the treatment of human diseases.
Farm animals as models for human diseases
In mouse genetics the generation of knockout animals is a
standard procedure and several thousand strains carrying
gene knockouts or transgenes have been developed [Mouse
Knockout and Mutation Database (MKMD); http://
research.bmn.com/mkmd]. Models have been developed
for several human diseases. However, mouse physiology,
anatomy and life span differ significantly from those in
humans, making the rodent model inappropriate for
several human diseases. Farm animals, such as pigs,
sheep or even cattle could be more appropriate models to
study human diseases in particular non-insulin-dependent
diabetes, cancer and neurodegenerative disorders,
which require longer observation periods than those
possible in mice [59–61]. With the aid of the microinjection
technology an important pig model for the rare human eye
disease Retinitis pigmentosa (PR) has been developed [62].
Patients with PR develop night blindness early in life
attributed to a loss of photoreceptors. The transgenic pigs
express a mutated rhodopsin gene and show a great
similarity with the human phenotype. Treatment models
with value for human patients are being developed [63].
The development of the somatic cloning technology and
the merger with targeted genetic modifications and
conditional gene expression will enhance the possibilities
for creating useful models for human diseases in large
animals. A good example is the knockout of the prion gene
that would make sheep and cattle non-susceptible to
spongiform encephalopathies (scrapie and BSE). Mice
models showed that the knockout of the prion protein is the
only secure way to prevent infection and transmission of
the disease [64]. The first successful targeting of the ovine
www.sciencedirect.com
Review TRENDS in Biotechnology Vol.22 No.6 June 2004 291
prion locus has been reported; however the cloned lambs
carrying the kockout locus died several days after birth
[65]. Prion knockout animals could be an appropriate
model for studying the epidemiology of spongiform
encephalopathies in humans and are crucial for
developing strategies to eliminate prion carriers from a
farm animal population.
The pig could be a useful model to study defects of
growth hormone releasing hormone (GHRH), which is
characterized by a variety of conditions such as Turner
syndrome, hypochrondroplasia, Crohn’s disease, intrauterine
growth retardation or renal insufficiency. Application
of recombinant GHRH in an injectable form and its
myogenic expression has been shown to alleviate these
problems in a porcine model [66].
An important aspect of large animal models for human
diseases is the recent finding that somatic cloning per se
does not result in shortening of the telomeres. Telomeres
are highly repetitive DNA sequences at the end of the
chromosomes that are crucial for their structural integrity
and function and are thought to be related to lifespan.
Telomere shortening is usually correlated with severe
limitations of the regenerative capacity of cells, the onset
of cancer, ageing and chronic disease with significant
impact on human lifespan [67–70]. Expression of the
enzyme telomerase, which is primarily responsible for the
formation and rebuilding of telomeres, is suppressed in
most somatic tissues postnatally. Although telomeres in
cloned sheep (Dolly) derived from epithelial cells were
shorter than those of naturally bred age matched control
animals, telomere lengths in cloned mice and cattle were
not different from those determined in age matched
controls even when senescent donor cells had been
employed [71–75]. Recent studies in our laboratory have
revealed that telomere length is established already early
in preimplantation development by a specific genetic
programme and is dependent on telomerase activity [76].
Dietary modifications of animal products
Application of gene and biotechnology for nutrition and
biomedicine is more developed for plants than farm
animals [77]. The term nutriceuticals in the farm animal
context means that gene and biotechnology are used to
enhance farm animal products to improve diet and have
concomitant medical applications. Because these products
have a proven pharmacological effect on the body, they are
regarded as ‘drugs’ and must be tested for efficacy and
safety. Functional foods are those designed to provide
specific and beneficial physiological effects on human
health and welfare and should prevent diet-related
diseases. Functional foods from animals could be used to
lower cholesterol levels in an effort to battle cardiovascular
diseases, to reduce high blood pressure by adding
angiotensin converting enzyme (ACE) inhibitors or to
increase immunity by adding specific immunostimulatory
peptides [78]. However, data showing that nutriceuticals
are really beneficial for human health are rare.
Regarding the production of improved quality animal
products, interesting observations have been made in
several beef cattle breeds, such as Belgian Blue and
Piedmontese. These breeds were accidentally bred for

292
mutations of the myostatin gene, which renders it nonfunctional
or less functional than the wild-type gene [79].
The mutated genes cause muscle hypertrophy and led to
improved meat quality. This observation makes targeted
modifications of the myostatin gene an interesting option
for the meat industry. A diet rich in non-saturated fatty
acids is correlated with a reduced risk of stroke and
coronary diseases. One transgenic approach to this is the
generation of pigs with increased amounts of nonsaturated
fatty acids. Pigs producing a higher ratio of
unsaturated versus saturated fatty acids in their muscles
are currently under development in Japan.
An attractive example for targeted genetic modification
could be dairy production [80,81]. Apart from conventional
dairy products, it could be possible to produce fat-reduced
or even fat-free milk or milk with a modified lipid
composition via modulation of enzymes involved in lipid
metabolism; to increase curd and cheese production by
enhancing expression of the casein gene family in the
mammary gland; to create ‘hypoallergenic’ milk by knockout
of the b-lactoglobulin gene; to generate lactose-free
milk via knockout of the a-lactalbumin locus that is the
key molecule in milk sugar synthesis; to produce ‘infant
milk’ in which human lactoferrin is abundantly available
or to produce milk with a highly improved hygienic
standard via an increased level of lysozyme or other
anti-microbiological substances in the udder. Lactosereduced
or lactose-free milk could make dairy products
suitable for consumption by a large proportion of the
world’s population who do not possess an active lactase
enzyme in their gut system. However, one has to bear in
mind that lactose is the main osmotically active substance
in milk and a lack thereof could interfere with milk
secretion. A lactase construct has been expressed in the
mammary gland of transgenic mice and reduced lactose
contents by 50–85% without altering milk secretion [82].
However, mice with a homozygous knockout for alactalbumin
could not feed their offspring because of the
high viscosity of the milk [83]. These diverging findings
demonstrate the feasibility of obtaining significant alterations
of milk composition by applying the appropriate
strategy.
The physicochemical properties of milk are mainly
affected by the ratio of casein variants. Therefore, casein is
a prime target for the improvement of milk composition.
Mouse models have been developed for most of the above
modifications indicating the feasibility of obtaining significant
alterations in milk composition but at the same
time showing that unwanted side effects cannot be ruled
out [83,84]. Only one full-scale study in livestock has been
reported as yet [85]. The recent report showed that the
casein ratio can be altered by overexpression of b- and
k-casein in cattle clearly underpinning the potential for
improvements in the functional properties of bovine
milk [85].
Towards environmentally friendly farm animals
Phosphorus pollution by animal production is a serious
problem in agriculture and excess phosphate from manure
promotes eutrophication. Phytase transgenic pigs have
been developed to address the problem of manure-based
www.sciencedirect.com
Review TRENDS in Biotechnology Vol.22 No.6 June 2004
environmental pollution. These pigs carry a bacterial
phytase gene under the transcriptional control of a
salivary gland specific promoter, which allows the pigs to
digest plant phytate. Without the bacterial enzyme, the
phytate phosphorus passes undigested into manure and
pollutes the environment. With the bacterial enzyme, the
fecal phosphorus output was reduced up to 75% [86]. These
environmentally friendly pigs are expected to enter the
commercial production chains within the next few years.
Precautions and perspectives
Throughout mankind’s history farm animals have made
significant contributions to human health and well-being.
The convergence of the recent advances in reproductive
technologies with the tools of molecular biology opens a
new dimension for this area [1]. Major prerequisites will be
the continuous refinement of reproductive biotechnologies
and a rapid completion of livestock genome sequencing
and annotation. The technology developed in the deciphering
of the human genome will improve and accelerate
sequencing of genomes from livestock [87]. We anticipate
genetically modified animals will play a significant role in
the biomedical arena, in particular via the production of
valuable pharmaceutical proteins and the derivation of
xenografts, within the next 5–7 years. Agricultural
application might be further away (.10 years) given the
complexity of some of the economically important traits
and the public skepticism of genetic modification related to
food production [1].
A crucial aspect of animal-derived products is the
prevention of transmission of pathogens from animals to
humans. This requires sensitive and reliable diagnostic
and screening methods for the various types of pathogenic
organisms. The recent findings (see above) that the risk of
PERV transmission is negligible are promising and show
that with targeted and intensive research such important
questions can be answered within a limited period of time,
paving the way for preclinical testing of xenografts.
Furthermore, it should be kept in mind that the biomedical
applications of farm animals will require strict standards
of ‘genetic security’ and reliable and sensitive methods for
the molecular characterization of the products. A major
contribution towards the goal of well-defined products will
come from array technology (cDNA, peptide or protein
arrays), which establishes ‘fingerprint’ profiles at the
transcriptional and/or protein level [88,89]. Meanwhile
improvements of RNA isolation and unbiased amplification
of tiny amounts of mRNA (picogram) enable researchers
to analyse RNA from single embryos [90]. With the aid
of this technology one can gain in-depth insight into the
proper functioning of a transgenic organism and thereby
ensure the absence of unwanted side effects [88,89]. This
would also be required to maintain the highest possible
levels of animal welfare in cases of genetic modification.
References
1 Niemann, H. and Kues, W.A. (2003) Application of transgenesis on
livestock for agriculture and biomedicine. Anim. Reprod. Sci. 79,
291–317
2 Hammer, R.E. et al. (1985) Production of transgenic rabbits, sheep and
pigs by microinjection. Nature 315, 680–683

3 Rudolph, N.S. (1999) Biopharmaceutical production in transgenic
livestock. Trends Biotechnol. 17, 367–374
4 Bösze, Zs. et al. (2003) The transgenic rabbit as model for human
diseases and as a source of biologically active recombinant proteins.
Transgenic Res. 12, 541–553
5 Ziomek, C.A. (1998) Commercialization of proteins produced in the
mammary gland. Theriogenology 49, 139–144
6 Dyck, M.K. et al. (2003) Making recombinant proteins in animals –
different systems, different applications. Trends Biotechnol. 21,
394–399
7 Meade, H.M. et al. (1999) Expression of recombinant proteins in the
milk of transgenic animals. In: Gene Expression Systems. Fernandez,
J.M., Hoeffler, J.P., (eds.) Academic Press, San Diego, U. S. A., pp. 399–
427
8 Van der Hout, J.M.P. et al. (2001) Enzyme therapy for Pompe disease
with recombinant human a-glucosidase from rabbit milk. J. Inherit.
Metab. Dis. 24, 266–274
9 van Berkel, P.H. et al. (2002) Large scale production of recombinant
human lactoferrin in the mik of trangenic cows. Nat. Biotechnol. 20,
484–487
10 Hyttinen, J.M. et al. (1994) Generation of transgenic dairy cattle from
transgene-analyzed and sexed embryos produced in vitro. Biotechnology
(N. Y.) 12, 606–608
11 Massoud, M. et al. (1996) The deleterious effects of human erythropoietin
gene driven by the rabbit whey acidic protein gene promoter in
transgenic rabbits. Reprod. Nutr. Dev. 36, 555–563
12 Hiripi, L. et al. (2003) Expression of active human blood clotting factor
VIII in the mammary gland of transgenic rabbits. DNA Cell Biol. 22,
21–25
13 Niemann, H. et al. (1999) Expression of human blood clotting factor
VIII in the mammary gland of transgenic sheep. Transgenic Res. 8,
237–247
14 Paleyanda, R.K. et al. (1997) Transgenic pigs produce functional
human factor VIII in milk. Nat. Biotechnol. 15, 971–975
15 Kuroiwa, Y. et al. (2002) Cloned transchromosomic calves producing
human immunoglobulin. Nat. Biotechnol. 20, 889–894
16 Hancock, R.E.E. and Scott, M.G. (2000) The role of antimicrobial
peptides in animal defense. Proc. Natl. Acad. Sci. U. S. A. 97,
8856–8861
17 Goldstein, B.P. (1998) Activity of nisin against Streptococcus pneunoniae,
in vitro, and in a mouse infection model. J. Antimicrob.
Chemother. 42, 277–278
18 Gamelli, R. et al. (1998) Improvement in survival with peptidyl
membraned interactive molecule D4B treatment after burn wound
infection. Arch. Surg. 133, 715–720
19 Kirikae, T. et al. (1998) Protective effects of a human 18-kilodalton
cationic antimicrobial protein (CAP18)-derived peptide against murine
endotoxemia. Infect. Immun. 66, 1861–1868
20 Zhang, G. et al. (2001) Porcine antimicrobial peptided: new prospects
for ancient molecules of host defense. Vet. Res. 31, 277–296
21 Lee, K.H. (2002) Development of short antimicrobial peptides derived
from host defense peptides or by combinatorial libraries. Curr. Pharm.
Des. 8, 795–813
22 Bach, F.H. (1998) Xenotransplantation: Problems and prospects.
Annu. Rev. Med. 49, 301–310
23 Platt, J.L. and Lin, S.S. (1998) The future promises of xenotransplantation.
In: Xenotransplantation. Ann. NY Acad. Sci. 862, 5–18.
24 White, D. (1996) Alteration of complement activity: a strategy for
xenotransplantation. Trends Biotechnol. 14, 3–5
25 Cowan, P.J. et al. (2000) Renal xenografts from triple-transgenic pigs
are not hyperacutely rejected but cause coagulopathy in nonimmunosuppressed
baboons. Transplantation 69, 2504–2515
26 Gaca, J.G. et al. (2002) The role of the porcine von Willebrand factor:
Baboon platelet interactions in pulmonary xenotransplantation.
Transplantation 74, 1596–1603
27 Cozzi, E. and White, D.J.G. (1995) The generation of transgenic pigs as
potential organ donors for humans. Nat. Med. 1, 964–966
28 White, D. (1996) Alteration of complement activity: a strategy for
xenotransplantation Trends. Biotechnol. 14, 3–5
29 Cozzi, E. et al. (2000) Progress in xenotransplantation. Clin. Nephrol.
53, 13–18
30 Diamond, L.E. et al. (2001) A human CD46 transgenic pig model
www.sciencedirect.com
Review TRENDS in Biotechnology Vol.22 No.6 June 2004 293
system for the study of discordant xenotransplantation. Transplantation
71, 132–142
31 Zaidi, A. et al. (1998) Life-supporting pig to primate renal xenotransplantation
using genetically modified donors. Transplantation
65, 1584–1590
32 Fodor, W.L. et al. (1994) Expression of a functional human complement
inhibitor in a transgenic pig as a model for the prevention of
xenogeneic hyperacute organ rejection. Proc. Natl. Acad. Sci. U. S. A.
91, 11153 – 11157
33 Niemann, H. et al. (2001) CMV early promoter induced expression of
hCD59 in porcine organs provides protection against hyperacute
rejection. Transplantation 72, 1898–1906
34 Dai, Y. et al. (2002) Targeted disruption of the alpha1,3-galactosyltransferase
gene in cloned pigs. Nat. Biotechnol. 20, 251–255
35 Lai, L. et al. (2002) Production of alpha-1,3-galactosyltransferase
knockout pigs by nuclear transfer cloning. Science 295, 1089–1092
36 Phelps, C.J. et al. (2003) Production of alpha 1,3-galactosyltransferasedeficient
pigs. Science 299, 411–414
37 Yamada, K. et al. (2003) An initial report of alpha-gal deficient pig-tobaboon
renal xenotransplantation: evidence for the benefit of cotransplanting
vascularized donor thymic tissue. Xenotransplantation
10, 480
38 Greenstein, J. and Sachs, D.H. (1997) The use of tolerance for
transplantation across xenogeneic barriers. Nat. Biotechnol. 15,
235–238
39 Auchincloss, H. Jr and Sachs, D.H. (1998)) Xenogenic transplantation.
Annu. Rev. Immunol. 16, 433–470
40 Fändrich, F. et al. (2002) Preimplantation-stage stem cells induce longterm
allogeneic graft acceptance without supplementary host conditioning.
Nat. Med. 8, 171–177
41 Patience, C. et al. (1997) Infection of human cells by an endogenous
retrovirus of pigs. Nat. Med. 3, 282–286
42 Paradis, K. et al. (1999) Search for cross-species transmission of
porcine endogenous retrovirus in patients treated with living pig
tissue. Science 285, 1236–1241
43 Patience, C. et al. (1998) No evidence of pig DNA of retroviral infection
in patients with short-term extracorporal connection of pig kidneys.
Lancet 352, 699–701
44 Dinsmore, L.E. et al. (2000) No evidence for infection of human cells
with porcine endogenous retrovirus (PERV) after exposure to porcine
fetal neuronal cells. Transplantation 70, 1382–1389
45 Switzer, W.M. et al. (2001) Lack of cross-species transmission of
porcine endogenous retrovirus infection to nonhuman primate
recipients of porcine cells, tissues and organs. Transplantation 71,
959–965
46 Martin, U. et al. (2002) Absence of PERV specific humoral immune
response in baboons after transplantation of porcine cells of organs.
Transplant. Int. 15, 361–368
47 Oldmixon, B.A. et al. (2002) Porcine endogenous retrovirus transmission
characteristics of an inbred herd of miniature swine. J. Virol.
76, 3045–3048
48 Rossant, J. (2001) Stem cells from the mammalian blastocyst. Stem
Cells 19, 477–482
49 Reubinoff, B.E. et al. (2000) Embryonic stem cell lines from human
blastocysts: somatic differentiation in vitro. Nat. Biotechnol. 18,
399–404
50 Edge, A.S.B. et al. (1998) Xenogeneic cell therapy: Current progress
and future developments in porcine cell transplantation. Cell
Transplant. 7, 525–539
51 Groth, C.G. et al. (1994) Transplantation of porcine fetal pancreas to
diabetic patients. Lancet 344, 1402–1404
52 Deacon, T. et al. (1997) Histological evidence of fetal pig neutral cell
survival after transplantation into a patient with Parkinson’s disease.
Nat. Med. 3, 350–353
53 Fink, J.S. et al. (2000) Porcine xenografts in Parkinson’s disease and
Huntington’s disease patients: preliminary results. Cell Transplant. 9,
273–278
54 Björklund, A. (1991) Neural transplantation – An experimental tool
with clinical possibilities. Trends Neurosci. 14, 319–322
55 Imaizumi, T. et al. (2000) Xenotransplantation of transgenic pig
olfactory ensheathing cells promotes axonal regeneration in rat spinal
cord. Nat. Biotechnol. 18, 949–953
56 Gunsalus, J.R. et al. (1997) Reduction of serum cholesterol in

294
Review TRENDS in Biotechnology Vol.22 No.6 June 2004
Watanabe rabbits by xenogeneic hepatocellular transplantation. Nat.
Med. 3, 48–53
57 Thomas, M. et al. (1997) Adrenocortical tissue formed by transplantation
of normal clones of bovine adrenocortical cells in scid mice
replaces the essential functions of the animals’ adrenal glands. Nat.
Med. 3, 978–983
58 Zawada, W.M. et al. (1998) Somatic cell cloned transgenic bovine
neurons for transplantation in parkinson rats. Nat. Med. 4, 569–574
59 Milan, D. et al. (2000) A mutation in PRKAG3 associated with excess
glycogen content in pig skeletal muscle. Science 288, 1248–1251
60 Palmarini, M. and Fan, H. (2001) Retrovirus-induced ovine pulmonary
adenocarcinoma, an animal model for lung cancer. J. Natl. Cancer Inst.
93, 1603–1614
61 Theuring, F. et al. (1997) Transgenic animals as models of neurodegenerative
disease in humans. Trends Biotechnol. 15, 320–325
62 Petters, R.M. et al. (1997) Genetically engineered large animal model
for studying cone photoreceptor survival and degeneration in retinitis
pigmentosa. Nat. Biotechnol. 15, 965–970
63 Mahmoud, T.H. (2003) Lensectomy and vitrectomy decrease the rate of
photoreceptor loss in rhodopsin P347L transgenic pigs. Graefes Arch.
Clin. Exp. Ophtalmol. 241, 298–308
64 Weissmann, C. et al. (2002) Transmission of prions. Proc. Natl. Acad.
Sci. U. S. A. 99 (Suppl. 4), 16378–16383
65 Denning, C. et al. (2001) Deletion of the alpha (1,3)galactosyl
transferase (GGTA1) and the prion protein (PrP) gene in sheep. Nat.
Biotechnol. 19, 559–562
66 Draghia-Akli, R. et al. (1999) Myogenic expression of an injectable
protease-resistant growth hormone-releasing hormone augments
long-term growth in pigs. Nat. Biotechnol. 17, 1179–1183
67 Djojosubroto, M.W. et al. (2003) Telomeres and telomerase in aging,
regeneration and cancer. Mol. Cells 15, 164–175
68 Rudolph, K.L. et al. (1999) Longevity, stress response, and cancer in
aging telomerase-deficient mice. Cell 96, 701–712
69 Rudolph, K.L. et al. (2001) Telomere dysfunction and evolution of
intestinal carcinoma in mice and humans. Nat. Genet. 28, 155–159
70 Cawthon, R.M. et al. (2003) Association between telomere length in
blood and mortality in people aged 60 years or older. Lancet 361,
393–395
71 Shiels, P.G. et al. (1999) Analysis of telomere lengths in cloned sheep.
Nature 399, 316–317
72 Wakayama, T. et al. (2000) Cloning of mice to six generations. Nature
407, 318–319
73 Tian, X.C. et al. (2000) Normal telomere lengths found in cloned cattle.
Nat. Genet. 26, 272–273
74 Lanza, R.P. et al. (2000) Extension of cell life-span and telomere length
in animals cloned from senescent somatic cells. Science 288, 665–669
75 Betts, D. et al. (2001) Reprogramming of telomerase activity and
rebuilding of telomere length in cloned cattle. Proc. Natl. Acad. Sci.
U. S. A. 98, 1077–1082
76 Schätzlein, S. et al. (2004) Telomere length is reset during early
mammalian embryogenesis. Proc. Natl. Acad. Sci. U. S. A. (accepted)
www.sciencedirect.com
77 Manzur, B.J. (2001) Developing transgenic grains with improved oils,
proteins and carbohydrates. Novartis Found. Symp. 236, 233–239
78 German, B. et al. (1999) The development of functional foods: lessions
from the gut. Trends Biotechnol. 17, 492–499
79 Grobet, L. et al. (1997) A deletion in the bovine myostatin gene causes
the double-muscled phenotype in cattle. Nat. Genet. 17, 71–74
80 Yom, H.C. and Bremel, R.D. (1993) Genetic engineering of milk
composition: modification of milk components in lactating transgenic
animals. Am. J. Clin. Nutr. 58 (Suppl.), 299S–306S
81 Karatzas, C.N. and Turner, J.D. (1997) Toward altering milk
composition by genetic manipulation: current status and challenges.
J. Dairy Sci. 80, 2225–2232
82 Jost, B. et al. (1999) Production of low-lactose milk by extopic
expression of intestinal lactase in the mouse mammary gland. Nat.
Biotechnol. 17, 160–164
83 Stinnakre, M.G. et al. (1994) Creation and phenotypic analysis of
a-lactalbumin-deficient mice. Proc. Natl. Acad. Sci. U. S. A. 91,
6544–6548
84 Kumar, S. et al. (1994) Milk composition and lactation of b-caseindeficient
mice. Proc. Natl. Acad. Sci. U. S. A. 91, 6138–6142
85 Brophy, B. et al. (2003) Cloned transgenic cattle produce milk with
higher levels of b-casein and k-casein. Nat. Biotechnol. 21, 157–162
86 Golovan, S.P. et al. (2001) Pigs expressing salivary phytase produce
low-phosphorus manure. Nat. Biotechnol. 19, 741–745
87 O’Brien, S.J. et al. (1999) The promise of comparative genomics in
mammals. Science 286, 458–481
88 Hughes, T.R. et al. (2000) Widespread aneuploidy revealed by DNA
microarray expression profiling. Nat. Genet. 25, 333–337
89 Templin, M.F. et al. (2002) Protein microarray technology. Trends
Biotechnol. 20, 160–166
90 Brambrink, T. et al. (2002) Application of cDNA arrays to monitor
mRNA profiles in single preimplantation mouse embryos. Biotechniques
33, 376–378
91 Willadsen, S.M. (1986) Nuclear transplantation in sheep embryos.
Nature 320, 63–65
92 Wilmut, I. et al. (1997) Viable offspring derived from fetal and adult
mammalian cells. Nature 385, 810–813
93 Schnieke, A.E. et al. (1997) Human factor IX transgenic sheep
produced by transfer of nuclei from transfected fetal fibroblasts.
Science 278, 2130–2133
94 Cibelli, J.B. et al. (1998) Cloned transgenic calves produced from
nonquiescent fetal fibroblasts. Science 280, 1256–1258
95 Chan, A.W.S. et al. (1998) Transgenic cattle produced by reversetranscribed
gene transfer in oocytes. Proc. Natl. Acad. Sci. U. S. A. 95,
14028–14033
96 McCreath, K.J. et al. (2000) Production of gene-targeted sheep by
nuclear transfer from cultured somatic cells. Nature 405,
1066–1069
97 Hofmann, A. et al. (2003) Efficient transgenesis in farm animals by
lentiviral vectors. EMBO Rep. 4, 1054–1060

BIOLOGY OF REPRODUCTION 72, 1020–1028 (2005)
Published online before print 22 December 2004.
DOI 10.1095/biolreprod.104.031229
Isolation of Murine and Porcine Fetal Stem Cells from Somatic Tissue 1
Wilfried A. Kues, Björn Petersen, Wiebke Mysegades, Joseph W. Carnwath, and Heiner Niemann 2
Department of Biotechnology, Institut für Tierzucht, Mariensee, D-31535 Neustadt, Germany
ABSTRACT
Adult stem cells have been previously isolated from a variety
of somatic tissues, including bone marrow and the central nervous
system; however, contribution of these cells to the germ
line has not been shown. Here we demonstrate that fetal somatic
explants contain a subpopulation of somatic stem cells
(FSSCs), which can be induced to display features of lineageuncommitted
stem cells. After injection into blastocysts, these
cells give rise to a variety of cell types in the resultant chimeric
fetuses, including those of the mesodermal lineage; they even
migrate into the genital ridge. In vitro, FSSCs exhibit characteristics
of embryonic stem cells, including extended self-renewal;
expression of stem cell marker genes, such as Pou5f1 (Oct4),
Stat3, and Akp2 (Tnap) and growth as multicellular aggregates.
We report that fetal tissue contains somatic stem cells with
greater potency than previously thought, which might form a
new source of stem cells useful in somatic nuclear transfer and
cell therapy.
assisted reproductive technology, early development, embryo,
environment, fibroblasts, germ line, Oct4, pluripotency, stem
cells
INTRODUCTION
Adult stem cells with a surprisingly high degree of plasticity
have been identified among hematopoietic and mesenchymal
cell populations from bone marrow and the ependymal
and subventricular zones of the central nervous
system, as well as in vitro-derived cultures thereof [1–8].
These cells are capable of contributing to organs of the
three germ layers, but contribution to the germ line has not
yet been shown. Recently, it has become a matter of debate
whether these cells have inherent pluripotency or whether
fusion with differentiated cells can account for the observed
plasticity [9–12].
Fibroblasts are the principal cell type in connective (mesodermal)
tissue, where they mediate structural and functional
processes, such as formation of a collagen meshwork
and wound healing [13–15]. Primary fibroblasts can be obtained
from subdermal and other connective tissues [16,
17]. These cells represent a poorly characterized mixture of
cell lineages [18], in which the composition varies with the
developmental stage of the donor and the tissue of origin
[14]. The regenerative ability of connective tissue suggests
the presence of tissue-specific progenitor cells.
In the present study, we have tested whether primary
fibroblast cultures contain stem cells with the potential for
multilineage differentiation. To identify rare stem cells
1 Supported by DFG.
2 Correspondence: FAX: 0 5034 871 101; e-mail: niemann@tzv.fal.de
Received: 26 April 2004.
First decision: 11 May 2004.
Accepted: 9 December 2004.
2005 by the Society for the Study of Reproduction, Inc.
ISSN: 0006-3363. http://www.biolreprod.org
1020
within a large population of primary somatic cells, we used
the OG2 transgenic mouse line, which carries the Oct4
(also known as Pou5f1) promoter driving a green fluorescent
protein (GFP) marker [19, 20]. Oct4 is a transcription
factor of the POU family that is crucial for maintenance of
embryonic stem cells in the undifferentiated state. It plays
a major role in mouse embryogenesis [21–23]. Oct4 regulates
expression of several genes, including Fgf4, Rex1
(also known as Zpf42), Sox2, Ssp1 (osteopontin), Hand1
and Ifnt1 [23, 24]. The Oct4 promoter is active in oocytes,
zygotes, early cleavage-stage embryos, the inner cell mass
of the blastocyst and in embryonic carcinoma and stem
cells [21, 24, 25]. Oct4 is downregulated when cells leave
the germ line and is found exclusively in germ cells in fetal
and adult mice [21–23]. (Re)activation of the Oct4 gene in
somatic cells would be a strong indication that these cells
fulfill an essential molecular precondition for pluripotency.
To test the potential for multilineage differentiation and
functional contribution to organogenesis, the most informative
assay is injection of the putative stem cells into
recipient blastocysts and the generation of chimeras.
Here, we report the identification of a fetal somatic stem
cell (FSSC) population in primary fibroblast cultures derived
from two mammalian species (mouse and pig) and
show that simple changes of the culture conditions allow
selective enrichment of the FSSCs. The FSSCs could be
more amenable to reprogramming and would thus be a new
source of donor cells in somatic nuclear transfer or celltherapy
approaches.
MATERIALS AND METHODS
Cell Culture of Fetal and Adult Somatic Tissues
Primary cultures were prepared by somatic explant (1 mm 3 ) cultures
of connective tissue. For isolation of fetal cells, porcine fetuses of Postcoitus
(PC) Day 25 were eviscerated, the extremities and the heads were
removed. Cell cultures from adult pigs were isolated from subdermal tissues
of ear clips. The tissues were isolated under sterile conditions and
washed twice in phosphate buffered saline (PBS) containing antibiotics
and were then cut into small pieces and pasted to cell culture dishes by
employing recalcified microdrops of bovine plasma. Bovine plasma was
isolated from EDTA-blood of healthy cows by centrifugation (4000 g,
15 min) and stored frozen in aliquots at 80C. For use, an aliquot was
thawed, supplemented with 80 mM CaCl 2 and microdrops of 5–10 l were
pipetted into a cell culture dish. Small pieces of tissue were placed into
the plasma drops, and culture dishes were incubated for 10–30 min at
37C until plasma coagulation was completed. Subsequently, tissues were
maintained in Dulbecco modified Eagles medium (DMEM) medium supplemented
with 2 mM glutamine, 1% nonessential amino acids, 1% vitamin
solution, 0.1 mM mercaptoethanol, 100 U/ml penicillin, 100 mg/ml
streptomycin (Sigma, Deisenhofen, Germany) containing 10% fetal calf
serum (FCS; batch numbers 40G321K, 40G2810K; Gibco, Karlsruhe, Germany)
and incubated in humidified 95% air with 5% CO 2 at 37C [16,
17]. Outgrowing cells were trypsinized and subpassaged once before cryopreservation.
Typically, first outgrowing cells from fetal explants became
visible within 24 h of incubation, and subpassaging was done after 7 days
of culture. For high serum culture, the serum content of the standard medium
was increased to 30% FCS. For suspension culture, colonies were
selectively isolated and completely dissociated in a trypsin solution, then

10 4 cells were seeded into 35-mm bacteriological dishes. Every second
day, 50% of the medium was replaced with new medium. To determine
the maximal replicative limit, cultures were serially subpassaged and 12.5
10 3 cells were seeded per square centimeter in six-well dishes, trypsinized
after 5–7 days, counted, and reseeded. The number of accumulated
population doublings per passage was determined using the equation, PD
log(A/B)/log 2, in which A is the number of collected cells and B is the
number of plated cells. Murine fibroblasts were obtained from Day 11.5–
15.5 fetuses or adult OG2 mice [14] (homozygous for the Oct4-GFP transgene)
or from double transgenic fetuses of crosses of OG2 with Rosa26
mice. Confocal microscopy was applied to detect GFP using a Zeiss Axiomat
LSM and an excitation wavelength of 488 nm. Embryonic stem
(ES) cells (wildtype GS1 129/Sv) were cultured as described [26]. Animal
handling was in accordance with institutional guidelines.
In some experiments, porcine FSSCs were cultured in standard medium
(DMEM 10% FCS) supplemented with growth factors. As controls, high
serum and standard cultures were run in parallel and, after 7 days, the
three-dimensional-colony formation and alkaline phosphatase (AP) induction
were determined. The following growth factors were supplemented:
human leukemia inhibitory factor (LIF, 1000 U/ml; Chemicon International),
epidermal growth factor (EGF, 0.1 ng/ml; TEBU GmbH, Offenbach,
Germany), platelet-derived growth factor (PDGF, 1.0 ng/ml; TEBU
GmbH), basic fibroblast growth factor (bFGF, 1.0 ng/ml; TEBU GmbH),
endothelial cell growth factor (ECGF, 500 ng/ml; Roche Diagnostics,
Mannheim, Germany), and insulin (250 ng/ml; Sigma).
In some experiments, porcine FSSCs were cultured in high serum medium
supplemented with one of the following inhibitory peptides: 1) bFGF
inhibitory peptide H-1948 (5 M; Bachem, Weil am Rhein, Germany), 2)
insulin-like growth factor (IGF-I) analog H-1356 (10 M; Bachem), 3)
PDGF antagonist H-8650 (10 M; Bachem), and 4) insulin receptor (689-
702) H-4212 (10 M; Bachem). In parallel, high serum and standard cultures
were run as controls and, after 7 days, three-dimensional-colony
formation and AP induction were determined.
DNA contents were measured by fluorescent activated cell sorting as
described [16]. In addition, nuclei from FSSCs were karyotyped and the
ploidy status was assessed.
RT-PCR of Specific mRNAs
In brief, total RNA was isolated from cells grown in six-well dishes
and 0.5 g RNA was reverse transcribed (RT) into cDNA using random
hexamers in a total volume of 40 l. Aliqouts of 2.5 l of the RT-reaction
were used as templates for polymerase chain reaction (PCR). Murine Oct4
and Stat3 were amplified by PCR with the following primers and conditions:
5-GGC GTT CTC TTT GGA AAG GTG TTC and 5-CTC GAA
CCA CAT CC TTC TCT (35 cycles, annealing temperature 57C) for the
murine Oct4; 5-TCA AGC ACC TGA CCC TTA GG and 5-CTG AAG
CGC AGT AGG AAG GT (37 cycles, 58C annealing temperature) for
Stat3 (U06922). For the amplification of TNAP (AF285233), the following
primer pair was used: 5-ATG AGG GTA AGG CCA AGC AG and 5-
CCA CCA TGG AGA CAT TTT CC (34 cycles, 58C annealing temperature).
Porcine OCT4 was amplified with intron-spanning 5-AGG TGT
TCA GCC AAA CGA CC and 5-TGA TCG TTT GCC CTT CTG GC
primers (AJ251914) and 36 cycles. Glyceraldehyde phosphate dehydrogenase
(GAPD) was amplified with the primer pair 5-CCT CCA CTA
CAT GGT CTA CAT GTT CCA GTA and 5-GCC TGC TTC ACC ACC
TTC TTG ATG TCA TCA (25 cycles, annealing temperature 60C). The
GAPD primers matched completely with the porcine ortholog (U48832)
and showed a single nucleotide mismatch with the mouse ortholog
(BC083065). The PCR reactions were performed in 20-l volumes, consisting
of 20 mM TrisHCl (pH 8.4), 50 mM KCl, 1.5 mM MgCl 2, 200
M deoxynucleoside triphosphates, 1 M of specific primer pairs and 0.5
U of Taq DNA polymerase (Gibco). Reactions without RT or without
template were used as controls.
Measurement of Cell Proliferation by BrdU Incorporation
DNA synthesis was measured by 5-bromo-2deoxy-uridine (BrdU) incorporation
as described [17]. Incorporated BrdU was detected by a chromogenic
immunoassay employing an anti-BrdU antibody conjugated with
alkaline phosphatase.
Immunohistology
For antibody staining, cells were cultured on gelatinized coverslips.
Sterile coverslips were placed in six-well cell culture dishes and covered
with a 1% gelatine solution (in PBS) for 5 min. The gelatine solution was
FETAL SOMATIC STEM CELLS
1021
then removed and the semidry coverslips were seeded with cells. After 3–
4 days of culture, the cells were fixed in cold 80% methanol. The following
monoclonal antibody dilutions were used: anti-vimentin (AMF-17b, 1:
200; Developmental Studies Hybridoma Bank, IA) and anticytokeratin
(peptide17, 1:100; Sigma). A rhodamine-labeled secondary anti-mouse antibody
(1:2000; Molecular Probes, Netherlands) was used. In some cases,
the nuclei were counterstained with 1 mM Hoechst 33342 [27]. The samples
were examined with an Olympus BX60 microscope equipped with
phase-contrast and epifluorescence optics, using band-pass rhodamine and
Hoechst filter sets.
Staining of Endogenous Alkaline Phosphatase Activity
Standard and high-density cell cultures were prepared in six-well cell
cultures dishes. The cultures were washed with PBS, fixed in 3.7% paraformaldehyde
for 15 min, washed in PBS, and then incubated in a solution
containing 25 mM TrisHC (pH 9.0), 4 mM MgCl 2, 0.4 mg sodium-naphtylphosphate,
1 mg/ml Fast Red TR (Sigma), and 0.05% Triton X-
100 for 60 min.
Chimera Generation by FSSC Injection
into Host Blastocysts
Rosa26 homozygous mice were obtained from Jackson Laboratory
(Bar Harbor, ME) and mated with homozygous OG2 animals to generate
double-transgenic fetuses carrying both marker genes, which were used to
isolate FSSCs. Day 11.5—15.5 fetuses were isolated and employed for
fetal cell cultures using the explant method described above.
For blastocyst injections, 6- to 10-wk-old female CD2F1 mice were
superovulated with 10 U eCG at noon on Day 2, followed by 10 U hCG
on Day 0, and were then mated with CD2F1 males. The next day, females
were checked for plug formation. At Day 3.5, females were sacrificed and
the uterine tracts were isolated and flushed with PBS containing 1% bovine
serum albumin. Blastocysts were isolated and incubated in PBS/1% albumin
at 37C. Single blastocysts were transferred into a micromanipulation
unit (Zeiss) and fixed with a holding pipette. On average, 2–15
double transgenic cells (OG2/Rosa26) were injected into the blastocoel
with the aid of a microcapillary. In total, 8–10 blastocysts were transferred
into the uteri of Day 2.5 or Day 3.5 pseudopregnant NMRI females that
had been mated with vasectomized males. Fetuses were recovered at Day
10.5–15.5 and either stained for lacZ-positive cells [28] as whole mounts,
or dissected and screened for GFP expression in genital ridges and other
organs.
RESULTS
Activation of the Germline-Specific Oct4 Promoter
in Somatic Cells
Fetal OG2-transgenic mice, which express the GFP gene
under transcriptional control of the germ-line-specific Oct4
promoter, were employed for explant cultures. Explants of
somatic tissue with an average size of 1 mm3were isolated
from fetuses at PC Days 11.5, 13.5, and 14.5; attached
with microdrops of bovine plasma to cell culture dishes,
and cultured in DMEM. Special care was taken to isolate
explants from mesodermal tissue of the neck and shoulder
regions. As expected, no GFP-positive cells were found in
the tissue explants and in the first outgrowths after 2 days
in culture (Fig. 1, C and D). However, after 8 days of culture,
GFP-positive cells were detected within the outgrowing
primary cells (Fig. 1, E and F), indicating (re)activation
of the germ-line-specific Oct4-GFP marker cassette. As
positive control, the genital ridges were isolated in parallel
and primordial germ cells could be unequivocally detected
by their strong expression of the Oct4-GFP marker (Fig. 1,
A and B). Additional experiments suggested that the microenvironment
of the plasma microdrops played an important
role in stimulating the proliferation of GFP-positive
cells (Fig. 1, G–I). Therefore, subpassages of the outgrowing
cells were cultured in DMEM containing high fetal calf
serum supplementation (30% FCS) and a population of
103 GFP-positive cells (Fig. 1, G–I) could be main-

1022 KUES ET AL.
FIG. 1. Activation of Oct4-promoter in
somatic explants of Oct4-eGFP tg mice.
Genital ridge of a male fetus (PC Day
14.5) with tissue-specific expression of
GFP in the primordial germ cells is shown
under fluorescent (A) and bright-field optics
(B). Bar 150 m. The primordial
germ cells show expression of GFP for 8
days in culture (A, B), no outgrowing GFPpositive
cells could be detected. Outgrowing
cells of a somatic explant, under fluorescent
(C) and bright-field (D) optics after
2 days of culture. No GFP-positive cells
were found. In the upper left, the explant
is visible. After 8 days in culture, several
GFP-positive cells were detectable within
the outgrowing cells (E, F). Bar 140 m.
Confocal analysis of murine FSSCs cultured
in medium with high serum supplementation:
(G) fluorescent, (H) bright-field,
and (I) merged images; bar 10 m. The
GFP is preferentially located in the cytoplasm,
probably because it doesn’t contain
a nuclear localization motif. J) RT-PCR detection
of endogenous Oct4, Stat3, and
Tnap transcripts in murine FSSCs; M, DNA
ladder; lane 1: FSSCs; lane 2: no RT; lane
3: ES cells; lane 4: no RT; lane 5: no template
control.
tained. Expression of the endogenous Oct4 gene was confirmed
by RT-PCR (Fig. 1J). Oct4 is one of the best characterized
genes for stemness. The presence of Oct4 transcripts
has been shown by two independent assays in this
study. The absence of a PCR product from fibroblast cultures
argues against the amplification of an Oct4 pseudogene.
In addition, the tissue nonspecific variant of alkaline
phosphatase (TNAP) and Stat3 were expressed in high serum-supplemented
cultures as determined by RT-PCR (Fig.
1); in contrast, no expression of the embryonic or intestinal
AP genes could be detected (not shown).
In Vivo Differentiation Potential by Injection of FSSCs
into Blastocysts
To determine the developmental potential, FSSCs were
injected into murine blastocysts, which were subsequently
transferred to pseudopregnant recipients. FSSCs of both
sexes were isolated from double transgenic fetuses of OG2
and Rosa26 mouse strains. These cells carried the germlinespecific
Oct4 GFP and the ubiquitously active lacZ reporter
gene constructs and thus allowed distinguishing them from
the cells of the recipient blastocysts.
Day 10.5–15.5 fetuses derived from the injected blas-
tocysts were isolated and analyzed for chimerism either by
staining for lacZ activity or by fluorescence microscopy to
identify GFP-positive cells. Of a total of 19 analyzed fetuses,
7 contained progeny cells from the injected FSSCs
(Table 1). Chimerism was detected in mesenchymal organs,
such as liver, muscle, and tongue, but also in the genital
ridges. Figure 2A shows an example of a chimeric fetus
with massive lacZ staining in liver, tongue, and genital ridges,
suggesting that at least parts of these organs were derived
from the injected cells. Chimeric and wildtype fetuses
were derived from embryo transfers that had been performed
on the same day, were stained for LacZ activity in
parallel, and photographed on the same slide. It is unclear
whether the apparent oversize of the chimeric fetus is related
to the cell injection. The summarized data for the
blastocyst transfer suggest that development of embryos after
FSSC injection is compromised (Table 1). Figure 2B
shows the presence of GFP-positive cells in the genital
ridges of a male PC Day 15.5 fetus. In total, 16 GFP-positive
cells were counted in the squeeze preparation, and
these cells behaved like prospermatogonia in that they floated
within the ducts of the genital ridges. GFP-positive cells
were not found in other organs, such as heart, liver, brain,
or connective tissue.

FETAL SOMATIC STEM CELLS
TABLE 1. Generation of chimeric fetuses by injection of FSSCs into recipient blastocysts.*
No. injected FSSCs
6–8
10–15
2–5
6–8
10–15
Control blastocysts
w/o cell injection
* NA, not applicable.
Transgenic
background
Rosa26
Rosa26
Rosa26/OG2
Rosa26/OG2
Rosa26/OG2
Isolation of FSSCs from Porcine Tissues
No. of
blastocysts
transferred
57
6
24
49
20
Recovered
fetuses
4
1
5
9
0
Chimeric
fetuses Assay Positive cells found in
0of4
1of1
3of5
2of7
1of2
wt 29 14 0 of 9
0of5
The isolation of FSSCs with stem-like properties from
murine somatic explants raised the question whether this is
a species-specific phenomenon or whether similar cells
could be obtained from other species. Therefore, somatic
explants of porcine fetuses (PC Day 25) were established
and subpassaged once using standard protocols. Immunostaining
showed uniform labeling for vimentin and no labeling
for cytokeratin (data not shown), suggesting that
most of the cells were fibroblasts. However, culture in
DMEM with high serum supplementation activated the porcine
OCT4 gene (Fig. 3M). Porcine OCT4 was amplified
with intron spanning porcine-specific primers; the obtained
—
LacZ:
LacZ:
LacZ:
LacZ:
OG2:
LacZ:
OG2:
none
liver, genital ridge, tongue
mesoderm, sev. organs, low chimerism
mesoderm, sev. organs, low chimerism
genital ridge
NA
some background in spinal cord
—
1023
PCR product was purified, sequenced, and found to be
identical to the corresponding OCT4 cDNA sequence. Control
cultures maintained in DMEM/10% FCS did not express
detectable OCT4 mRNA levels
With high serum concentrations, the cultures grew faster
and lost contact inhibition, resulting in the formation of
three-dimensional colonies (Fig. 3, A and B). Only cells
within the three-dimensional colonies continued to proliferate
as measured by BrdU incorporation, whereas cells in
the surrounding monolayers were mitotically inactive (Fig.
3D). Staining for endogenous AP activity revealed a massive
induction of AP-positive cells, almost exclusively associated
with the three-dimensional colonies (Fig. 3, G–J).
FIG. 2. Generation of chimeric fetuses by
FSSC injection into blastocysts. A) Wholemount
staining for LacZ activity in a control
fetus (left) and a fetus (PC Day 15.5)
derived from a FSSC (Rosa26/OG2)-injected
blastocyst (right). Note the -galactosidase
staining in liver (arrow) and genital
ridge (arrowheads) of the chimeric fetus.
B) Oct4 promoter driven expression of
GFP in the genital ridges of a chimeric fetus
(PC Day 15.5) derived from a FSSC
(Rosa26/OG2)-injected blastocyst (left).
Genital ridge from a control OG2/Rosa26
fetus (right). Bar 20 m. C) Higher magnification
of a GFP-positive cell (top) in
the genital ridge of a chimeric fetus (PC
Day 15.5) and corresponding phase-contrast
image (bottom). Bar 20 m.

1024 KUES ET AL.
FIG. 3. Induction of three-dimensional
growth and AP-positive cells in porcine
FSSCs. A) Three-dimensional-colony
growth of porcine FSSCs (passage 3, 5
days) in culture medium with high serum
supplementation, (B) same view as in A
with Hoechst 33324-stained nuclei under
ultraviolet excitation. Bar 20 m for A–
F; it is displayed in D. C) Control culture
of the same cell batch cultured in standard
medium (10% FCS, 5 days). D) BrdU incorporation
in high serum cultures (5 days,
30% FCS). Note that only cells within the
three-dimensional colonies (arrows) incorporated
BrdU, the surrounding monolayer
is unlabelled; inset: another three-dimensional
colony. E) BrdU incorporation in
proliferating fibroblasts (three-dimensional,
standard medium with 10% FCS); the majority
of the cells are labeled. F) BrdU incorporation
in confluent fibroblasts (5
days, standard medium), the majority of
the cells became contact inhibited and
stopped proliferating. G–J) Induction of
AP-positive cells, accompanied with thredimensional-colony
growth after 2, 4, 6, 8
days in high serum culture. K) Higher
magnification of AP-positive cells aggregated
in three-dimensional colony (4
days). L) Individual AP-positive cells within
the fibroblast monolayer. Bars 20 m.
M) Species-specific RT-PCR detection of
OCT4 transcripts in porcine FSSCs (top); 1,
DNA ladder with prominent 600-base pair
fragment; lane 2: no template; lane 3: murine
ES cells; lane 4: porcine fibroblasts;
lane 5: porcine FSSCs. As control, transcripts
of the housekeeping gene GAPD
were amplified by RT-PCR (bottom).
AP-positive cells differed (Fig. 3, K and L) from typical
fibroblasts in that they displayed dendritic projections.
These changes were not found in control cultures from
identical batches of cells when grown under standard conditions
with 10% FCS supplementation (Fig. 3C, Table 2).
In total, 6.7% of microwells seeded with 10 cells from high
serum cultures resulted in continuously growing cultures,
suggesting that 1 out of 150 cells was able to initiate clonal
growth. Induction of colony growth and AP expression by
high serum supplementation were abolished by pretreatment
with heat (90C) or trypsin (data not shown).
Adult porcine fibroblasts derived from subdermal tissue
explants of three animals did not display three-dimensionalcolony
growth (Fig. 4) when cultured for 7 days in DMEM/
30% FCS, but the frequency of AP-expressing cells increased
2- to 10-fold over this period (Table 2). In comparison,
when fetal cells were used, a 100- to 1000-fold
increase in AP-positive cells was observed. Induction of
three-dimensional-colony growth and AP expression in porcine
cultures was at least one order of magnitude higher
than that seen in murine cultures (Table 2).
When high serum cultures were split and one part of the
population was returned to standard medium, colony
growth ceased and AP-positive cells disappeared in the

FETAL SOMATIC STEM CELLS
TABLE 2. High serum induction of AP-positive cells and three-dimensional (3D)-colonies in porcine and murine cell isolates.*
Age of donors Tissue source Method n
porcine
Day 25–27 PC
Day 25 PC
0.5–1.5 y
murine
Day 11.5 PC
Day 13.5 PC
Day 14.5 PC
4mo
Mesoderm
Mesoderm
Ear biopsy
Mesoderm
Mesoderm
Mesoderm
Subdermal tissue
Try
Expl
Expl
2
12
3
High serum induced
1025
AP-positive cells (fold
increase compared with
standard cultures) 3D colonies (no./6-well)
250–850
100–1000
2–10
* Try, Trypsinisation of pooled fetuses (n 6–8); Expl, explant cultures from individual fetuses or adult subdermal tissues.
Expl
Expl
Expl
Expl
standard culture within 2–3 subpassages, suggesting that
the induction and proliferation of FSSCs are dependent on
high levels of not-yet-identified serum factors (Fig. 4B).
When high serum cultures were subpassaged five times
in standard medium, the colony growth phenotype was lost
and a switch to high serum medium was no longer associated
with the appearance of three-dimensional growth,
suggesting that the FSSC population had been lost due to
unfavorable conditions.
To narrow down the possibilities of potential factors in
serum responsible for these effects, it was tested whether
purified growth factors could substitute for high serum supplementation.
Porcine FSSC cultures in standard medium
(DMEM 10% FCS) were supplemented with either hLIF,
PDGF, FGF1, ECGF, or insulin. However, none of these
growth factors induced three-dimensional growth or induction
of AP expression compared with approximately 200–
300 colonies in the positive controls (not shown).
In addition, no inhibitory effect of the inhibitory peptides
FGF1 inhibitory peptide, IGF1 analog, PDGF antagonist,
or insulin-receptor [609–702] [29–32] on the FSSC
phenotype could be detected; the peptide supplemented cultures
developed the same number of FSSC colonies as the
positive controls. These data indicate that the examined
growth factors and receptors are not involved in the apparent
pluripotent phenotype induced by the high serum supplementation.
FSSCs Have Increased Proliferative Potential
Culture medium supplemented with high serum resulted
in a dramatically altered growth curve (Fig. 4C). Porcine
FSSC cultures maintained under high serum conditions
grew continuously over a period of 120 days and exceeded
more than 100 cell doublings without reaching a
plateau phase (Fig. 4C). In contrast, standard cultures, i.e.,
DMEM with 10% FCS, were compatible with only 50–60
cell doublings before mitotic activity ceased after approximately
70 days. The FSSCs maintained a diploid status, as
measured by fluorescence-activated cell sorting (Fig. 4D)
and metaphase spreads of cells from passage 20. Thirtytwo
karyotyped nuclei of porcine FSSC cultures contained
the euploid number of 38 chromosomes; only 1 nucleus
with 37 chromosomes was found.
FSSCs Are Capable of Forming Spheroids and Exhibit
Anchorage-Independent Growth
To investigate the growth potential of the colony-forming
cells, porcine three-dimensional colonies of 200–300
3
1
3
1
8
3
11
1.5
100–290
65–340
3–5
0
3–5
0
m diameter were isolated and trypsinized to obtain singlecell
suspensions. Subsequently, 10 4 cells were seeded into
bacteriological culture dishes. In DMEM/30% FCS, irregular
aggregates consisting of only few cells (2–20), were
detected. These cells did not divide and the majority apparently
underwent cell death (Fig. 4E). Culture medium
supplemented with retinoic acid induced the formation of
tiny aggregates, which, after 2–4 days, attached to the surface
(Fig. 4F). Supplementation of the culture medium
(DMEM/30% FCS) with dexamethasone resulted in aggregation
of small multicellular spheroids within 24 h, which
continued to grow up to a diameter of 400 m after 10–
15 days and contained nearly exclusively AP-positive cells
(Fig. 4, G and H). Dexamethasone is an antiinflammatory
glucocorticoid, which regulates T cell survival, growth, and
differentiation and inhibits the induction of nitric oxide synthase.
Several protocols for differentiation of stem cells also
employed dexamethasone. The dexamethasone-derived
spheroids were capable of forming secondary spheroids if
trypsinized and reseeded in bacteriological dishes. If plated
on gelatinized coverslips, dexamethasone spheroids reattached
and monolayer cells grew out. These outgrowing
cells were vimentin negative, whereas control cultures kept
in standard medium with 10% FCS were strongly positive
(Fig. 4, I and J).
DISCUSSION
The present findings provide compelling evidence for the
presence of a somatic stem cell population in explant cultures
derived from mouse and pig fetuses. The FSSC cells
are characterized by extended proliferative capacity, altered
morphology, expression of stem cell-specific markers, including
Oct4, Stat3, and Tnap and by contact- and anchorage-independent
growth. Chimeric fetuses, obtained by injection
of murine FSSCs into recipient blastocysts, showed
that the FSSCs were able to contribute to various mesenchymal
organs and in particular the genital ridges. Whether
FSSCs show a similar broad spectrum of differentiation potential
as multipotent adult progenitor cells [6] remains to
be shown. As some, albeit few, cells expressed GFP fluorescence
driven by the Oct4 promoter in the chimeric genital
ridges, germ-line transmission might be possible. The
final proof for germ-line transmission by FSSCs would be
the generation of live and fertile chimeric animals. The
finding that GFP-positive cells were not found outside of
the genital ridges indicates that the Oct4 marker was correctly
activated in cells committed to the germ line. It also
suggests that at least some of the FSSC descendants were

1026 KUES ET AL.
FIG. 4. Growth characteristics of FSSCs
in vitro. A) Porcine cultures from fetal and
adult origin of the same batches, respectively,
were split and cultured with high
serum (30%) or standard (10% FCS) conditions
in six-well plates; after 5 days, the
cultures were fixed and stained for endogenous
AP activity. Note the massive induction
of AP-positive three-dimensional colonies
in the fetal culture (red dots). B) The
induction of three-dimensional-colony
growth and AP expression is serum dependent.
After six passages with constant
three-dimensional-colony formation and
AP expression in high serum (30% FCS),
fetal cells were trypsinized, replated, and
cultured for two passages with standard
medium (10% FCS) before AP staining. C)
Growth curves of fetal somatic cells cultured
in standard medium (□) containing
10% FCS and high serum medium ()
containing 30% FCS. D) Cell cycle status
in standard and high serum culture. Note
that the high serum culture displays a normal
ploidy. E, F) Anchorage-independent
growth of FSSCs in suspension culture.
High serum-induced three-dimensional
colonies were isolated, trypsinized to single
cell suspensions, and seeded into bacteriological
dishes to prevent attachment.
E) In DMEM with high serum supplementation,
tiny aggregates formed. F) In high
serum medium with retinoic acid (10 7
M), the initial aggregates reattach and
show outgrowing cells on the surface. G)
In high serum medium with dexamethasone
(10 7 M), spheroids of 300-m size
grow over 10–15 days; inset: lower magnification.
H) Dexamethasone-spheroids
stained for endogenous AP, bar 230
m. I) Expression of vimentin in fibroblasts
cultured in standard medium (passage
5), merged image of antibody (red)
and nuclei (blue) staining (left). J) Loss of
vimentin epitopes in cells derived from
dexamethasone spheroids. After 15 days of
suspension culture, the spheroids were allowed
to reattach to gelatinized coverslips
and probed with a monoclonal antivimentin
antibody.
capable of migrating into the genital ridge. The relatively
low percentage of chimerism might be due to the fact that
the cells used for blastocyst injection were not preselected
for Oct4-GFP expression.
Chimerism was found preferentially in liver, muscle, and
tongue. The LacZ-positive cells in the tongue may actually
represent lymphatic tissue. It is well known that the fetal
liver contains hepatic as well as migratory hematopoietic
progenitor cells. However, we have not yet determined
which cell types in these three organs are derived from the
injected cells. This is the subject of future studies. No chimerism
was detected in heart and brain, two organs that
showed a high rate of spontaneous cell fusions in a recent
study [12]. However, we cannot fully exclude the possibility
that fusion with differentiated cells might have contributed
to the observed chimerism.
FSSCs represent a rare subpopulation in fetal fibroblast
cultures, and the proliferation of FSSCs critically depends
on the culture conditions, including an autologous feedercell
layer and factors present in bovine serum. The explant
culture is based on microdrops of bovine plasma as an adhesive
support, which seems to be essential for the initial
stimulation of FSSC proliferation. Standard culture media
compositions, with no or low amounts of FCS supplementation,
are associated with a progressive loss of the FSSC
phenotype. These observations show that appearance of
FSSCs is critically dependent on cell-collection method
and/or culture conditions.
At present, it is not clear whether FSSCs represent a
preexisting subpopulation in the fetus or whether they are
the result of a de novo formation induced by the culture
conditions. Potential sources are ectopic primordial germ
cells [19] or fetal tissue-specific stem cells. In humans, it
has been shown that mesenchymal stem cells are present in
a variety of tissues during development, whereas in adults,
they are predominantly found in the bone marrow [33].

Activation of the Oct4 promoter in murine explant outgrowths,
although at lower expression levels than in murine
ES cells, after a few days in culture suggests that the culture
conditions induce this phenotype. We cannot completely
rule out that this reprogramming is attributed to dedifferentiation
of a susceptible, non-lineage-committed cell population
present in fetal tissues. The observed frequency of
1/1000 GFP-positive cells in the in vitro cultures may
actually underestimate the occurrence of FSSCs, as GFP
expression was low and might be around the detection limit.
Clonal growth was found for 1 out of 150 cells and
chimerism was detected in 7 out of 19 fetuses.
In line with the expression of stem cell marker genes,
FSSCs show three-dimensional-colony growth in adherent
culture and spheroid growth in suspension culture, whereas
fibroblasts cease dividing and arrest in the G1 phase of the
cell cycle under these conditions [34–36]. Loss of contactinhibition
and anchorage-independent growth is characteristic
for ES cells or transformed cells [37]. Our data provide
convincing evidence that, unlike many cell lines derived
from tumors or cells transformed by oncogenic agents, the
FSSC subpopulation does not result from spontaneous immortalization
or transformation. FSSCs do not exhibit a crisis
followed by clonal outgrowth, and they show no chromosomal
abnormalities or aneuplodies. The altered growth
characteristics of FSSCs are reversed after exposure to standard
cell culture conditions. Unlike rodent cell cultures,
cells from humans and livestock rarely, if ever, immortalize
spontaneously [38]. Our findings show that FSSCs can be
efficiently and reliably isolated from porcine, but also from
bovine and ovine, fetal explants (data not shown) and with
a lower efficiency from murine fetal explants. The diminished
efficiency of FSSC stimulation from murine explant
cultures may be attributed to the species specificity of factors
present in bovine serum.
In conclusion, this study shows that explants from fetal
somatic tissues contain a subpopulation of potentially pluripotent
stem cells, which fulfill most of the essential criteria
for stem cells, including self-renewal ability, multilineage
differentiation, and differentiation in vivo [39]. Therefore,
the FSSCs might hold great promise for regenerative
therapies.
ACKNOWLEDGMENTS
The authors thank Erika Lemme for advice on blastocyst injection. We
gratefully acknowledge critical discussion and the gift of the OG2-transgenic
mouse line from Hans Schöler.
REFERENCES
1. Weissman IL. Stem cells: units of development, units of regeneration
and units of evolution. Cell 2000; 100:157–168.
2. Shih CC, Weng Y, Mamelak A, LeBon T, Hu MC, Forman SJ. Identification
of a candidate human neurohematopoietic stem-cell population.
Blood 2001; 98:2412–2422.
3. Tropepe V, Coles BL, Chiasson BJ, Horsford DJ, Elia AJ, McInnes
RR, van der Kooy D. Retinal stem cells in the adult mammalian eye.
Science 2000; 287:2032–2036.
4. Bjornson C, Rietze RL, Reynolds BA, Magli MC, Vescovi AL. Turning
brain into blood: a hematopoietic fate adopted by adult neural
stem cells in vivo. Science 1999; 283:354–357.
5. Lagasse E, Connors H, Al-Dhalimy M, Reitsma M, Dohse M, Osborne
L, Wang X, Finegold M, Weissman IL, Grompe M. Purified
hematopoietic stem cells can differentiate into hepatocytes in vivo.
Nat Med 2000; 6:1229–1234.
6. Jiang Y, Jahagirdar BN, Reinhardt RL, Schwartz RE, Keene CD, Ortiz-Gonzalez
XR, Reyes M, Lenvik T, Lund T, Blackstad M, Du J,
Aldrich S, Lisberg A, Low WC, Largaespada DA, Verfaillie CM.
FETAL SOMATIC STEM CELLS
1027
Pluripotency of mesenchymal stem cells derived from adult marrow.
Nature 2002; 418:41–49.
7. Clarke DL, Johansson CB, Wilbertz J, Veress B, Nilsson E, Karlstrom
H, Lendahl U, Frisen J. Generalized potential of adult neural stem
cells. Science 2000; 288:1660–1663.
8. Raff M. Adult stem cell plasticity: fact or artifact? Annu Rev Cell
Dev Biol 2003; 19:1–22.
9. Terada N, Hamazaki T, Oka M, Hoki M, Mastalerz DM, Nakano Y,
Meyer EM, Morel L, Petersen BE, Scott EW. Bone marrow cells adopt
the phenotype of other cells by spontaneous cell fusion. Nature 2002;
416:542–545.
10. Ying QL, Nichols J, Evans EP, Smith AG. Changing potency by spontaneous
fusion. Nature 2002; 416:545–548.
11. Wang X, Willenbring H, Akkari Y, Torimaru Y, Foster M, Al-Dhalimy
M, Lagasse E, Finegold M, Olson S, Grompe M. Cell fusion is the
principal source of bone-marrow-derived hepatocytes. Nature 2003;
422:897–901.
12. Alvarez-Dolado M, Pardal R, Garcia-Verdugo JM, Fike JR, Lee HO,
Pfeffer K, Lois C, Morrison SJ, Alvarez-Buylla A. Fusion of bonemarrow-derived
cells with Purkinje neurons, cardiomyocytes and hepatocytes.
Nature 2003; 425:968–973.
13. Moulin V, Garrel D, Auger FA, O’Connor-McCourt M, Castilloux G,
Germain L. What’s new in human wound-healing myofibroblasts?
Curr Top Pathol 1999; 93:123–133.
14. Chang HY, Chi JT, Dudoit S, Bondre C, van de Rijn M, Botstein D,
Brown PO. Diversity, topographic differentiation, and positional
memory in human fibroblasts. Proc Natl Acad Sci U S A 2002; 99:
12877–12882.
15. Han X, Amar S. Identification of genes differentially expressed in cultured
human periodontal ligament fibroblasts vs. human gingival fibroblasts
by DNA microarray analysis. J Dent Res 2002; 81:399–405.
16. Kues WA, Anger M, Carnwath JW, Paul D, Motlik J, Niemann H.
Cell cycle synchronization of porcine fetal fibroblasts. Effects of serum
deprivation and reversible cell cycle inhibitors. Biol Reprod 2000;
62:412–419.
17. Kues WA, Carnwath JW, Paul D, Niemann H. Cell cycle synchronization
of porcine fetal fibroblasts by serum deprivation initiates an
unconventional form of apoptosis. Clon Stem Cells 2002; 4:231–243.
18. Oback B, Wells D. Donor cells for nuclear cloning: many are called,
but few are chosen. Clon Stem Cells 2002; 4:147–168.
19. Anderson R, Copeland TK, Scholer H, Heasman J, Wylie C. The onset
of germ cell migration in the mouse embryo. Mech Dev 2000; 91:
61–68.
20. Boiani M, Eckardt S, Scholer HR, McLaughlin KJ. Oct4 distribution
and level in mouse clones: consequences for pluripotency. Genes Dev
2002; 16:1209–1219.
21. Scholer HR, Balling R, Hatzopoulos AK, Suzuki N, Gruss P. Octamer
binding proteins confer transcriptional activity in early mouse embryogenesis.
EMBO J 1989; 8:2543–2550.
22. Yeom YI, Fuhrmann G, Ovitt CE, Brehm A, Ohbo K, Gross M, Hubner
K, Scholer HR. Germline regulatory element of Oct4 specific for the
totipotent cycle of embryonal cells. Development 1996; 122:881–894.
23. Pesce M, Schöler HR. Oct4: gatekeeper in the beginnings of mammalian
development. Stem Cells 2001; 19:271–278.
24. Niwa H, Miyazaki J, Smith A. Quantitative expression of Oct3/4 defines
differentiation, dedifferentiation or self-renewal of ES cells. Nat
Genet 2000; 24:372–376.
25. Rosner MH, Vigano MA, Ozato K, Timmons PM, Poirier F, Rigby
PW, Staudt LM. A POU-domain transcription factor in early stem cells
and germ cells of the mammalian embryo. Nature 1990; 345:686–
692.
26. Gotz J, Probst A, Ehler E, Hemmings B, Kues W. Delayed embryonic
lethality in mice lacking protein phosphatase 2A catalytic subunit Calpha.
Proc Natl Acad Sci U S A 1998; 95:12370–12375.
27. Kues WA, Brenner HR, Sakmann B, Witzemann V. Local neurotrophic
repression of gene transcripts encoding fetal AChRs at rat neuromuscular
synapses. J Cell Biol 1995; 130:949–957.
28. Friedrich G, Soriano P. Promoter traps in embryonic stem cells: a
genetic screen to identify and mutate developmental genes in mice.
Genes Dev 1991; 5:1513–1523.
29. Yayon A, Aviezer D, Safran M, Gross JL, Heldman Y, Cabilly S,
Givol D, Katchalski-Katzir E. Isolation of peptides that inhibit binding
of basic fibroblast growth factor to its receptor from a random phageepitope
library. Proc Natl Acad Sci U S A 1993; 90:10643–10647.
30. Pietrzkowski Z, Wernicke D, Porcu P, Jameson BA, Baserga R. Inhibition
of cellular proliferation by peptide analogues of insulin-like
growth factor 1. Cancer Res 1992; 52:6447–6451.

1028 KUES ET AL.
31. Engstrom U, Engstrom A, Ernlund A, Westermark B, Heldin CH.
Identification of a peptide antagonist for platelet-derived growth factor.
J Biol Chem 1992; 267:16581–16587.
32. Naranda T, Goldstein A, Olsson L. A peptide derived from an extracellular
domain selectively inhibits receptor internalization: target sequences
on insulin and insulin-like growth factor 1 receptors. Proc
Natl Acad Sci U S A 1997; 94:11692–11698.
33. Caplan AI, Bruder SP. Mesenchymal stem cells: building blocks for
molecular medicine in the 21st century. Trends Mol Med 2001; 7:
259–264.
34. Holley RW, Kiernan JA. ‘‘Contact inhibition’’ of cell division in 3T3
cells. Proc Natl Acad Sci U S A 1968; 60:300–304.
35. Todaro GJ, Lazar GK, Green H. The initiation of cell division in a
contact-inhibited mammalian cell line. J Cell Physiol 1965; 66:325–
333.
36. Otsuka H, Moskowitz M. Arrest of 3T3 cells in G1 phase in suspension
culture. J Cell Physiol 1975; 87:213–220.
37. Layer PG, Robitzki A, Rothermel A, Willbold E. Of layers and
spheres: the reaggregate approach in tissue engineering. Trends Neurosci
2002; 25:131–134.
38. Rubin H. Multistage carcinogenesis in cell culture. Dev Biol (Basel)
2001; 106:61–67.
39. Verfaillie C. Adult stem cells: assessing the case for pluripotency.
Trend Cell Biol 2002; 12:502–508.

Bovine ICM Derived Cells Express
the Oct4 Ortholog
MOLECULAR REPRODUCTION AND DEVELOPMENT
PREM S. YADAV, 1,2 WILFRIED A. KUES, 1 DORIS HERRMANN, 1 JOSEPH W. CARNWATH, 1
AND HEINER NIEMANN 1 *
1 Department of Biotechnology, Institute for Animal Breeding (FAL) Mariensee, Neustadt, Germany
2 Department of Physiology and Reproduction, Central Institute for Research on Buffaloes, Hisar, Haryana, India
ABSTRACT The goal of this study was to
define conditions for the successful isolation of embryonic
stem cells from bovine blastocysts. Expression
of the Pit-Oct-Unc (POU) transcription factor Oct4 was
employed to monitor the pluripotent status of cultured
cells. No expression of the previously identified bovine
Oct4 pseudogene was found, and transcription of the
Oct4 ortholog correlated with the proliferative potential
of bovine ICM derived cells. Two methods to isolate
pluripotent inner cell mass were compared; 90% of
trypsin isolated ICMs formed growing cultures,
whereas only 12%–23% of the ICMs isolated by immunosurgery
attached and grew. Colony formation
from complete blastocysts was 55%. The bovine ICM
derived cells could be grown for 4–7 passages. However,
Oct4 transcripts were only present in the primary
cultures, indicating that the initial culture period of
bovine ICM derived cells is critical and needs to be
optimized to yield true ES cells. In contrast to bovine
ICMs, murine ICMs yielded rapidly growing cells,
which proliferated for more than 60 passages. Mol.
Reprod. Dev. ß 2005 Wiley-Liss, Inc.
Key Words: embryonic stem cells; bovine Oct4;
pseudogene
INTRODUCTION
Embryonic stem cells are derived from the inner cell
mass of blastocysts and are pluripotent, that is, can
differentiate into any cell type in the body including
gametes (Weissman, 2000; Rossant, 2001). Application
of these cells to study fundamental events in embryonic
development, to produce therapeutic delivery systems,
and to test drugs in pharmaceutical research has made
this a rapidly growing area of research (Lovell-Badge,
2001). Evans and Kaufman (1981) were the first to
establish a method for growing stem cells from mouse
embryos indefinitely in the laboratory, while Thomson
et al. (1998) developed the first human embryonic stem
cell line. No true pluripotent ES cells with germ line
contribution have been established from mammals
other than mouse (Thomson and Marshall, 1998;
Niemann and Kues, 2000; Saito et al., 2004; Wolf et al.,
2004). Bovine ES-like cells have been reported by
ß 2005 WILEY-LISS, INC.
several laboratories. The time period over which these
cells could be maintained in culture varied from 13
weeks to 3 years and chimera formation has been
described with cells from passages 3–10 (Evans et al.,
1990; Sims and First, 1993; Stice et al., 1996; Cibelli
et al., 1998; Talbot et al., 2000; for review see Gjørret and
Maddox-Hyttel, 2005).
The correct expression level of Oct4 is considered a key
marker for pluripotent cells in the mouse because it is
essential for maintenance of an undifferentiated state
(Niwa et al., 2000; Pesce and Schöler, 2001). Oct4, a
transcription factor of the Pit-Oct-Unc (POU) family, is
expressed in pluripotent cells of preimplantation
embryos and in all cells of the germ line. In the mouse,
Oct4 is present in all embryonic cells up to the morula
stage; and becomes restricted to the ICM cells in
blastocysts (Nordhoff et al., 2001; Pesce and Schöler,
2001). Orthologous genes have been identified in the
genome of humans, primates, and domestic species.
Whereas the bovine Oct4 mRNA follows the same
pattern of expression as in the mouse during preimplantation
development, bovine, and porcine Oct4 proteins
are apparently not restricted to the pluripotent
ICM cells of blastocysts, but have also been detected in
trophectoderm and in all cells of primary blastocyst
outgrowths (van Eijk et al., 1999; Kirchhof et al., 2000;
Kurosaka et al., 2004). Moreover, van Eijk et al. (1999)
isolated a bovine Oct4 pseudogene, which was not
known from the mouse system and RT-PCR data
suggested that the pseudogene might be expressed in
bovine embryos (van Eijk et al., 1999). These latter data
compromised the usefulness of Oct4 as a marker for
pluripotency in livestock species.
The availability of ES cells from farm animals would
permit the extension of studies using murine cells, as
human embryos and ES cells are constrained by legal
and ethical restrictions. A procedure for the isolation of
bovine ES cells would facilitate transgenic approaches
Grant sponsor: Deutsche Forschungsgemeinschaft (DFG).
*Correspondence to: Prof. Heiner Niemann, Department of Biotechnology,
Institute of Animal Breeding (FAL), Mariensee, 31535
Neustadt, Germany. E-mail: niemann@tzv.fal.de
Received 7 February 2005; Accepted 1 June 2005
Published online in Wiley InterScience
(www.interscience.wiley.com).
DOI 10.1002/mrd.20343

2 P.S. YADAV ET AL.
in agriculture and biomedicine (Kues and Niemann,
2004). An important precondition for the isolation of
livestock ES cells is the availability of a suitable marker
for pluripotency. In the present study, bovine ICM cells
were isolated and cultured, and the usefulness of Oct4 as
a bovine stem cell marker was assessed. For comparison,
murine ES cells were derived from mouse blastocysts
and cultured in parallel.
MATERIALS AND METHODS
Isolation of Feeder Cells
A bovine fetus (estimated age 110 days p.c.) was
obtained from a commercial slaughterhouse and kept in
PBS. The fetus was decapitated, eviscerated, and small
(>1 mm 3 ) pieces of sub-dermal tissue were prepared.
These tissue explants were placed in microdrops of recalcified
bovine plasma and incubated for 1 hr to allow
coagulation of the plasma prior to adding culture
medium (87% Dulbecco’s Modified Eagles Medium
(DMEM, PAA, Cölbe, Germany) and 10% fetal calf
serum (batch: 40F2342K, untreated, Gibco, Karlsruhe,
Germany), 1% nonessential amino acids (Sigma, Deisenhofer,
Germany), 1% vitamin solution (Sigma), 1%
antibiotics, 2 mM glutamine, and 0.1 mM mercaptoethanol.
Subconfluent cultures were trypsin-EDTA treated
and subpassaged for cell multiplication (Kues et al.,
2000, 2005). The harvested cells were frozen in aliquots
using a mixture of 90% culture medium and 10%
dimethylsulfoxid; frozen aliquots were thawed and
grown to confluency and then treated with 10 mg/ml
mitomycin C (Sigma) for 3 hr. The mitomycin C treated
cells were frozen in small aliquots, and seeded 1 day
prior usage as feeder cells. Sufficient stocks of the feeder
fibroblasts were created and frozen in liquid nitrogen to
provide an identical feeder layer for all experiments.
In Vitro Production of Bovine Blastocysts
Bovine blastocysts were produced in vitro (Eckert and
Niemann, 1995; Holm et al., 1999; Wrenzycki et al.,
2001). Briefly, ovaries were collected from a local
slaughterhouse and transported to the laboratory in
an insulated container at 25–308C in PBS. Oocytes were
isolated by slicing the ovaries in PBS containing heparin
and 1% BSA. The oocytes were matured in TCM 199
(Sigma) containing 0.2 mM L-glutamine and 25 mM
HEPES. For oocyte maturation, TCM199 containing
0.1% fatty acid free BSA (Sigma, A7030) medium was
supplemented with 10 IU/ml eCG and 5 IU hCG/ml
(Suigonan, Intervet, Germany) for 24 hr in a CO2 incubator. Cumulus oocyte complexes (COC) were
cultured in groups of 15–20 in 100 ml maturation drops
under silicone oil in a humidified atmosphere composed
of 5% CO2 in air at 398C for 24 hr. Matured oocytes were
rinsed in fertilization medium (Fert-TALP supplemented
with 6 mg/ml BSA) and fertilized in Fert-TALP
containing 10 mM hypotaurine (Sigma), 1 mM epinephrine
(Sigma), 0.1 IU/ml heparin (Serva, Heidelberg,
Germany), and 6 mg/ml BSA. Frozen thawed semen
from bulls of proven fertility was used for IVF. The final
sperm concentration added per drop of 100 ml containing
10–15 oocytes was 1 10 6 sperm cells/ml. Fertilization
took place over 18 hr co-culture of sperm and oocytes.
Presumptive zygotes were cultured in 30 ml of synthetic
oviduct fluid (SOF) supplemented with 1% BSA. Embryos
were cultured in mixture of 5% CO 2,7%O 2, 88%
N 2 (Air Products, GmbH Hattingen, Germany) in
modular incubator chambers (615300 ICN Biomedical,
Inc., Aurora OH). Expanded blastocysts were harvested
on day 8 of development (day 0 ¼ IVF).
Isolation of Inner Cell Masses
From Blastocysts
The inner cell masses (ICM) were isolated either by
trypsin treatment or by immunosurgery. In both cases,
the zona pellucida was first removed by incubation in
1.0% pronase (Sigma, P6911) in PBS (w/v) until it
dissolved. For trypsin isolation, zona free blastocysts
were transferred into 0.25% trypsin-EDTA solution and
observed under a microscope until the trophectoderm
cells became loose, and were shed from the ICM by
pipetting. These ICMs were transferred into PBS and
then seeded on feeder cells. For a modified immunosurgical
isolation of ICMs (Solter and Knowles, 1975), the
zona-free blastocysts were washed three times in PBS
with 1% polyvinyalcohol (PVA) (Sigma P 8136) and
placed in 10 mM trinitrobenzene-sulphonic acid (TNBS)
(Sigma P 2297) in PBS containing 3 mg/ml polyvinylpyrrolidone
for 10 min. After washing in 1% PBS-PVA,
they were treated with rabbit anti dinitrophenyl-BSA
(anti DNP BSA 61-006 ICN Biochemicals, Eschwege,
Germany) diluted 3:7 in PBS for 10 min. The anti-DNP-
BSA crossreacts with trinitrophenol groups. Outer
trophectodermal cells were then lysed with guinea pig
complement serum (Sigma S1639, 1:4) for 15 min. The
isolated ICMs were washed with PBS-PVA and then
seeded on feeder layers. The culture medium for bovine
embryonic cells consisted of 77% DMEM, 20% FCS, 1%
nonessential amino acids, 1% vitamin solution, and 1%
penicillin-streptomycin solution. In some experiments,
the culture medium was supplemented with either LIF
(40–80 ng/ml), hIGF (82 ng/ml), TNF-b (0.12 ng/ml), and
bFGF (4 ng/ml). Culture media were changed every
second day.
Suspension cultures were maintained in hanging
drops. Hanging drops were prepared by placing drops
of 30 ml media on the inner surface of the cover of 6-well
plates. The wells of the 6-well plates were filled with PBS
to prevent drying of drops.
Alkaline Phosphatase Staining
Expression of alkaline phosphatase (AP) was analyzed
in blastocysts, ICMs, and cultured cells. The
specimens were washed twice with PBS before fixing
them in 3.7% paraformaldehyde for 10 min. After
washing with PBS, they were incubated in AP staining
solution (25 mM Tris HCl pH 9.0, 150 mM NaCl, 4 mM
MgCl2; 0.4 mg/ml sodium naphthylphosphate; 1.0 mg/
ml fast red) for 1 hr (Kues et al., 2000). AP positive
stained cells appeared red, while negative cells were
colorless or brownish.

RT-PCR Amplification of Selected Transcripts
Poly(A) þ RNA from groups of 5–10 blastocysts was
isolated using a Dynabeads mRNA DIRECT Kit (Dynal,
Norway, Product number 610.11). Nearly confluent ICM
derived cells in 6-well culture dishes at the 2nd, 3rd, and
4th passage (or 24-well dishes with primary colonies)
were washed twice with PBS, and then stored at 808C
prior to isolation of total RNA. Isolation of RNA from
cells was accomplished with Trizol (1 ml/6-well culture
plate) (Trizol Invitrogen Cat No. 15596026). The Trizol
extracts were transferred to 1.5 ml safe lock tubes and
200 ml of chloroform were added, the aqueous and
organic phase were mixed by shaking prior to centrifugation
for 15 min at 9,700g. The supernatant was
collected and 0.5 ml isopropylalcohol was added per ml
Trizol. The samples were then centrifuged for 15 min,
the supernatant was removed and the RNA pellet was
washed with 1 ml 70% cold ethanol. The pellet was air
dried for several minutes and dissolved in 60 ml RNase
free water. The RNA was treated with RNase-free
DNase for removal of DNA, then the RNA concentration
was measured using a Nanodrop spectrophotometer
(ND-1000 spectrophotometer, Rockland, MD).
The mRNAs were reverse transcribed in a reaction
mixture consisting of 1 RT buffer (50 mM KCl, 10 mM
Tris HCl pH 8.3, Perkin Elmer), 5 mM MgCl2, 1 mM each
of dNTP (Amersham, Brunswick, Germany) 20 IU
RNase inhibitor (Perkin Elmer), and 50 U reverse
transriptase (RT, Perkin Elmer) in a total volume of
20 ml using 1.0 ml of50mMrandom hexamer primers
(Perkin-Elmer, Vaterstetten, Germany). The RT reaction
was carried out at 258C for 10 min and then 428C for
1 hr followed by denaturation at 998C for 5 min. The
polymerase chain reaction was performed with the
reverse transcribed product using one or two embryo
equivalents or 10% of the RT-reaction from cultured
cells. The final volume of the PCR reaction mixture was
50 ml (1 PCR Buffer, 20 mM Tris buffer HCl pH 8.4,
1.5 mM MgCl2, 200 mM dNTPs, 0.25 mM of each primer).
RT-PCR products were separated by electrophoresis on
a 2% agarose gel in 1 TBE buffer (90 mM Tris, 90 mM
borate, 2 mM EDTA, pH 8.3 containing 0.2 mg/ml
ethidium bromide). An image of each gel was recorded
using a CCD camera (Quantix, Photometrics, Munich
Germany). Details of primers are given in Table 1. The
amplicon of the control poly(A) polymerase gene does not
contain an intron, therefore the PCR products using
RNA or genomic DNA as templates are identical. For
sequencing, the DNA bands were cut out under long
wave length UV illumination (365 nm), purified using a
DNA gel band purification kit (Amersham Biosciences,
Freiburg, Germany) and sequenced with the Oct-26
primer (van Eijk et al., 1999).
Isolation and Culture of Mouse
Embryo Derived Cells
Mouse blastocysts were collected by flushing the uteri
of superovulated wildtype or Oct4-GFP transgenic
(OG2) mice at day 3.5 after mating. Oct4 positive transgenic
blastocysts were used for culture or ICM isolation.
ICMs were isolated and cultured as described for bovine
embryos.
RESULTS
Expression of the Bovine Oct4 Gene but not
of the Pseudogene in Bovine Blastocysts
Expression of Oct4 was assessed in bovine embryos
and somatic tissues by RT-PCR with splice-site spanning
primers (Fig. 1A). To determine if the obtained
RT-PCR fragments resulted from amplification of the
Oct4 ortholog or the Oct4 pseudogene, PCR products
were isolated and directly sequenced. The sequences of
the Oct4 ortholog (AF022987) and the Oct4 pseudogene
(AF022988, van Eijk et al., 1999) differ by nucleotide
exchanges at positions 754 and 1,245 (numbering
according to AF022987). The obtained sequences from
bovine blastocysts revealed that blastocysts exclusively
expressed the bovine Oct4 ortholog, whereas control
PCRs with bovine genomic DNA isolated from white
blood cells (Fig. 1B), liver, and kidney amplified exclusively
the pseudogene. No amplification of Oct4 fragments
was obtained from mRNAs isolated from white
blood cells, liver, and kidney (Fig. 1A). Thus the presence
of a bovine Oct4 pseudogene could be verified,
however, no evidence of pseudogene transcription was
found. Together with recent data indicating that Oct4
mRNA expression patterns are conserved between
mammalian species (Kurosaka et al., 2004), this
suggests that Oct4 transcription can indeed be used as
a marker for pluripotent cells in cattle.
TABLE 1. Details of Primers Used for Identification of Bovine Oct-4 Expression
Name of primer Primer sequence
Bovine Oct4 Upper 50-GTT CTC TTT GGA AAG GTG TTC
Lower 50-ACA CTC GGA CCA CGT CTT TC
PolyA polymerase Uppper 50-CCT CAC TGC ACA ATA TGC CGT
CTT CAC CTG
STEM CELLS FROM BOVINE AND MURINE BLASTOCYSTS 3
Gene bank
accession
number
Annealing temp.
(PCR cycles) Reference
AF022987 57 (40) Van Eijk et al.,
1999
X 63436 54 (36) Wrenzycki et al.,
2001
Lower 5 0 -AGC CAA TCC ACT GTT CTC CCA
CCT TTA CTC
Mouse Oct4 Upper 5 0 -GAA CAG TTT GCC AAG CTG CTG X 52437 54 (40) Schöler, 1991
Lower 5 0 -CCG GTT ACA GAA CCATAC TCG

4 P.S. YADAV ET AL.
Fig. 1. Oct4 but not its pseudogene is expressed in bovine
blastocysts. A: Lane 1, RT-PCR amplification of Oct4 from bovine
blastocysts; lane 2 and 3, controls without RT and without template;
lanes 4, 6, 8, and 10, RT-PCR of total RNA from bovine white blood cells,
liver, kidney, and lung; lane 11, PCR Oct4-fragment from genomic
DNA; lanes 5, 7, 9 controls without RT; and lane 12 without template.
Control reactions with primers specific for poly(A) polymerase are
shown below. B: The amplified Oct4 products obtained from blastocyst
mRNAs and genomic DNA were isolated (indicated by white boxes in A)
and sequenced in pools. Short stretches of the sequences containing the
Isolation and Initial Cultures
of Bovine ICM Derived Cells
In the first experiment, 20 intact blastocysts and
50 ICMs isolated by trypsin treatment were cultured
on feeder cells. Intact blastocysts hatched prior to attachment,
and the trypsin isolated ICMs regained a
blastocyst-like shape due to outgrowth of the remaining
trophectodermal cells (Fig. 2A). Different trypsin treatment
times and different enzyme concentrations were
tested. Under conditions, which allowed the survival of
regions of nucleotide mismatches (boxed nt positions) between the Oct4
gene and its pseudogene are shown, the numbering is according to
GenBank accession no AF022987. The sequences derived from
blastocysts match 100% with the Oct4 gene. Both nucleotide exchanges
of the described pseudogene were present in genomic DNA at positions
1,245 and 754. For sequence reactions, the reverse Oct-26 primer was
used, therefore, the noncoding strand is shown. C: Control sequences of
bovine Prnp genes of cattle with known single nucleotide polymorphisms
(SNP). Arrows indicate the SNP positions where signal peaks for
both allele variants are present.
ICMs, the removal of trophectodermal cells was not
complete. The remaining trophectodermal cells produced
blastocyst-like structures with diameters of up
to 500–600 mm before attaching to the feeder cells.
Primary colonies formed after 2 weeks and grew as a
single sheet of cells (Fig. 2B). These sheet-like colonies
were physically separated into small pieces for subpassaging
since trypsin treatment was not effective. In
subcultures, the pieces increased in size before attaching
(Fig. 2C). The typical time for each passage was 10–
12 days. It was found that 55% of the intact blastocysts

Fig. 2. Different growth phenotypes of bovine ICM derived cultures.
A–F: Bovine ICMs and initial cultures. (A) Reexpanded bovine trypsinisolated
ICM before attachment (40 ), (B) Trypsin isolated ICM,
passage 2, sheet like colony (40 ), (C) Passage 2 colony after physical
detachment (40 ), (D) Donut shaped growth in LIF supplemented
formed primary colonies, which could be passaged 4–
5 times. By comparison, 90% of the cells isolated from
trypsin digested ICMs formed primary colonies which
could be passaged 6–7 times over a period of 60–65 days
(Table 2) before proliferation ceased.
STEM CELLS FROM BOVINE AND MURINE BLASTOCYSTS 5
When trypsin isolated ICMs were cultured in medium
with LIF (40 ng/ml) supplementation, they grew into
donut shaped structures (Fig. 2D). The size of the
donut-like structure increased to >1 mm and cells of
two different morphologies became visible. Round
TABLE 2. Comparison of Culture Behavior of Embryo Derived Cells From Intact
Bovine Blastocysts and Trypsin-EDTA Isolated ICMs
Starting material No. of Embryos
Primary colony
formation (%) Passages a
Blastocysts 20 11 (55%) >4
ICMs (trypsin isolated) 50 45 (90%) >7
a Sub-passaging was done when the cells reached 50%–70% confluency.
medium (40 ), (E) Bovine ICM derived by immunosurgery, attached on
feeder cells (200 ), (F) Primary colony growth from immunoisolated
ICM. G–H: Murine ICMs and derived cell cultures: (G) Murine trypsin
isolated ICM, day 13 of attachment (40 ), (H) Proliferating ICM
derived cells at passage 6.

6 P.S. YADAV ET AL.
individual cells were present on the bottom of the
structure, while the surface was composed of tightly
bound cells.
Immunosurgically Isolated ICMs
In the second experiment, bovine ICMs were isolated
by immunosurgery and cultured in DMEM/20% FCS
supplemented with (1) LIF (40 ng/ml), hIGF(2 ng/ml),
TNF-ß (0.12 ng/ml), and bFGF (4 ng/ml); (2) LIF (40 ng/
ml); (3) LIF (80 ng/ml); or (4) without growth factor
supplement. The rate of primary colony formation and
the proportion of proliferating colonies are presented in
Table 3.
Immunosurgically isolated ICMs attached within 3–
4 days after seeding on the feeder layer in all tested
media (Fig. 2E). The initial colonies remained very small
for 1 week, but after 2 weeks in culture, large primary
colonies could be observed (Fig. 2F). In the group grown
in medium containing all four growth factors, 11.5% of
the seeded ICMs produced primary colonies. The group
supplemented with LIF (40 ng/ml) had the highest
percentage of colony formation (21.5%). The morphology
of cells in these colonies was different from that of
enzyme digested ICMs or intact blastocyst colonies.
Trypsin could be used to detach these colonies and the
cultures were passaged after gentle physical separation.
Small clumps of cells were better at attachment and
growth after passaging than individual cells. Most
cells proliferated well in the first four passages and
then grew at a slower rate up to the 6th passage, finally
arresting after 50–60 days. RT-PCR analysis revealed
that only the initial cultures expressed Oct4 mRNA,
from the second passage Oct4 mRNA was no longer
detectable (Fig. 3A,B). The average passage time was
10–14 days. In hanging drops, the floating cells did not
proliferate.
Permanent Culture of Murine
ICM-derived Cells
Day 3.5 p.c. murine blastocysts from wildtype and
Oct4-EGFP (OG2) transgenic mice served as controls to
validate the ICM isolation protocols and culture conditions.
Results were identical for transgenic and nontransgenic
embryos, and ICMs (Table 4). Attachment
rates and primary colony formation for trypsin isolated
murine ICMs were higher than for intact blastocysts.
GFP expression was observed in cells from the OG2transgenic
embryos, but started to diminish from day 4
of culture. In unattached blastocysts, GFP was visible
for up to 10 days in culture. Primary colonies formed
after 10–13 days of culture starting with intact embryos
or ICMs (Fig. 2G). Primary colonies in 24-well plates
were transferred to 6-well plates and then to 25 cm
flasks for amplification (Fig. 2H). ICM derived cells from
three different batches survived for 62, 58, 57 passages,
respectively and could be maintained in culture for more
than 225 days (Table 5). In hanging drops, the cells
formed loose embryoid bodies within 1 week. Without a
feeder cell layer, embryonic cells could attach to the
plastic but growth was slow. Murine ICM derived cells
were negative for AP staining, but expressed Oct4
mRNA at passages 41 and 46 (Fig. 3C).
DISCUSSION
The transcription factor Oct4 is essential for the germ
cell lineage in the mouse where it is required at critical
levels to maintain embryonic stem cells in a pluripotent
state (Niwa et al., 2000; Buehr et al., 2003). The bovine
Oct4 shares high sequence homology with its mouse,
primate, and human orthologs (Nordhoff et al., 2001;
Mitalipova et al., 2003), and has 90.6% and 81.7%
overall identity at the protein level to human and
murine orthologs, respectively. However, in bovine cells,
the usefulness of Oct4 has been questioned by the
identification of a bovine Oct4 pseudogene and suggestions
that this pseudogene might be transcribed in
bovine embryos (van Eijk et al., 1999). The apparent
discrepancy to the data presented here might be due to
the fact that van Eijk et al. (1999) used an indirect
method to discriminate between the pseudogene and
Oct4 mRNA. They employed a mutagenised PCR primer
to introduce a restriction site in the Oct4 amplicon,
followed by EagI digest and gel analysis. In the present
study, Oct4 expression was detected by RT-PCR with
completely matching primers. Direct sequencing of the
PCR product allowed unequivocal discrimination
between the Oct4 ortholog and pseudogene, as they
differ by nucleotide exchanges at positions 754 and
1,245. Our sequence data revealed that bovine blastocysts
expressed exclusively the Oct4 ortholog; expression
of the pseudogene could not be detected in
embryonic or adult tissues such as liver, kidney, and
white blood cells. In contrast, control experiments with
genomic DNA from liver, kidney, and white blood cells,
resulted in successful amplification of the pseudogene,
confirming presence of the pseudogene in the bovine
genome and demonstrating that the PCR conditions are
suitable and sensitive for its detection. Recently, it was
TABLE 3. Proliferation of Bovine Immunosurgically Isolated ICMs in the
Presence of Various Growth Factors
Media
supplements
No. of
trials
No. of
ICMs
No. of
primary
colonies
% primary
colonies
No. of
passages
Days in
culture
LIF, IGF, TNFb, bFGF 11 78 9 11.5 4–6 65
LIF (40 ng/ml) 13 87 19 21.8 4–6 57
LIF (80 ng/ml) 3 33 6 18.2 3 30
None 12 79 13 16.4 4–6 56

Fig. 3. Expression of Oct4 in ICM derived cell cultures. A: Oct4 is
expressed in passage 1 bovine ICM cultures. M, 100 bp ladder; lane 1,
passage 1 bovine ICM cells (day 14 of culture); lane 2 and 3, controls
without RT or template; lane 4, Oct4 PCR with bovine genomic DNA;
lane 5, control without template. B: RT-PCR of Oct4 from passages 2–4.
M, 100 bp ladder, lanes 1, 3, 5 passage 2–4 bovine ICM cells; lanes 2, 4,
6, controls without RT; lane 7, control without template; lane 8, Oct4
shown that the Oct4 mRNA pattern is restricted to ICM
cells in bovine blastocysts as in mice (Kurosaka et al.,
2004). The more widespread distribution of the Oct4
protein in ICM and trophectodermal cells of bovine
blastocysts (van Eijk et al., 1999; Kirchhof et al., 2000)
possibly reflects the prolonged bovine preimplantation
phase compared to that of the mouse. Recent data show
that the Oct4 protein becomes restricted to the embryonic
disc of hatched day 12 bovine embryos which
confirms this view (Gjørret and Maddox-Hyttel, 2005).
Taken together, these observations make Oct4 transcription
a suitable marker for the identification of
pluripotent cells in cattle. During culture of bovine
ICMs, expression of Oct4 mRNA was rapidly lost after
STEM CELLS FROM BOVINE AND MURINE BLASTOCYSTS 7
PCR with bovine genomic DNA; lane 9, control without template. C: RT-
PCR of Oct4 from murine ICM derived cultures employing mouse
specific primers. M, 100 bp ladder, lanes 1 and 2, Oct4 RT-PCR from
passages 41 and 47, lane 3, control without RT; lane 4, control without
template. In parallel, control RT-PCRs with poly(A) polymerasespecific
primers were performed (bottoms).
the first passage, which correlates well with their
limited capacity for self renewal and proliferation.
AP activity has previously been used to identify
pluripotent cells in cultures from livestock species
(Talbot et al., 2000, 1993; Li et al., 2003). In the present
study, intact bovine and murine blastocysts were
positive for AP activity. However, we found that AP
activity was weak or absent in isolated bovine ICMs and
in bovine ICM derived cell cultures. In some colonies of
later passages, a few AP positive cells could be identified.
A similar heterogeneous staining pattern of AP activity
in bovine ICM derived cells had been reported previously
(van Stekelenburg-Hamers et al., 1995; Gjørret
and Maddox-Hyttel, 2005). These observations suggest
TABLE 4. Murine Embryo Derived Cells: Efficiency of Isolation and Development
Starting material No. No. of attached (%) Primary Colony (%)
Transgenic blastocysts 12 3 (25%) 3 (25%)
Nontransgenic blastocysts 10 6 (60%) 4 (40%)
Transgenic ICM 24 17 (91%) 17 (91%)
Nontransgenic ICM 16 16 (100) 14 (87%)

8 P.S. YADAV ET AL.
TABLE 5. Maintenance of Murine Cells in Culture on
Bovine Feeders
Cultures
Number of
days
Number of
passages
Av. time/passage
(days)
1 234 62 3.8
2 227 57 4.0
3 220 58 3.8
that AP expression is not a robust marker for pluripotency
in bovine ICM derived cells.
In the present study, two different methods, trypsin
digestion and immunosurgery, were tested for their
suitability for ICM isolation from bovine blastocysts.
Trypsin digestion had previously been shown to effectively
remove porcine trophectoderm cells (Li et al.,
2003). In the present study, murine and bovine ICMs
isolated with trypsin showed an increased attachment
rate and improved primary colony formation as compared
to intact blastocysts. This substantiates recent
findings for porcine embryos (Li et al., 2003). The trypsin
digestion method yielded a population of murine cells
which could be continuously cultured, while the bovine
system resulted in sheet shaped colonies, in which the
cells had the appearance of trophectoderm, suggesting
that lysis of trophectodermal cells was incomplete.
Trypsin has been reported to be ineffective for
detaching primary ES cell colonies for initial passaging
(Stice et al., 1996; Talbot et al., 2000), and such cultures
are commonly passaged by physical dissociation. In the
present study, primary colonies derived from trypsin
digested ICMs, contained cells of two distinct morphologies.
Individual, round cells were only found in the
central parts of the colonies. Immunosurgery is the
conventional method for isolating ICMs from blastocysts
(Thomson and Marshall, 1998). The morphology of the
cells obtained in the present study after immunosurgery
was quite different from that of cells derived from
trypsin digestion in that individual cells could be easily
distinguished by phase contrast microscopy.
Four different culture media were used after immunosurgical
isolation of ICMs to explore the effect of growth
factors. For immunosurgically isolated ICMs, growth
factors caused variation in attachment and growth, but
only LIF seemed to stimulate colony formation. However,
one has to bear in mind that the medium also
contained fetal calf serum, which may have masked
effects of individual growth factors. When all growth
factors were used together, this resulted in low-primary
colony formation rates, showing that the mixture of
growth factors including LIF did not improve the growth
of cells from the ICMs. The morphology of cells after
growth factor supplementation with or without LIF
remained similar. Recently, a synergistic effect between
bone morphogenetic protein 4 (BMP4) and LIF was
found in maintaining the self renewal of murine ES cells
(Qi et al., 2004). This makes BMP4 a good candidate
molecule for testing on bovine ICM derived cells.
The culture of murine and human stem cells usually
requires the presence of feeder cells (Thomson and
Marshall, 1998; Richards et al., 2002; Amit et al., 2004).
Feeder cells presumably produce growth factors and
other substances that support proliferation and prevent
the differentiation of pluripotent cultured cells (Anderson,
1992). Livestock ES-like cells are also commonly
cultured on feeder cells because the molecular pathways
and key molecules required to maintain pluripotency in
these species are unknown (Wolf et al., 2004). In the
present study, mitomycin-treated bovine fetal fibroblasts
(BFF) from explant cultures (Kues et al., 2005)
were used as a feeder layer. These feeder cells supported
the attachment of intact embryos, ICMs and the proliferation
of bovine ICM cell colony formation for 6–7
passages and murine ICM cell proliferation for more
than 60 passages. Previously, murine embryonic fibroblasts
and STO cells or bovine epithelial layers were
used as feeders for bovine ICM cells (Saito et al., 1992;
van Stekelenburg-Hamers et al., 1995). Successful use
of BFF cells to culture murine ICM cells indicates that
BFF cells could potentially be used as feeder cells for
homologous as well as heterologous ES cells.
In contrast to the limited proliferation of bovine ICM
derived cells, cells from murine blastocysts could be
grown well for more than 200 days over 60 passages on
the same feeder layers and under identical culture
conditions. In the mouse, ES cells appear to arise from
the epiblast cells (Brook and Gardner, 1997); however,
attempts to isolate ES cells from bovine embryonic
discs of day 12 embryos did not result in permanent cell
lines (Gjørret and Maddox-Hyttel, 2005). AP activity in
murine ES cells was negative but the cells expressed
Oct4 in the 41th and 46st passage. The cells formed
embryoid bodies in suspension culture and differentiated
into various cell types when cultured without
feeder cells.
In summary, bovine embryonic fibroblast cells can be
used as feeder cells for both bovine and murine ICM
cells. However, bovine ICM derived cells proliferated for
a limited period. The bovine cells expressed Oct4 only in
primary colonies for up to 2 weeks whereas murine cells
still expressed Oct4 at passage 47, suggesting that the
initial culture conditions for bovine ICMs are critical
and require optimization before permanent bovine ES
cells can be obtained.
ACKNOWLEDGMENTS
The overseas fellowship from the Department of
Biotechnology, the Ministry of Science and Technology
(Government of India) for PY, and funding by the
Deutsche Forschungsgemeinschaft (DFG) to H.N. is
gratefully acknowledged. We are grateful to Karin
Korsawe and Erika Lemme for excellent technical help
to Dieter Bunke for photographical artwork and to Hans
Schöler (Münster) for the gift of OG2 mice.
REFERENCES
Amit M, Shariki C, Margulets V, Itskovitz-Eldor J. 2004. Feeder layerand
serum-free culture of human embryonic stem cells. Biol Reprod
70:837–845.

Anderson GB. 1992. Isolation and use of embryonic stem cells from
livestock species. Anim Biotech 3:165–175.
Brook FA, Gardner RL. 1997. The origin and efficient derivation of
embryonic stem cells in the mouse. Proc Natl Acad Sci USA 94:5709–
5712.
Buehr M, Nichols J, Stenhouse F, Mountford P, Greenhalg C,
Kantachuvesiri S, Brooker G, Mullins S, Smith AG. 2003. Rapid loss
of OCT-4 and pluripotency in cultured rodents and blastocysts
derived cell lines. Biol Reprod 68:222–229.
Cibelli J, Stice SL, Golueke OPJ, Kane JJ, Jerry J, Blackwell W, Ponce
de Leon FA, Robl JM. 1998. Transgenic bovine chimeric offspring
produced from somatic cell-derived stem-like cells. Nat Biotechnol
16:642–646.
Eckert J, Niemann H. 1995. In vitro maturation, fertilization, and
culture to blastocysts of bovine oocytes in protein-free media.
Theriogenology 43:1211–1225.
Evans MJ, Kaufman MH. 1981. Establishment in culture of pluripotential
cells from mouse embryos. Nature 294:154–156.
Evans MJ, Notarianni E, Laurie S, Moor RM. 1990. Derivation and
primary characterization of pluripotent cell lines from porcine and
bovine blastocysts. Theriogenology 33:125–128.
Gjørret JO, Maddox-Hyttel P. 2005. Attempts towards derivation and
establishment of bovine embryonic stem cell-like cultures. Reprod
Fertil Dev 17:113–124.
Holm P, Booth PJ, Schmidt MH, Greve T. 1999. High bovine blastocyst
development in a static in vitro production system using SOF as
medium supplemented with sodium lactate and myo-inositol with or
without serum proteins. Theriogenology 52:683–700.
Kirchhof N, Carnwath JW, Lemme E, Anastassiadis K, Scholer H,
Niemann H. 2000. Expression pattern of Oct-4 in preimplantation
embryos of different species. Biol Reprod 69:1698–1705.
Kues WA, Niemann H. 2004. The contribution of farm animals to
human health. Trends Biotech 22:286–294.
Kues WA, Anger M, Carnwath JW, Paul D, Motlik J, Niemann H. 2000.
Cell cycle synchronization of porcine fetal fibroblasts: Effects of
serum deprivation and reversible cell cycle inhibitors. Biol Reprod
62:412–419.
Kues WA, Petersen B, Mysegades W, Carnwath JW, Niemann H. 2005.
Isolation of murine and porcine fetal stem cells from somatic tissue.
Biol Reprod 72:1020–1028.
Kurosaka S, Eckhardt S, McLaughlin KJ. 2004. Pluripotent lineage
definition in bovine embryos by Oct4 transcript localization. Biol
Reprod 71:1578–1582.
Li M, Zhang D, Hou Y, Jiao L, Zheng X, Wang WH. 2003. Isolation and
culture of embryonic stem cells from porcine blastocyst. Mol Reprod
Dev 65:429–434.
Lovell-Badge R. 2001. Future for stem cells research. Nature 414:
88–97.
Mitalipova SM, Kuo HC, Hennebold JD, Wolf DP. 2003. Oct-4 expression
in pluripotent cells of the rhesus monkey. Biol Reprod 69:1785–
1792.
Niemann H, Kues WA. 2000. Transgenic livestock: Premises and
promises. Anim Reprod Sci 60–61:277–293.
Niwa H, Miyazaki J, Smith AG. 2000. Quantitative expression of Oct3/4
defines differentiation, dedifferentiation or self-renewal of ES cells.
Nat Genet 24:372–376.
STEM CELLS FROM BOVINE AND MURINE BLASTOCYSTS 9
Nordhoff V, Hübner K, Bauer A, Orlova I, Malapesta A, Schöler HR.
2001. Comparative analysis of human, bovine and murine Oct 4
upstream sequences. Mamm Genome 12:309–317.
Pesce M, Schöler HR. 2001. Oct-4: Gate keeper in beginning of
mammalian development. Stem Cells 19:271–278.
Qi X, Li TG, Hao J, Hu J, Wang J, Simmons H, Miura S, Mishina Y,
Zhao GQ. 2004. BMP4 supports self renewal of embryonic stem cells
by inhibiting mitogen-activated protein kinase pathways. Proc Natl
Acad Sci USA 101:6027–6032.
Richards M, Fong CY, Chan WK, Wong PC, Bongso A. 2002.
Human feeders support prolonged undifferentiated growth of human
inner masses and embryonic stem cells. Nat Biotechnol 20:933–
936.
Rossant J. 2001. Stem cells from the mammalian blastocst. Stem Cells
19:477–482.
Saito S, Strelchenko N, Niemann H. 1992. Bovine embryonic stem like
cells cultured over several passages. Roux’s Arch Dev Biol 21:134–
141.
Saito S, Liu B, Yokohama K. 2004. Animal embryonic stem (ES) cells:
Self renewal, pluripotency, transgenesis and nuclear transfer.
Human Cell 17:7–15.
Schöler HR. 1991. Octamania: the POU factors in murine development.
Trends Genet 7:323–329.
Sims MM, First NL. 1993. Production of fetuses from totipotent
cultured bovine inner cell mass cells. Theriogenology 39:313.
Solter D, Knowles BB. 1975. Immunosurgery of mouse blastocysts.
Proc Natl Acad Sci USA 72: 5099–5102.
Stice SL, Strelchenko NS, Keefer CL, Matthews L. 1996. Pluripotent
bovine embryonic cell lines direct embryonic development following
nuclear transfer. Biol Reprod 54:100–110.
Talbot NC, Caperna J, Edwards JL, Gerret W, Wells KD, Ealy AD.
2000. Bovine blastocyst derived trophectoderm and endoderm cell
cultures: Interferon TAU and transferrin expression as respective
in vitro markers. Biol Reprod 62:235–247.
Thomson JA, Marshall VS. 1998. Primate embryonic stem cells. Curr
Top Dev Biol 38:133–165.
Thomson JA, Itskovitz-Elder J, Shapiro SS, Waknitz MA, Swiergiel JJ,
Marshall VS, Jones JM. 1998. Embryonic stem cell line derived from
human beings. Science 282:1145–1147.
van Eijk MJ, van Rooijen MA, Modina S, Scesi L, Folkers G, van Tol HT,
Bevers MM, Fisher SR, Lewin HA, Rakacolli D, Galli C, de Vaureix C,
Trounson AO, Mummery CL, Gandolfi F. 1999. Molecular cloning,
genetic mapping, and developmental expression of Bovine POU5F1.
Biol Reprod 60:1093–1103.
Van Stekelenburg-Hamers AE, Van Achterberg TA, Rebel HG, Flechon
JE, Campbell KH, Weima SM, Mummery CL. 1995. Isolation and
characterisation of permanent cell lines from inner cell mass cells
from bovine blastocysts. Mol Reprod Dev 40:444–454.
Weissman IL. 2000. Stem cells: Units of development, units of
regeneration and units of evolution. Cell 100:157–168.
Wolf DP, Kuo HC, Pau KY, Lester L. 2004. Progress with nonhuman
primate embryonic stem cells. Biol Reprod 71:1766–1771.
Wrenzycki C, Herrmann D, Keskintepe L, Martins A , Jr., Sirisathien
S, Brackett B, Niemann H. 2001. Effects of culture system and
protein supplementation on mRNA expression in pre-implantation
bovine embryos. Hum Reprod 16:893–901.

Rev. sci. tech. Off. int. Epiz., 2005, 24 (1), 285-298
Transgenic farm animals: present and future
Introduction: evolution of
transgenic technologies
The first transgenic livestock were produced almost
20 years ago by microinjection of foreign deoxyribonucleic
acid (DNA) into the pronuclei of zygotes (33). However, as
microinjection has several significant shortcomings –
including low efficiency, random integration and variable
expression patterns related to the site of integration –
research has focused on alternative methodologies for
improving efficiency of generating transgenic livestock
(Table I). These methodologies include:
– sperm-mediated DNA transfer (12, 54, 55)
– intracytoplasmic injection of sperm heads carrying
foreign DNA (71, 72)
– injection or infection of oocytes and/or embryos by
different types of viral vectors (11, 35, 37)
– ribonucleic acid (RNA) interference technology
(small interfering RNA: siRNA) (14)
– the use of nuclear transfer (5, 13, 21, 53, 86).
H. Niemann, W. Kues & J.W. Carnwath
Department of Biotechnology, Institute for Animal Breeding (FAL), Mariensee, 31535 Neustadt, Germany
Summary
Until recently, pronuclear microinjection of deoxyribonucleic acid (DNA) was the
standard method for producing transgenic animals. This technique is now being
replaced by more efficient protocols based on somatic nuclear transfer that also
permit targeted genetic modifications. Lentiviral vectors and small interfering
ribonucleic acid technology are also becoming important tools for transgenesis.
Transgenic farm animals are important in human medicine as sources of
biologically active proteins, as donors in xenotransplantation, and for research
in cell and gene therapy. Typical agricultural applications include improved
carcass composition, lactational performance and wool production, as well as
enhanced disease resistance and reduced environmental impact. Product safety
can be ensured by standardisation of procedures and monitored by polymerase
chain reaction and array technology. As sequence information and genomic
maps of farm animals are refined, it becomes increasingly practical to remove or
modify individual genes. This approach to animal breeding will be instrumental in
meeting global challenges in agricultural production in the future.
Keywords
Agricultural application – Environmental benefit – Farm animal – Gene pharming –
Lentiviral vector – Microinjection – Nuclear transfer – Small interfering ribonucleic acid
– Transgenic – Xenotransplantation.
To date, somatic nuclear transfer, which has been
successful in ten species – albeit at low efficiency (47, 103)
– holds the greatest promise for significant improvements
in the generation of transgenic livestock (Table I). Further
qualitative improvements may be derived from
technologies that allow precise modifications of the
genome, including targeted chromosomal integration by
site-specific DNA recombinases, such as Cre or flippase
(FLP), or methods that allow temporally and/or spatially
controlled transgene expression (9, 45). The first genomes
of farm animals (cattle, chicken) were sequenced and
annotated in 2004 (2, 3). Thus, after approximately
7,000 years of domestic animal selection (16) based on the
random mutations caused by radiation and oxidative
injury to the genome, technology is now available to
introduce or remove known genes with known functions.
Despite the inherent inefficiency of microinjection
technology, a broad spectrum of genetically modified large
animals has been generated for applications in agriculture
and biomedicine (Table II). The use of transgenic livestock
for ‘gene pharming’ has now reached the level of
commercial exploitation (47). This paper provides a brief
summary of the current status of transgenic animal
production and look at future implications. The authors

286
focus on large domesticated species and do not cover the
recent developments in poultry breeding or aquaculture.
Biomedical applications of
transgenic domestic animals
Pharmaceutical production in the mammary
gland of transgenic animals
Gene ‘pharming’ entails the production of recombinant
biologically active human proteins in the mammary glands
of transgenic animals. This technology overcomes the
Table I
Evaluation of gene transfer methodology*
Methodology
Rev. sci. tech. Off. int. Epiz., 24 (1)
limitations of conventional and recombinant production
systems for pharmaceutical proteins (63, 82) and has
advanced to the stage of commercial application (27, 107).
The mammary gland is the preferred production site,
mainly because of the quantities of protein that can be
produced in this organ using mammary gland-specific
promoter elements and established methods for extraction
and purification of that protein (63, 82).
Guidelines developed by the Food and Drug Administration
(FDA) in the United States of America (USA) require
monitoring of the animals’ health, sequence validation of the
gene construct, characterisation of the isolated recombinant
protein, and monitoring of the genetic stability of the
Animal Site of Integration Homologous Multiple Maximum construct Founder Technical
usage integration prescreening recombination transgenes size limitation mosaicism difficulty
Microinjection High Random No No Inefficient Artificial chromosomes Yes
Somatic nuclear transfer Low Prescreened Yes Possible Yes Transfection limited/
artificial chromosomes
No
Implantation of transgenic
spermatogonia
Low Random Yes Not yet Not yet Transfection limited No
Lentivirus injection Low Random No No Yes ~ 5 kb Yes
Sperm-mediated gene
transfer method
Low Random No No Inefficient Not known Not known
* all grading is based on the fully matured technology
Table II
Current status of transgenesis in livestock
Area of application
Biomedicine
Gene pharming
Antibody production
Xenotransplantation
Solid organs
Cells/tissues
Blood replacement
Disease model
Agriculture
Carcass composition
Leaner meat
Healthful lipids
Lactational performance
Environmental impact
Wool production
Disease resistance
Fertility
Early experimental Experimental Advanced Transition experiments/ Practical
phase stage experimental stage practical use use

Rev. sci. tech. Off. int. Epiz., 24 (1) 287
transgenic animals over several generations. This has
necessitated, for example, the use of animals from scrapiefree
countries (New Zealand) and the maintenance of
production animals under strict hygienic conditions.
Products derived from the mammary gland of transgenic
goats and sheep, such as antithrombin III (ATIII),
α-antitrypsin or tissue plasminogen activator (tPA), have
progressed to advanced clinical trials (47). Phase III trials
for a recombinant human ATIII product have been
completed and an application has been filed for European
Market Authorisation. The protein is expected to be
registered and on the market by the end of 2005. The
product is employed for the treatment of heparin-resistant
patients undergoing cardiopulmonary bypass procedures.
At the same company that manufactures this product,
11 transgenic proteins have been expressed in the
mammary gland of transgenic goats at more than one gram
per litre. The enzyme α-glucosidase from the milk of
transgenic rabbits has orphan drug status and has been
successfully used for the treatment of Pompe’s disease (94)
(in the USA the term ‘orphan drug’ refers to a product that
treats a rare disease affecting fewer than
200,000 Americans). Similarly, recombinant C1 inhibitor
produced in the milk of transgenic rabbits has completed
phase III trials and is expected to receive registration within
the next 24 months. A topical antibiotic against Streptococcus
mutans, for prevention and treatment of dental caries, has
completed phase III trials and should be launched shortly.
The global market for recombinant proteins from domestic
animals is expected to exceed US$1 billion in 2008 and to
reach US$18.6 billion in 2013.
Some gene constructs have failed to produce economically
significant amounts in the milk of transgenic animals,
indicating that the technology needs further refinements to
achieve high-level expression. This is particularly true for
genes that have complex regulation, such as those coding
for erythropoietin or human clotting factor VIII (36, 41,
62, 67). With the advent of transgenic crops that produce
pharmacologically active proteins, there is now an array of
recombinant technologies that will allow selection of the
most appropriate production system for each required
protein (58). The production of edible vaccines in
transgenic crop plants against, for example, foot and
mouth disease, might become an important application for
animal health (102).
Antibody production in transgenic animals
Numerous monoclonal antibodies are being produced in
the mammary gland of transgenic goats (63). Cloned
transgenic cattle produce a recombinant bispecific
antibody in their blood (31). Purified from serum, the
antibody is stable and mediates target cell-restricted T cell
stimulation and tumour cell killing. An interesting new
development is the generation of trans-chromosomal
animals. A human artificial chromosome containing the
complete sequences of the human immunoglobulin heavy
and light chain loci was introduced into bovine fibroblasts,
which were then used in nuclear transfer. Transchromosomal
bovine offspring were obtained that
expressed human immunoglobulin in their blood. This
system could be a significant step forward in the
production of human therapeutic polyclonal antibodies
(51). Further studies will show whether the additional
chromosome will be maintained over future generations
and how stable expression will be.
Blood replacement
Functional human haemoglobin has been produced in
transgenic swine. The transgenic protein could be purified
from the porcine blood and showed oxygen-binding
characteristics similar to natural human haemoglobin. The
main obstacle was that only a small proportion of porcine
red blood cells contained the human form of haemoglobin
(90). Alternative approaches to produce human blood
substitutes have focused on the chemical cross-linking of
haemoglobin to the superoxide-dismutase system (20).
Xenotransplantation of porcine organs to
human patients
Today more than 250,000 people are alive only because of
the successful transplantation of an appropriate human
organ (allotransplantation). However, progress in organ
transplantation technology has led to an acute shortage of
appropriate organs, and cadaveric or live organ donation
does not meet the demand in Western societies. To close
the growing gap between demand and availability of
appropriate human organs, porcine xenografts from
domesticated pigs are considered to be the best alternative
(47, 77). Essential prerequisites for successful
xenotransplantation are:
– overcoming the immunological hurdles
– preventing the transmission of pathogens from the donor
animal to the human recipient
– ensuring the compatibility of the donor organs with
human anatomy and physiology.
The major immunological obstacles in porcine-to-human
xenotransplantation are:
– hyperacute rejection (HAR)
– acute vascular rejection (AVR)
– cellular rejection, and eventually
– chronic rejection (101).

288
Hyperacute rejection occurs within seconds or minutes,
when, in the case of a discordant organ (e.g. in
transplanting from pig to human), pre-existing antibodies
react with antigenic structures on the surface of the porcine
cells and activate the complement cascade; in other words,
the antigen-antibody complex triggers formation of the
membrane attack complex. Induced xenoreactive
antibodies are thought to be responsible for AVR, which
occurs within days after transplantation of a xenograft;
disseminated intravascular coagulation (DIC) is a
predominant feature of AVR (17, 52). Human
thrombomodulin and heme-oxygenase 1 are crucially
involved in the etiology of DIC and are targets for future
transgenic modifications to improve the long-term survival
of porcine xenografts by creating multi-transgenic pigs.
When using a discordant donor species such as the pig,
overcoming HAR and AVR are the pre-eminent goals.
Two main strategies have been successfully explored for
long-term suppression of HAR: synthesis of human
regulators of complement activity (RCAs) in transgenic
pigs (18, 77) and the knockout of α-gal epitopes, the
antigenic structures on the surface of the porcine cells that
cause HAR (52, 74, 105). Survival rates, after the
transplantation of porcine hearts or kidneys expressing
transgenic RCA proteins to immunosuppressed nonhuman
primates, reached 23 to 135 days, indicating that
HAR can be overcome in a clinically acceptable manner
(4). The successful xenotransplantation of porcine organs
with a knockout of the 1,3-α-galactosyltransferase gene,
eliminating the 1,3-α-gal-epitopes produced by the
1,3-α-galactosyltransferase enzyme, has recently been
demonstrated. Upon transplantation of porcine hearts or
kidneys from these α-gal-knockout pigs to baboons,
survival rates reached two to six months (52, 105). A
particularly promising strategy to enhance long-term graft
tolerance is the induction of permanent chimerism via
intraportal injection of embryonic stem (ES) cells (28) or
the co-transplantation of vascularised thymic tissue (105).
Recent findings have revealed that the risk of porcine
endogenous retrovirus transmission is negligible and show
that this critical danger could be eliminated, paving the
way for preclinical testing of xenografts (47). Despite
further challenges, appropriate lines of transgenic pigs are
likely to be available as organ donors within the next five
to ten years. Guidelines for the clinical application of
porcine xenotransplants are already available in the USA
and are currently being developed in other countries. The
general consensus of a worldwide debate is that the
technology is ethically acceptable provided that the
individual’s well-being does not compromise public health.
Economically, xenotransplantation will be viable, as the
enormous costs of maintaining patients suffering from
severe kidney disease using dialysis or supporting those
suffering from chronic heart disease could be reduced by a
functional kidney or heart xenograft.
Rev. sci. tech. Off. int. Epiz., 24 (1)
Farm animals as models for human diseases
Mouse physiology, anatomy and life span differ
significantly from those of humans, making the rodent
model inappropriate for many human diseases.
Farm animals, such as pigs, sheep or even
cattle, may be more appropriate models in which to
study potential therapies for human diseases that
require longer observation periods than those possible in
mice, e.g. atherosclerosis, non-insulin-dependent diabetes,
cystic fibrosis, cancer and neuro-degenerative disorders
(34, 56, 70, 92). Cardiovascular disease is an increasing
health problem in aging Western societies, where coronary
artery diseases account for the majority of deaths. Because
genetically modified mice do not manifest myocardial
infarction or stroke as a result of atherosclerosis, new
animal models, such as swine that exhibit these
pathologies, are needed to develop effective therapeutic
strategies (32, 80). An important porcine model has been
developed for the rare human eye disease retinitis
pigmentosa (PR) (73). Patients with PR suffer from night
blindness early in life, a condition attributed to a loss of
photoreceptors. Transgenic pigs that express a mutated
rhodopsin gene show great similarity to the
human phenotype and effective treatments are being
developed (61).
The pig could be a useful model for studying
defects of growth-hormone releasing hormone
(GHRH), which are implicated in a variety of conditions
such as Turner syndrome, hypochrondroplasia,
Crohn’s disease, intrauterine growth retardation or renal
insufficiency. Application of recombinant GHRH
and its myogenic expression has been shown to alleviate
these problems in a porcine model (26). Development
of further ovine and porcine models of human diseases is
underway (29).
An important aspect of nuclear-transfer-derived
large animal models for human diseases and the
development of regenerative therapies is that somatic
cloning per se does not result in shortening of the
telomeres and thus does not necessarily lead to premature
ageing (85). Telomeres are highly repetitive
DNA sequences at the ends of the chromosomes that are
crucial for their structural integrity and function and are
thought to be related to lifespan. Telomere shortening is
usually correlated with severe limitation of the regenerative
capacity of cells, the onset of cancer, ageing and
chronic disease with significant impacts on human
lifespans (85). Expression of the enzyme telomerase, which
is primarily responsible for the formation and rebuilding of
telomeres, is suppressed in most somatic tissues postnatally.
Recent studies have revealed that telomere length is
established early in pre-implantation development by a
specific genetic programme and correlates with telomerase
activity (84).

Rev. sci. tech. Off. int. Epiz., 24 (1) 289
Transgenic animals in
agriculture
Carcass composition
Transgenic pigs bearing a human metallothionein
promoter/porcine growth-hormone gene construct showed
significant improvements in economically important traits
such as growth rate, feed conversion and body fat/muscle
ratio without the pathological phenotype known from
previous growth hormone constructs (69, 78). Similarly,
pigs transgenic for the human insulin-like growth factor-I
had ~30% larger loin mass, ~10% more carcass lean tissue
and ~20% less total carcass fat (79). The commercialisation
of these pigs has been postponed due to the current lack of
public acceptance of genetically modified foods.
Recently, an important step towards the production of
more healthful pork has been made by the creation of the
first pigs transgenic for a spinach desaturase gene that
produces increased amounts of non-saturated fatty acids.
These pigs have a higher ratio of unsaturated to saturated
fatty acids in striated muscle, which means more healthful
meat since a diet rich in non-saturated fatty acids is known
to be correlated with a reduced risk of stroke and coronary
diseases (66, 83).
Lactation
The physicochemical properties of milk are mainly due to
the ratio of casein variants, making these a prime target for
the improvement of milk composition. Transgenic mice
have been developed with various modifications
demonstrating the feasibility of obtaining significant
alterations in milk composition in larger animals, but at the
same time, showing that unwanted side effects can occur
(50, 89).
Dairy production is an attractive field for targeted genetic
modification (44, 106). It may be possible to produce milk
with a modified lipid composition by modulating the
enzymes involved in lipid metabolism, or to increase curd
and cheese production by enhancing expression of the
casein gene family in the mammary gland. The bovine
casein ratio has been altered by over-expression of betaand
kappa-casein, clearly underpinning the potential for
improvements in the functional properties of bovine milk
(8). Furthermore, it may be possible to create
‘hypoallergenic’ milk by knockout or knockdown of the
β-lactoglobulin gene; to generate lactose-free milk by a
knockout or knockdown of the α-lactalbumin locus,
which is the key molecule in milk sugar synthesis; to
produce ‘infant milk’ in which human lactoferrin is
abundantly available; or to produce milk with a highly
improved hygienic standard by increasing the amount of
lysozyme. Lactose-reduced or lactose-free milk would
render dairy products suitable for consumption by the
large numbers of adult humans who do not possess an
active intestinal lactase enzyme system. Although lactose is
the main osmotically active substance in milk and a lack
thereof could interfere with milk secretion, a lactase
construct has been tested in the mammary gland of
transgenic mice. In hemizygous mice, this reduced lactose
contents by 50% to 85% without altering milk secretion
(43). Unfortunately, mice with a homozygous knockout for
α-lactalbumin could not nurse their offspring because of
the high viscosity of their milk (89). These findings
demonstrate the feasibility of obtaining significant
alterations in milk composition by applying the
appropriate strategy.
In the pig, transgenic expression of a bovine lactalbumin
construct in sow milk has been shown to result in higher
lactose contents and greater milk yields, which correlated
with improved survival and development of piglets (100).
Any increased survival of piglets at weaning would provide
significant commercial advantages to the producer.
Wool production
Transgenic sheep carrying a keratin-IGF-I construct
showed that expression in the skin and the amount of clear
fleece was about 6.2% greater in transgenic than in nontransgenic
animals. No adverse effects on health or
reproduction were observed (22, 23). Approaches
designed to alter wool production by transgenic
modification of the cystein pathway have met with only
limited success, although cystein is known to be the ratelimiting
biochemical factor for wool growth (96).
Environmentally friendly farm animals
Phytase transgenic pigs have been developed to address the
problem of manure-related environmental pollution. These
pigs carry a bacterial phytase gene under the
transcriptional control of a salivary-gland-specific
promoter, which allows the pigs to digest plant phytate.
Without the bacterial enzyme, phytate phosphorus passes
undigested into manure and pollutes the environment.
With the bacterial enzyme, fecal phosphorus output was
reduced by up to 75% (30). Developers expect these
environmentally friendly pigs to enter commercial
production in Canada within the next few years.
Transgenic animals and disease resistance
Transgenic strategies to increase disease resistance
In most cases, susceptibility to pathogens originates from
the interplay of numerous genes; in other words,
susceptibility to pathogens is polygenic in nature. Only a

290
few loci are known that confer resistance against a specific
disease. Transgenic strategies to enhance disease resistance
include the transfer of major histocompatibility-complex
genes, T-cell-receptor genes, immunoglobulin genes, genes
that affect lymphokines or specific disease-resistance genes
(64). A prominent example for a specific disease resistance
gene is the murine Mx-gene. Production of the
Mx1-protein is induced by interferon and was discovered
in inbred mouse strains that are resistant to infection with
influenza viruses (88). Microinjection of an interferon- and
virus-inducible Mx-construct into porcine zygotes resulted
in two transgenic pig lines that expressed the
Mx-messenger RNA (mRNA); unfortunately, no Mx protein
could be detected (65). Recently the bovine MxI gene was
identified and shown to confer antiviral activity as a
transgenic construct in Vero cells (6).
Transgenic constructs bearing the immunoglobulin-A
(IgA) gene have been successfully introduced into pigs,
sheep and mice in an attempt to increase resistance against
infections (57). The murine IgA gene was expressed in two
transgenic pig lines, but only the light chains were detected
and the IgA-molecules showed only marginal binding to
phosphorylcholine (57). High levels of monoclonal murine
antibodies with a high binding affinity for their specific
antigen have been produced in transgenic pigs (97).
Attempts to increase ovine resistance to Visna virus
infection via transgenic production of Visna envelope
protein have been reported (15). The transgenic sheep
developed normally and expressed the viral gene without
pathological side effects. However, the transgene was not
expressed in monocytes, the target cells of the viral
infection. Antibodies were detected after an artificial
infection of the transgenic animals (15).
It has also proved possible to induce passive immunity
against an economically important porcine disease in a
transgenic mouse model (10). The transgenic mice secreted
a recombinant antibody in milk that neutralised the corona
virus responsible for transmissible gastroenteritis (TGEV)
and conferred resistance against TGEV. Strong mammarygland-specific
expression was achieved for the entire
duration of lactation. Verification of this work in transgenic
pigs is anticipated in the near future.
Knockout of the prion protein is the only secure way to
prevent infection and transmission of spongiform
encephalopathies like scrapie or bovine spongiform
encephalopathy (98). The first successful targeting of the
ovine prion locus has been reported; however, the cloned
lambs carrying the knockout locus died shortly after birth
(24). Cloned cattle with a knockout for the prion locus
have also been generated (19). Transgenic animals with
modified prion genes will be an appropriate model for
studying the epidemiology of spongiform
encephalopathies in humans and are crucial for developing
Rev. sci. tech. Off. int. Epiz., 24 (1)
strategies to eliminate prion carriers from farm animal
populations.
Transgenic approaches to increase disease
resistance of the mammary gland
The levels of the anti-microbial peptides lysozyme and
lactoferrin in human milk is many times higher than in
bovine milk. Transgenic expression of the human lysozyme
gene in mice was associated with a significant reduction of
bacteria and reduced the frequency of mammary gland
infections (59, 60). Lactoferrin has bactericidal and
bacteriostatic effects, in addition to being the main iron
source in milk. These properties make an increase in
lactoferrin levels in bovine transgenics a practical way to
improve milk quality. Human lactoferrin has been expressed
in the milk of transgenic mice and cattle at high levels (46,
76) and is associated with an increased resistance against
mammary gland diseases (93). Lycostaphin has been shown
to confer specific resistance against mastitis caused by
Staphylococcus aureus. A recent report indicates that
transgenic technology has been used to produce cows that
express a lycostaphin gene construct in the mammary gland,
thus making them mastitis-resistant (95).
Emerging transgenic
technologies
Lentiviral transfection of oocytes and zygotes
Recent research has shown that lentiviruses can overcome
previous limitations of viral-mediated gene transfer, which
included the silencing of the transgenic locus and low
expression levels (104). Injection of lentiviruses into the
perivitelline space of porcine zygotes resulted in a very
high proportion of piglets that carried and expressed the
transgene. Stable transgenic lines have been established by
this method (36). The generation of transgenic cattle by
lentiviruses requires microinjection into the perivitelline
space of oocytes and has a lower efficiency than that
obtained in pigs (37). Lentiviral gene transfer in livestock
promises unprecedented efficiency of transgenic animal
production. Whether the multiple integration of
lentiviruses into the genome is associated with unwanted
side-effects like oncogene activation or insertional
mutagenesis remains to be investigated.
Chimera generation via injection of pluripotent
cells into blastocysts
Embryonic stem cells with pluripotent characteristics have
the ability to participate in organ and germ cell
development after injection into blastocysts or by
aggregation with morulae (81). True ES cells (that is, those

Rev. sci. tech. Off. int. Epiz., 24 (1) 291
able to contribute to the germ line) are currently only
available from inbred mouse strains (48). In mouse
genetics, ES cells have become an important tool for
generating gene knockouts, gene knockins and large
chromosomal rearrangements (25). Embryonic stem-like
cells and primordial germ cell cultures have been reported
for several farm animal species, and chimeric animals
without germ line contribution have been reported in
swine (1, 87, 99) and cattle (13). Recent data indicate that
somatic stem cells may have a much greater potency than
previously assumed (42, 49). Whether these cells will
improve the efficiency of chimera generation or somatic
nuclear transfer in farm animals has yet to be shown (48).
Culture of spermatogonia and transplantation
into recipient males
Transplantation of genetically altered primordial germ cells
into the testes of host male animals is an alternative
approach to generating transgenic animals. Initial
experiments in mice showed that the depletion of
endogenous spermatogenesis by treatment with busulfan
prior to transplantation is effective and compatible with recolonisation
by donor cells. Recently, researchers
succeeded in transmitting the donor haplotype to the next
generation after germ-cell transplantation (38). The major
obstacles to this strategy are the lack of efficient in vitro
culture methods for primordial germ/prospermatogonial
cells, and the limitations this imposes on gene transfer
techniques for these cells.
Ribonucleic acid interference
Ribonucleic acid interference is a conserved posttranscriptional
gene regulatory process in most biological
systems, including fungi, plants and animals. Common
mechanistic elements include siRNAs with 21 to
23 nucleotides, which specifically bind complementary
sequences on their target mRNAs and shut down
expression. The target mRNAs are degraded by
exonucleases and no protein is translated (75). The RNA
interference seems to be involved in gene regulation by
controlling/suppressing the translation of mRNAs from
endogenous viral elements.
The relative simplicity of active siRNAs has facilitated the
adoption of this mechanism to generate transient or
permanent knockdowns for specific genes. For transient
gene knockdown, synthetic siRNAs can be transfected into
cells or embryonic stages. For stable gene repression, the
siRNA sequences must be incorporated into a gene
construct (14). The conjunction of siRNA and lentiviral
vector technology may soon provide a method with high
gene transfer efficiency and highly specific gene
knockdown for livestock.
Safety aspects and outlook
Biological products from any animal source are unique,
and must be handled in a different manner from
chemically synthesised drugs to assure their safety, purity
and potency. Proteins derived from living systems are heat
labile, subject to microbial contamination, can be damaged
by shear forces and have the potential to be immunogenic
and allergenic. In the USA, the FDA has developed
guidelines to assure the safe commercial exploitation of
recombinant biological products. A crucial consideration
with animal-derived products is the prevention of
transmission of pathogens from animals to humans (47).
This requires sensitive and reliable diagnostic and
screening methods for the various types of pathogenic
organisms. Furthermore, it should be kept in mind that all
transgenic applications of farm animals will require strict
standards of ‘genetic security’ and reliable, sensitive
methods for molecular characterisation of the products. A
major contribution towards the goal of well-defined
products will come from matrix-assisted laser
desorption/ionisation time-of-flight spectometry (40, 91).
Meanwhile improvements in RNA isolation and unbiased
global amplification of picogram amounts of mRNA enable
researchers to analyse RNA even from single embryos (7).
This technology can offer insights into the entire
transcriptome of a transgenic organism and thereby ensure
the absence of unwanted side-effects (40, 91). Rigorous
control is also required to maintain the highest possible
levels of animal welfare in cases of genetic modification.
Conclusion
Throughout history, animal husbandry has made significant
contributions to human health and well-being. The
convergence of recent advances in reproductive technologies
(in vitro production of embryos, sperm sexing, somatic
nuclear transfer) with the tools of molecular biology (gene
targeting and array analysis of gene expression) adds a new
dimension to animal breeding (68). Major prerequisites for
success and safety will be the continuous refinement of
reproductive biotechnologies and a rapid completion of
genomic sequencing projects in livestock. The authors
anticipate that within the next five to seven years genetically
modified animals will play a significant role in the
biomedical arena, in particular via the production of valuable
pharmaceutical proteins and the supply of xenografts
(Table II). Agricultural applications are already being
prepared (39), but general public acceptance may take as
long as ten years to achieve. As the complete genomic
sequences of all farm animals become available, it will be
possible to refine targeted genetic modification in animal
breeding and to develop strategies to cope with future
challenges in global agricultural production.

292
Glossary
Artificial chromosome
A construction composed of the basic elements of a normal
chromosome into which one or more transgene sequences
may be introduced. After introduction into the nucleus,
this artificial chromosome is replicated and distributed to
daughter cells just like a normal chromosome. The
transgene expression is more predictable as it is not
influenced by integration into an unknown location.
Expression pattern
A representation of relative levels of gene expression in the
various cells and tissues of a transgenic animal. This is
primarily determined by the promoter, but is also
dependent on the position in the genome where the
construct has become integrated. As cells differentiate,
certain chromosomal regions are permanently turned off.
Homologous recombination
A transgene sequence is constructed which matches the
sequence of the endogenous target gene. This biases
insertion to the target gene. The design of the gene
construct determines whether the target gene will be
rendered inactive (knocked out) or simply modified.
Inducible promoter
A promoter that can be activated by an environmental
signal such as the introduction of a heavy metal or an
antibiotic.
Knockout
Removal of a gene or part of a gene to eliminate a particular
protein product.
Lentivirus
One of several types of virus that have been evaluated for
their ability to carry genes into early-stage embryos for the
purpose of introducing a transgene. The transgene is
placed within the viral genome and is carried into the
target embryo by the viral infection mechanism.
Microinjection
A now routine procedure in which a glass micropipette is
used to deliver a small amount of DNA solution (the
transgene) into the nucleus of a fertilised egg. In a small
percentage of these injected eggs, the transgene becomes
incorporated into one of the chromosomes and so will be
present in all subsequent cell divisions and in the germ
cells, so that future offspring will also carry the transgene.
Mosaicism
The situation where an individual is composed of cells of
more than one genetic background. Transgene integration
takes place after the first round of cell division; thus, only
a portion of the cells in the resulting individual will be
transgenic. It is important that the germ cells carry the
transgene so that subsequent offspring will also be
transgenic.
Multiple transgenic
A transgenic organism carrying more than one transgene.
This can be achieved either by introduction of several
transgenes at the same time, or by obtaining cells or
embryos from an existing transgenic animal and using
these for a second round of transgenesis. This is most
efficiently achieved by nuclear-transfer-based transgenesis
because the transfected cells can be screened prior to the
production of an embryo.
Promoter
The control sequence that determines in which tissue or
cell type and at which point in time a gene will be
expressed. Some promoters are universally active, and
some are active only in specific cell types or developmental
stages.
Reporter gene
A sequence that codes for a detectable product such as a
fluorescent protein or an enzyme which produces a visible
product.
Somatic nuclear transfer
In its most common form, this involves removal of the
nucleus from a fertilised egg and replacement with the
nucleus of a differentiated somatic cell such as a fibroblast.
The result is a cloned embryo that has the genetic
composition of the nuclear donor cell.
Spermatogonia
Rev. sci. tech. Off. int. Epiz., 24 (1)
Early developmental precursors of sperm that can be
removed from the testes, transfected with a transgene, and
then re-implanted to develop into mature sperm that carry
the transgene.

Rev. sci. tech. Off. int. Epiz., 24 (1) 293
Targeted integration
Sequences have been discovered (FLP, Cre/lox) that cause
the insertion or removal of intervening gene sequences.
When properly used, these systems can direct insertion to
a specific location in the genome, or can at some point in
the future remove portions of a transgene that are no
longer needed (such as the antibiotic resistance sequences
used to select transfected cells).
Transfection
A process mediated by an electrical pulse (electroporation),
or by treatment with agents that make the cell membranes
porous, such that DNA molecules in the culture medium
are able to pass into the cell where they can be expressed
or integrated into the genome.
Animaux d’élevage transgéniques : le présent et l’avenir
H. Niemann, W. Kues & J.W. Carnwath
Résumé
Jusqu’à une date récente, la microinjection pronucléaire d’acide
désoxyribonucléique (ADN) était la méthode standard utilisée pour la production
d’animaux transgéniques. Cette technique est actuellement remplacée par des
protocoles plus efficaces basés sur le transfert nucléaire de cellules somatiques
permettant également de réaliser des modifications génétiques ciblées. De
même, les vecteurs lentiviraux et la technique de l’acide ribonucléique (ARN)
interférent deviennent des outils importants de la transgenèse. Les animaux
d’élevage transgéniques ont une importance en médecine humaine comme
sources de protéines biologiquement actives, comme donneurs pour la
xénotransplantation et à des fins de recherche en thérapie cellulaire et génique.
Parmi les applications agricoles habituelles figurent l’amélioration de la
composition des viandes, de la production laitière et lainière, de la résistance
aux maladies, de même que la réduction de l’impact sur l’environnement. La
sécurité sanitaire des produits peut être assurée par la standardisation des
procédures et contrôlée par l’application de la réaction en chaîne par
polymérase et de la technologie du criblage de filtres à ADN. Avec l’affinement
des données relatives aux séquences et des cartes génomiques des animaux
d’élevage, la suppression ou la modification de certains gènes devient de plus en
plus réalisable. Cette méthode de reproduction d’animaux jouera un rôle
déterminant dans la résolution des problèmes mondiaux qui se poseront demain
en matière de production agricole.
Mots-clés
Animaux d’élevage – Application agricole – Avantage environnemental – « Gene
pharming » – Microinjection – Séquence courte à interférence ARN – Transfert nucléaire
– Transgénique – Vecteur lentiviral – Xénotransplantation.

294
Presente y futuro del ganado transgénico
References
1. Anderson G.B. (1999). – Embryonic stem cells in agricultural
species. In Transgenic animals in agriculture (J.D. Murray,
G.B. Anderson, A.M. Oberbauer & M.M. McGloughlin, eds).
CABI Publishing, New York, 57-66.
2. Anon. (2004). – Chicken genome. Genome Sequencing
Center at Washington University in St Louis. Website:
genome.wustl.edu/projects/chicken/ (accessed on 17 May
2005).
3. Anon. (2005). – Bovine Genome Project. Human Genome
Sequencing Center at Baylor College of Medicine. Website:
www.hgsc.bcm.tmc.edu/projects/bovine/ (accessed on
17 May 2005).
H. Niemann, W. Kues & J.W. Carnwath
Rev. sci. tech. Off. int. Epiz., 24 (1)
Resumen
Hasta hace poco tiempo, el procedimiento de rigor para obtener animales
transgénicos era la microinyección pronuclear de ácido desoxirribonucleico
(ADN). Ahora se empiezan a aplicar otros métodos más eficaces basados en la
transferencia de núcleos de células somáticas, que además permiten inducir
cambios genéticos de manera más específica. El uso de vectores lentivíricos y
la técnica del ARN interferente pequeño son otros dos métodos de transgénesis
cada vez más empleados. El ganado transgénico es importante en medicina
humana porque de él se extraen proteínas biológicamente activas y tejidos u
órganos para xenotrasplantes y porque proporciona material para investigar
terapias celulares y génicas. En el terreno de la producción animal, sus
aplicaciones van desde la mejora de la composición de carne, el rendimiento
lechero y la producción de lana hasta el aumento de la resistencia a las
enfermedades o la atenuación de los efectos ambientales de la ganadería. La
estandarización de protocolos puede servir para garantizar la inocuidad de los
productos obtenidos, y técnicas como la reacción en cadena de la polimerasa
(PCR) o la de matrices (arrays) de ADN para efectuar los correspondientes
controles. A medida que se perfeccionan los mapas genómicos del ganado y se
conoce mejor su secuencia génica va resultando cada vez más fácil eliminar o
modificar genes concretos. En el futuro, estos sistemas de selección animal
serán básicos para resolver los problemas de producción agropecuaria en el
plano mundial.
Palabras clave
Aplicación agropecuaria – ARN interferente pequeño – Beneficio ambiental – Ganado –
“Gen pharming” – Microinyección – Transferencia nuclear – Transgénico – Vector
lentivírico – Xenotrasplante.
4. Bach F.H. (1998). – Xenotransplantation: problems and
prospects. Annu. Rev. Med., 49, 301-310.
5. Baguisi A., Behboodi E., Melican D., Pollock J.S.,
Destrempes M.M., Cammuso C., Williams J.L., Nims S.D.,
Porter C.A., Midura P., Palacios M.J., Ayres S.L.,
Denniston R.S., Hayes M.L., Ziomek C.A., Meade H.M.,
Godke R.A., Gavin W.G., Overström E.W. & Echelard Y.
(1999). – Production of goats by somatic cell nuclear transfer.
Nature Biotechnol., 17 (5), 456-461.
6. Baise E., Pire G., Leroy M., Gerardin J., Goris N.,
De Clercq K., Kerkhofs P. & Desmecht D. (2004). –
Conditional expression of type I interferon-induced bovine
Mx1 GTPase in a stable transgenic vero cell line interferes
with replication of vesicular stomatitis virus. J. Interferon
Cytokine Res., 24 (9), 512-521.

Rev. sci. tech. Off. int. Epiz., 24 (1) 295
7. Brambrink T., Wabnitz P., Halter R., Klocke R.,
Carnwath J.W., Kues W.A., Wrenzycki C., Paul D. &
Niemann H. (2002). – Application of cDNA arrays to monitor
mRNA profiles in single preimplantation mouse embryos.
Biotechniques, 33 (2), 376-385.
8. Brophy B., Smolenski G., Wheeler T., Wells D., L’Huillier P. &
Laible G. (2003). – Cloned transgenic cattle produce milk
with higher levels of β-casein and κ-casein. Nature Biotechnol.,
21 (2), 157-162.
9. Capecchi M.R. (1989). – The new mouse genetics: altering
the genome by gene targeting. Trends Genet., 5 (3), 70-76.
10. Castilla J., Pintado B., Sola I., Sánchez-Morgado J.M. &
Enjuanes L. (1998). – Engineering passive immunity in
transgenic mice secreting virus-neutralizing antibodies in
milk. Nature Biotechnol., 16 (4), 349-354.
11. Chan A.W., Homan E.J., Ballou L.U., Burns J.C. &
Bremel R.D. (1998). – Transgenic cattle produced by reversetranscribed
gene transfer in oocytes. Proc. natl Acad. Sci. USA,
95 (24), 14028-14033.
12. Chang K., Qian J., Jiang M., Liu Y.H., Wu M.C., Chen C.D.,
Lai C.K., Lo H.L., Hsiao C.T., Brown L., Bolen J. Jr,
Huang H.I., Ho P.Y., Shih P.Y., Yao C.W., Lin W.J., Chen C.H.,
Wu F.Y., Lin Y.J., Xu J. & Wang K. (2002). – Effective
generation of transgenic pigs and mice by linker based
sperm-mediated gene transfer. BMC Biotechnol., 2 (1), 5.
13. Cibelli J.B., Stice S.L., Golueke P.L., Kane J.J., Jerry J.,
Blackwell C., Ponce de Leon F.A. & Robl J.M. (1998). –
Transgenic bovine chimeric offspring produced from somatic
cell-derived stem like cells. Nature Biotechnol., 16 (7), 642-
646.
14. Clark J. & Whitelaw B. (2003). – A future for transgenic
livestock. Nat. Rev. Genet., 4 (10), 825-833.
15. Clements J.E., Wall R.J., Narayan O., Hauer D., Schoborg R.,
Sheffer D., Powell A., Carruth L.M., Zink M.C. &
Rexroad C.E. (1994). – Development of transgenic sheep that
express the Visna virus envelope gene. Virology, 200 (2),
370-380.
16. Copley M.S., Berstan R., Dudd S.N., Docherty G.,
Mukherjee A.J., Straker V., Payne S. & Evershed R.P. (2003).
– Direct chemical evidence for widespread dairying in
prehistoric Britain. Proc. natl Acad. Sci. USA, 100 (4),
1524-1529.
17. Cowan P.J., Aminian A., Barlow H., Brown A.A., Chen C.G.,
Fisicaro N., Francis D.M., Goodman D.J., Han W., Kurek M.,
Nottle M.B., Pearse M.J., Salvaris E., Shinkel T.A.,
Stainsby G.V., Stewart A.B. & d’Apice A.J. (2000). – Renal
xenografts from triple-transgenic pigs are not hyperacutely
rejected but cause coagulopathy in nonimmunosuppressed
baboons. Transplantation, 69 (12), 2504-2515.
18. Cozzi E. & White D.J.G. (1995). – The generation of
transgenic pigs as potential organ donors for humans. Nature
Med., 1 (9), 964-966.
19. Cyranoski D. (2003). – Koreans rustle up madness-resistant
cows. Nature, 426 (6968), 743.
20. D’Agnillo F. & Chang T.M. (1998). – Polyhemoglobinsuperoxide
dismutase-catalase as a blood substitute with
antioxidant properties. Nature Biotechnol., 16 (7), 667-671.
21. Dai Y., Vaught T.D., Boone J., Chen S.H., Phelps C.J., Ball S.,
Monahan J.A., Jobst P.M., McCreath K.J., Lamborn A.E.,
Cowell-Lucero J.L., Wells K.D., Colman A., Polejaeva I.A. &
Ayares D.L. (2002). – Targeted disruption of the α1,3galactosyltransferase
gene in cloned pigs. Nature Biotechnol.,
20 (3), 251-255.
22. Damak S., Jay N.P., Barrell G.K. & Bullock D.W. (1996). –
Targeting gene expression to the wool follicle in transgenic
sheep. Biotechnology, 14 (2), 181-184.
23. Damak S., Su H., Jay N.P. & Bullock D.W. (1996). –
Improved wool production in transgenic sheep expressing
insulin-like growth factor 1. Biotechnology, 14 (2), 185-188.
24. Denning C., Burl S., Ainslie A., Bracken J., Dinnyes A.,
Fletcher J., King T., Ritchie M., Ritchie W.A., Rollo M.,
de Sousa P., Travers A., Wilmut I. & Clark A.J. (2001). –
Deletion of the alpha(1,3)galactosyltransferase (GGTA1) and
the prion protein (PrP) gene in sheep. Nature Biotechnol., 19
(6), 559-562.
25. Downing G.J. & Battey J.F. Jr (2004). – Technical assessment
of the first 20 years of research using mouse embryonic stem
cell lines. Stem Cells, 22 (7), 1168-1180.
26. Draghia-Akli R., Fiorotto M.L., Hill L.A., Malone P.B.,
Deaver D.R. & Schwartz R.J. (1999). – Myogenic expression
of an injectable protease-resistant growth hormone-releasing
hormone augments long-term growth in pigs. Nature
Biotechnol., 17 (12), 1179-1183.
27. Dyck M.K., Lacroix D., Pothier F. & Sirard M.A. (2003). –
Making recombinant proteins in animals: different systems,
different applications. Trends Biotechnol., 21 (9), 394-399.
28. Fändrich F., Lin X., Chai G.X., Schulze M., Ganten D.,
Bader M., Holle J., Huang D.S., Parwaresch R., Zavazava N.
& Binas B. (2002). – Preimplantation-stage stem cells induce
long-term allogeneic graft acceptance without supplementary
host conditioning. Nature Med., 8 (2), 171-178.
29. Forsberg E.J. (2005). – Commercial applications of nuclear
transfer cloning: three examples. Reprod. Fertil. Dev., 17 (2),
59-68.
30. Golovan S.P., Meidinger R.G., Ajakaiye A., Cottrill M.,
Wiederkehr M.Z., Barney D.J., Plante C., Pollard J.W.,
Fan M.Z., Hayes M.A., Laursen J., Hjorth J.P., Hacker R.R.,
Phillips J.P. & Forsberg C.W. (2001). – Pigs expressing
salivary phytase produce low-phosphorus manure. Nature
Biotechnol., 19 (8), 741-745.
31. Grosse-Hovest L., Muller S., Minoia R., Wolf E.,
Zakhartchenko V., Wenigerkind H., Lassnig C.,
Besenfelder U., Müller M., Lytton S.D., Jung G. & Brem G.
(2004). – Cloned transgenic farm animals produce a
bispecific antibody for T cell-mediated tumor cell killing.
Proc. natl Acad. Sci. USA, 101 (18), 6858-6863.

296
32. Grunwald K.A., Schueler K., Uelmen P.J., Lipton B.A.,
Kaiser M., Buhman K. & Attie A.D. (1999). – Identification of
a novel Arg-->Cys mutation in the LDL receptor that
contributes to spontaneous hypercholesterolemia in pigs.
J. Lipid. Res., 40 (3), 475-485.
33. Hammer R.E., Pursel V.G., Rexroad C.E. Jr, Wall R.J.,
Bolt D.J., Ebert K.M., Palmiter R.D. & Brinster R.L. (1985). –
Production of transgenic rabbits, sheep and pigs by
microinjection. Nature, 315 (6021), 680-683.
34. Hansen K. & Khanna C. (2004). – Spontaneous and
genetically engineered animal models: use in preclinical
cancer drug development. Eur. J. Cancer, 40 (6), 858-880.
35. Haskell R.E. & Bowen R.A. (1995). – Efficient production of
transgenic cattle by retroviral infection of early embryos.
Molec. Reprod. Dev., 40 (3), 386-390.
36. Hofmann A., Kessler B., Ewerling S., Weppert M., Vogg B.,
Ludwig H., Stojkovic M., Boelhauve M., Brem G., Wolf E. &
Pfeifer A. (2003). – Efficient transgenesis in farm animals by
lentiviral vectors. EMBO Rep., 4 (11), 1054-1060.
37. Hofmann A., Zakhartchenko V., Weppert M., Sebald H.,
Wenigerkind H., Brem G., Wolf E. & Pfeifer A. (2004). –
Generation of transgenic cattle by lentiviral gene transfer into
oocytes. Biol. Reprod., 71 (2), 405-409.
38. Honaramooz A., Behboodi E., Megee S.O., Overton S.A.,
Galantino-Homer H., Echelard Y. & Dobrinski I. (2003). –
Fertility and germline transmission of donor haplotype
following germ cell transplantation in immunocompetent
goats. Biol. Reprod., 69 (4), 1260-1264.
39. Houdebine L.M. (2002). – Transgenesis to improve animal
production. Livest. Prod. Sci., 74 (3), 255-268.
40. Hughes T.R., Roberts C.J., Dai H., Jones A.R., Meyer M.R.,
Slade D., Burchard J., Dow S., Ward T.R., Kidd M.J.,
Friend S.H. & Marton M.J. (2000). – Widespread aneuploidy
revealed by DNA microarray expression profiling.
Nature Genet., 25 (3), 333-337.
41. Hyttinen J.M., Peura T., Tolvanen M., Aalto J., Alhonen L.,
Sinervirta R., Halmekyto M., Myohanen S. & Janne J. (1994).
– Generation of transgenic dairy cattle from transgeneanalyzed
and sexed embryos produced in vitro. Biotechnology,
12 (6), 606-608.
42. Jiang Y., Jahagirdar B.N., Reinhardt R.L., Schwartz R.E.,
Keene C.D., Ortiz-Gonzalez X.R., Reyes M., Lenvik T.,
Lund T., Blackstad M., Du J., Aldrich S., Lisberg A.,
Low W.C., Largaespada D.A. & Verfaillie C.M. (2002). –
Pluripotency of mesenchymal stem cells derived from adult
marrow. Nature, 418 (6893), 41-49.
43. Jost B., Vilotte J.L., Duluc I., Rodeau J.L. & Freund J.N.
(1999). – Production of low-lactose milk by ectopic
expression of intestinal lactase in the mouse mammary gland.
Nature Biotechnol., 17 (2), 160-164.
44. Karatzas C.N. & Turner J.D. (1997). – Toward altering milk
composition by genetic manipulation: current status and
challenges. J. Dairy Sci., 80 (9), 2225-2232.
Rev. sci. tech. Off. int. Epiz., 24 (1)
45. Kilby N.J., Snaith M.R. & Murray J.A.H. (1993). – Sitespecific
recombinases: tools for genome engineering. Trends
Genet., 9 (12), 413-421.
46. Krimpenfort P., Rademakers A., Eyestone W., van der Schans A.,
van den Broek S., Kooiman P., Kootwijk E., Platenburg G.,
Pieper F., Strijker R. & de Boer H. (1991). – Generation of
transgenic dairy cattle using in vitro embryo production.
Biotechnology, 9 (9), 844-847.
47. Kues W.A. & Niemann H. (2004). – The contribution of farm
animals to human health. Trends Biotechnol., 22 (6), 286-294.
48. Kues W.A., Carnwath J.W. & Niemann H. (2005). – From
fibroblasts and stem cells: implications for cell therapies and
somatic cloning. Reprod. Fertil. Dev., 17 (2), 125-134.
49. Kues W.A., Petersen B., Mysegades W., Carnwath J.W. &
Niemann H. (2005). – Isolation of murine and porcine fetal
stem cells from somatic tissue. Biol. Reprod., 72 (4), 1020-
1028. Website: www.biolreprod.com/cgi/content/abstract/
biolreprod.104.031229v1 (accessed on 23 March 2005).
50. Kumar S., Clarke A.R., Hooper M.L., Horne D.S., Law A.J.,
Leaver J., Springbett A., Stevenson E. & Simons J.P. (1994). –
Milk composition and lactation of β-casein deficient mice.
Proc. natl Acad. Sci. USA, 91 (13), 6138-6142.
51. Kuroiwa Y., Kasinathan P., Choi Y.J., Naeem R., Tomizuka K.,
Sullivan E.J., Knott J.G., Duteau A., Goldsby R.A.,
Osborne B.A., Ishida I. & Robl J.M. (2002). –
Cloned transchromosomic calves producing human
immunoglobulin. Nature Biotechnol., 20 (9), 889-894.
52. Kuwaki K., Tseng Y.L., Dor F.J., Shimizu A., Houser S.L.,
Sanderson T.M., Lancos C.J., Prabharasuth D.D., Cheng J.,
Moran K., Hisashi Y., Mueller N., Yamada K., Greenstein J.L.,
Hawley R.J., Patience C., Awwad M., Fishman J.A.,
Robson S.C., Schuurman H.J., Sachs D.H. & Cooper D.K.
(2005). – Heart transplantation in baboons using
α1,3-galactosyltransferase gene-knockout pigs as donors:
initial experience. Nature Med., 11 (1), 29-31.
53. Lai L., Kolber-Simonds D., Park K.W., Cheong H.T.,
Greenstein J.L., Im G.S., Samuel M., Bonk A., Rieke A.,
Day B.N., Murphy C.N., Carter D.B., Hawley R.J.
& Prather R.S. (2002). – Production of
α1,3-galactosyltransferase knockout pigs by nuclear transfer
cloning. Science, 295 (5557), 1089-1092.
54. Lavitrano M., Camaioni A., Fazio V.M., Dolci S., Farace M.G.
& Spadafora C. (1989). – Sperm cells as vectors for
introducing foreign DNA into eggs: genetic transformation of
mice. Cell, 57 (5), 717-723.
55. Lavitrano M., Bacci M.L., Forni M., Lazzereschi D.,
Di Stefano C., Fioretti D., Giancotti P., Marfe G., Pucci L.,
Renzi L., Wang H., Stoppacciaro A., Stassi G., Sargiacomo M.,
Sinibaldi P., Turchi V., Giovannoni R., Della Casa G., Seren E.
& Rossi G. (2002). – Efficient production by sperm-mediated
gene transfer of human decay accelerating factor (hDAF)
transgenic pigs for xenotransplantation. Proc. natl Acad. Sci.
USA, 99 (22), 14230-14235.
56. Li Z. & Engelhardt J.F. (2003). – Progress toward generating
a ferret model of cystic fibrosis by somatic cell nuclear
transfer. Reprod. Biol. Endocrinol., 1 (1), 83.

Rev. sci. tech. Off. int. Epiz., 24 (1) 297
57. Lo D., Pursel V., Linton P.J., Sandgren E., Behringer R.,
Rexroad C., Palmiter R.D. & Brinster R.L. (1991). –
Expression of mouse IgA by transgenic mice, pigs and sheep.
Eur. J. Immunol., 21 (4), 1001-1006.
58. Ma J.K., Drake P.M. & Christou P. (2003). – The production
of recombinant pharmaceutical proteins in plants. Nat. Rev.
Genet., 4 (10), 794-805.
59. Maga E.A., Anderson G.B. & Murray J.D. (1995). – The
effects of mammary gland expression of human lysozyme on
the properties of milk from transgenic mice. J. Dairy Sci.,
78 (12), 2645-2652.
60. Maga E.A. & Murray J.D. (1995). – Mammary gland
expression of transgenes and the potential for altering the
properties of milk. Biotechnology, 13 (13), 1452-1457.
61. Mahmoud T.H., McCuen B.W., Hao Y., Moon S.J.,
Tatebayashi M., Stinnett S., Petters R.M. & Wong F. (2003). –
Lensectomy and vitrectomy decrease the rate of
photoreceptor loss in rhodopsin P347L transgenic pigs.
Graefes Arch. Clin. Exp. Ophtalmol., 241 (4), 298-308.
62. Massoud M., Attal J., Thepot D., Pointu H., Stinnakre M.G.,
Theron M.C., Lopez C. & Houdebine L.M. (1996). – The
deleterious effects of human erythropoietin gene driven by
the rabbit whey acidic protein gene promoter in transgenic
rabbits. Reprod. Nutr. Dev., 36 (5), 555-563.
63. Meade H.M., Echelard Y., Ziomek C.A., Young M.W.,
Harvey M., Cole E.S., Groet S. & Curling J.M. (1999). –
Expression of recombinant proteins in the milk of transgenic
animals. In Gene expression systems: using nature for the art
of expression (J.M. Fernandez & J.P. Hoeffler, eds). Academic
Press, San Diego, 399-427.
64. Müller M. & Brem G. (1991). – Disease resistance in farm
animals. Experientia, 47 (9), 923-934.
65. Müller M., Brenig B., Winnacker E.L. & Brem G. (1992). –
Transgenic pigs carrying cDNA copies encoding the murine
Mx1 protein which confers resistance to influenza virus
infection. Gene, 121 (2), 263-270.
66. Niemann H. (2004). – Transgenic pigs expressing plant
genes. Proc. natl Acad. Sci. USA, 101 (19), 7211-7212.
67. Niemann H., Halter R., Carnwath J.W., Herrmann D.,
Lemme E. & Paul D. (1999). – Expression of human blood
clotting factor VIII in the mammary gland of transgenic
sheep. Transgenic Res., 8 (3), 237-247.
68. Niemann H. & Kues W.A. (2003). – Application of
transgenesis in livestock for agriculture and biomedicine.
Anim. Reprod. Sci., 79 (3-4), 291-317.
69. Nottle M.B., Nagashima H., Verma P.J., Du Z.T., Grupen C.G.,
MacIlfatrick S.M., Ashman R.J., Harding M.P., Giannakis C.,
Wigley P.L., Lyons I.G., Harrison D.T., Luxford B.G.,
Campbell R.G., Crawford R.J. & Robins A.J. (1999). –
Production and analysis of transgenic pigs containing a
metallothionein porcine growth hormone gene construct.
In Transgenic animals in agriculture (J.D. Murray,
G.B. Anderson, A.M. Oberbauer & M.M. McGloughlin, eds).
CABI Publishing, New York, 145-156.
70. Palmarini M. & Fan H. (2001). – Retrovirus-induced ovine
pulmonary adenocarcinoma: an animal model for lung
cancer. J. natl Cancer Inst., 93 (21), 1603-1614.
71. Perry A.C., Wakayama T., Kishikawa H., Kasai T., Okabe M.,
Toyoda Y. & Yanagimachi R. (1999). – Mammalian
transgenesis by intracytoplasmic sperm injection. Science,
284 (5417), 1180-1183.
72. Perry A.C., Rothman A., de las Heras J.I., Feinstein P.,
Mombaerts P., Cooke H.J. & Wakayama T. (2001). – Efficient
metaphase II transgenesis with different transgene archetypes.
Nature Biotechnol., 19 (11), 1071-1073.
73. Petters R.M., Alexander C.A., Wells K.D., Collins E.B.,
Sommer J.R., Blanton M.R., Rojas G., Hao Y., Flowers W.L.,
Banin E., Cideciyan A.V., Jacobson S.G. & Wong F. (1997). –
Genetically engineered large animal model for studying cone
photoreceptor survival and degeneration in retinitis
pigmentosa. Nature Biotechnol., 15 (10), 965-970.
74. Phelps C.J., Koike C., Vaught T.D., Boone J., Wells K.D.,
Chen S.H., Ball S., Specht S.M., Polejaeva I.A., Monahan J.A.,
Jobst P.M., Sharma S.B., Lamborn A.E., Garst A.S., Moore M.,
Demetris A.J., Rudert W.A., Bottino R., Bertera S., Trucco M.,
Starzl T.E., Dai Y. & Ayares D.L. (2003). – Production of
α1,3-galactosyltransferase deficient pigs. Science, 299 (5605),
411-414.
75. Plasterk R.H. (2002). – RNA silencing: the genome’s immune
system. Science, 296 (5571), 1263-1265.
76. Platenburg G.J., Kootwijk E.A.P., Kooiman P.M.,
Woloshuk S.L., Nuijens J.H., Krimpenfort P.J.A., Pieper F.R.,
de Boer H.A. & Strijker R. (1994). – Expression of human
lactoferrin in milk of transgenic mice. Transgenic Res., 3 (2),
99-108.
77. Platt J.L. & Lin S.S. (1998). – The future promises of
xenotransplantation. Ann. N.Y. Acad. Sci., 862, 5-18.
78. Pursel V.G., Pinkert C.A., Miller K.F., Bolt D.J.,
Campbell R.G., Palmiter R.D., Brinster R.L. & Hammer R.E.
(1989). – Genetic engineering of livestock. Science,
244 (4910), 1281-1288.
79. Pursel V.G., Wall R.J., Mitchell A.D., Elsasser T.H.,
Solomon M.B., Coleman M.E., Mayo F. & Schwartz R.J.
(1999). – Expression of insulin-like growth factor-I in skeletal
muscle of transgenic pigs. In Transgenic animals in
agriculture (J.D. Murray, G.B. Anderson, A.M. Oberbauer &
M.M. McGloughlin, eds). CABI Publishing, New York,
131-144.
80. Rapacz J. & Hasler-Rapacz J. (1989). – Animal models: the
pig. In Genetic factors in atherosclerosis: approaches and
model systems (R.S. Sparkes & A.J. Lusis, eds). Karger, Basle,
139-169.
81. Rossant J. (2001). – Stem cells from the mammalian
blastocyst. Stem Cells, 19 (6), 477-482.
82. Rudolph N.S. (1999). – Biopharmaceutical production in
transgenic livestock. Trends Biotechnol., 17 (9), 367-374.

298
83. Saeki K., Matsumoto K., Kinoshita M., Suzuki I., Tasaka Y.,
Kano K., Taguchi Y., Mikami K., Hirabayashi M.,
Kashiwazaki N., Hosoi Y., Murata N. & Iritani A. (2004). –
Functional expression of a Delta12 fatty acid desaturase gene
from spinach in transgenic pigs. Proc. natl Acad. Sci. USA,
101 (17), 6361-6366.
84. Schätzlein S., Lucas-Hahn A., Lemme E., Kues W.A.,
Dorsch M., Manns M.P., Niemann H. & Rudolph K.L. (2004).
– Telomere length is reset during early mammalian
embryogenesis. Proc. natl Acad. Sci. USA, 101 (21), 8034-
8038.
85. Schätzlein S. & Rudolph K.L. (2005). – Telomere length
regulation during cloning, embryogenesis and aging. Reprod.
Fertil. Dev., 17 (1-2), 85-96.
86. Schnieke A.E., Kind A.J., Ritchie W.A., Mycock K., Scott A.R.,
Ritchie M., Wilmut I., Colman A. & Campbell K.H. (1997).
– Human factor IX transgenic sheep produced by transfer of
nuclei from transfected fetal fibroblasts. Science, 278 (5346),
2130-2133.
87. Shim H., Gutierrez-Adan A., Chen L.R., BonDurant R.H.,
Behboodi E. & Anderson G.B. (1997). – Isolation of
pluripotent stem cells from cultured porcine primordial germ
cells. Biol. Reprod., 57 (5), 1089-1095.
88. Staeheli P. (1991). – Intracellular immunization: a new
strategy for producing disease-resistant transgenic livestock?
Trends Biotechnol., 9 (3), 71-72.
89. Stinnakre M.G., Vilotte J.L., Soulier S. & Mercier J.C. (1994).
– Creation and phenotypic analysis of α-lactalbumindeficient
mice. Proc. natl Acad. Sci. USA, 91 (14), 6544-6548.
90. Swanson M.E., Martin M.J., O’Donnell J.K., Hoover K.,
Lago W., Huntress V., Parsons C.T., Pinkert C.A., Pilder S. &
Logan J.S. (1992). – Production of functional human
hemoglobin in transgenic swine. Biotechnology, 10 (5), 557-
559.
91. Templin M.F., Stoll D., Schrenk M., Traub P.C., Vohringer C.F.
& Joos T.O. (2002). – Protein microarray technology. Trends
Biotechnol., 20 (4), 160-166.
92. Theuring F., Thunecke M., Kosciessa U. & Turner J.D.
(1997). – Transgenic animals as models of neurodegenerative
disease in humans. Trends Biotechnol., 15 (8), 320-325.
93. Van Berkel P.H., Welling M.M., Geerts M., van Veen H.A.,
Ravensbergen B., Salaheddine M., Pauwels E.K., Pieper F.,
Nuijens J.H. & Nibbering P.H. (2002). – Large scale
production of recombinant human lactoferrin in the mik of
trangenic cows. Nature Biotechnol., 20 (5), 484-487.
94. Van den Hout J.M., Reuser A.J., de Klerk J.B., Arts W.F.,
Smeitink J.A. & Van der Ploeg A.T. (2001). – Enzyme therapy
for Pompe disease with recombinant human α-glucosidase
from rabbit milk. J. inherited metabol. Dis., 24 (2), 266-274.
95. Wall R.J., Powell A., Paape M.J., Kerr D.E.,
Bannermann D.D., Pursel V.G., Wells K.D., Talbot N.
& Hawk H. (2005). Genetically enhanced cows resist
intramammary Staphylococcus aureus infection.
Nat. Biotechnol. 23 (4), 445-451.
Rev. sci. tech. Off. int. Epiz., 24 (1)
96. Ward K.A. (2000). – Transgene-mediated modifications to
animal biochemistry. Trends Biotechnol., 18 (3), 99-102.
97. Weidle U.H., Lenz H. & Brem G. (1991). – Genes encoding
a mouse monoclonal antibody are expressed in transgenic
mice, rabbits and pigs. Gene, 98 (2), 185-191.
98. Weissmann C., Enari M., Klohn P.C., Rossi D. & Flechsig E.
(2002). – Transmission of prions. Proc. natl Acad. Sci. USA,
99 (Suppl. 4), 16378-16383.
99. Wheeler M.B. (1994). – Development and validation of
swine embryonic stem cells: a review. Reprod. Fertil. Dev.,
6 (5), 563-568.
100. Wheeler M.B., Bleck G.T. & Donovan S.M. (2001). –
Transgenic alteration of sow milk to improve piglet growth
and health. Reproduction, 58 (Suppl.), 313-324.
101. White D. (1996). – Alteration of complement activity: a
strategy for xenotransplantation. Trends Biotechnol.,
14 (1), 3-5.
102. Wigdorovitz A., Mozgovoj M., Santos M.J., Parreno V.,
Gomez C., Perez-Filgueira D.M., Trono K.G., Rios R.D.,
Franzone P.M., Fernandez F., Carrillo C., Babiuk L.A.,
Escribano J.M. & Borca M.V. (2004). – Protective lactogenic
immunity conferred by an edible peptide vaccine to bovine
rotavirus produced in transgenic plants. J. gen. Virol.,
85 (Pt 7), 1825-1832.
103. Wilmut I., Beaujean N., De Sousa P.A., Dinnyes A., King
T.J., Paterson L.A., Wells D.N. & Young L.E. (2002). –
Somatic cell nuclear transfer. Nature, 419 (6907), 583-586.
104. Wiznerowicz M. & Trono D. (2005). – Harnessing HIV for
therapy, basic research and biotechnology.
Trends Biotechnol., 23 (1), 42-47.
105. Yamada K., Yazawa K., Shimizu A., Iwanaga T.,
Hisashi Y., Nuhn M., O’Malley P., Nobori S., Vagefi P.A.,
Patience C., Fishman J., Cooper D.K., Hawley R.J.,
Greenstein J., Schuurman H.J., Awwad M., Sykes M. &
Sachs D.H. (2005). – Marked prolongation of porcine renal
xenograft survival in baboons through the use of
α1,3-galactosyltransferase gene-knockout donors and the
cotransplantation of vascularized thymic tissue. Nature
Med., 11 (1), 32-34.
106. Yom H.C. & Bremel R.D. (1993). – Genetic engineering of
milk composition: modification of milk components in
lactating transgenic animals. Am. J. clin. Nutr., 58 (2 Suppl.),
299S-306S.
107. Ziomek C.A. (1998). – Commercialization of proteins
produced in the mammary gland. Theriogenology,
49 (1), 139-144.

The FASEB Journal Express article fj.05-5415fje. Published online May 9, 2006.
The FASEB Journal FJ Express Full-Length Article
Epigenetic silencing and tissue independent expression
of a novel tetracycline inducible system in doubletransgenic
pigs
Wilfried A. Kues,* Reinhard Schwinzer, † Dagmar Wirth, ‡ Els Verhoeyen, ‡,1
Erika Lemme,* Doris Herrmann,* Brigitte Barg-Kues,* Hansjörg Hauser, ‡
Kurt Wonigeit, †,2 and Heiner Niemann* ,2
*Department of Biotechnology, Institute for Animal Breeding (FAL), Mariensee, Germany; † Klinik
für Viszeral- und Transplantationschirurgie, Medizinische Hochschule Hannover, Hannover,
Germany; and ‡ Molecular Biotechnology, Gesellschaft für Biotechnologische Forschung mbH,
Braunschweig, Germany
ABSTRACT The applicability of tightly regulated
transgenesis in domesticated animals is severely hampered
by the present lack of knowledge of regulatory
mechanisms and the long generation intervals. To
capitalize on the tightly controlled expression of mammalian
genes made possible by using prokaryotic control
elements, we have used a single-step transduction
to introduce an autoregulative tetracycline-responsive
bicistronic expression cassette (NTA) into transgenic
pigs. Transgenic pigs carrying one NTA cassette showed
a mosaic transgene expression restricted to single muscle
fibers. In contrast, crossbred animals carrying two
NTA cassettes with different transgenes, revealed a
broad tissue-independent and tightly regulated expression
of one cassette, but not of the other one. The
expression pattern correlated inversely with the methylation
status of the NTA transcription start sites indicating
epigenetic silencing of one NTA cassette. This
first approach on tetracycline regulated transgene expression
in farm animals will be valuable for developing
precisely controlled expression systems for transgenes
in large animals relevant for biomedical and
agricultural biotechnology.—Kues, W.A., Schwinzer,
R., Wirth, D., Verhoeyen, E., Lemme, E., Hermann, D.,
Barg-Kues, B., Hauser, H., Wonigeit, K., and Niemann,
H. Epigenetic silencing and tissue independent expression
of a novel tetracycline inducible system in doubletransgenic
pigs. FASEB J. 20, E000–E000 (2006)
Key Words: autoregulative cassette bicistronic transgenic
livestock tissue independent expression DNA methylation
Transgenic mice and farm animals harboring the first
generation of conditional promoter elements, which
were responsive to heavy metals or steroid hormones,
suffered from high basal expression levels and pleiotropic
effects (1–4). In contrast, binary expression systems
based on prokaryotic control elements, which are responsive
to exogenous IPTG, RU-486, ecdysone, or
tetracycline (tet) derivatives are compatible with a
0892-6638/06/0020-0001 © FASEB
tightly controlled expression (5, 6). Several transgenic
mouse lines expressing modified tet-system components
in various tissues have been generated and a
rapid and reversible transgene regulation has been
shown (7–13). Factors affecting the efficiency of tetracycline-dependent
gene regulation include the strain of
mice and the site of integration (14), as well as clearance
of tetracycline derivatives (15). A high degree of
variability in activator-dependent target gene expression
is observed and high background expression
makes it necessary to screen for appropriately responding
lines (16).
The original tetracycline system requires two DNA
constructs for expression of the transactivator and
transactivator dependent expression of the target gene,
respectively. These DNA-constructs are usually integrated
in two different lines of transgenic mice. On
breeding, offspring are obtained in which the target
gene can be regulated by addition of doxycycline (7).
The long-generation intervals make this approach unfeasible
in other mammalian species, including livestock
(17). One approach to overcome this limitation is
to combine both transactivator and target genes, including
individual promoters in a single construct. This
approach was compatible with efficient control of gene
expression in mammalian cells and mice (18, 19).
However, the near physical distance of two promoter
sequences makes this system prone to elevated background
expression. A tetracycline-controlled transcriptional
silencer has been used to suppress background
expression (9). Alternatively, autoregulatory expression
1 Present address: Envelope retrovirale et ingeniérerie retrovirale,
INSERM 758, ENS de Lyon, France.
2 Correspondence: K. W., Klinik f. Viszeral-und Transplantations
Clinique, Medizinische Hochschule Hannover, Carl-
Neuberg Str. 1, Hannover D-30623, Germany. E-mail:
wonigeit.kurt@mh-hannover.de H. N., Institut for Animal
Breeding (FAL) Department of Biotechnology Höltystr. 10,
Neustadt D-31535, Germany. E-mail: niemann@tzv.fal.de
doi: 10.1096/fj.05-5415fje
E1

systems have been established that overcome the problem
of promoter interference. In these systems the
transactivator is either expressed from a tet-responsive
bicistronic expression cassette (20–23) or from a tetresponsive
bidirectional promoter (24, 25). It has been
shown that expression of biologically active proteins
can be tightly controlled with these systems, albeit
minimum basal expression levels of the transactivator
are required (26). Another advantage of autoregulative
cassettes is that transgene transcription is linked to
ubiquitously present cellular cofactors, thereby circumventing
cell-/tissue-specific expression as observed for
classical promoters.
Here, we describe tightly controlled transgene overexpression
in the domestic pig by an autoregulative
bicistronic tetracycline-responsive cassette (NTA). The
NTA-cassette was designed to ensure high and ubiquitous
expression levels of human regulators of complement
activation (RCA) relevant for xenotransplantation
(17), (i.e., decay accelerating factor (DAF)) and CD59.
The rationale for this approach was twofold: (i) As
proof of principle we wanted to demonstrate that
single-construct cassettes can be successfully expressed
in large animals; (ii) we intended to improve xenotransplantation
by producing tet-off regulated human
complement regulator transgenic animals. Unexpectedly,
nine independent transgenic pig lines showed
expression restricted to muscle fibers. However, in
crossbred double-transgenic animals a broad tissue
independent transgene expression of the CD59-NTA
cassette, but not of the DAF-NTA cassette was discovered.
This asymmetric expression pattern correlated
with different methylation patterns of the NTA cassettes
indicating that epigenetic mechanisms are critical
for the function of the NTA system. Expression of
human complement regulators and tet transactivator
did not compromise animal health and fertility.
MATERIALS AND METHODS
Construction of the bicistronic NTA-cassettes
CD59 was amplified from pWTCD59 (27). DAF was amplified
from pWTDAF (27). The transactivator tTA was amplified
from pUHD15–1 (28), thereby flanking the tTA cDNA with
NotI and PstI sites. The cDNAs were independently integrated
into pTBC-1 (29) and both plasmids were then fused via the
unique BamHI and VspI sites. All polymerase chain reaction
(PCR)-derived sequences were verified by DNA sequencing.
Vector sequences are available on request.
Cell culture and transfection
NIH3T3 cells were cultivated in Dulbecco’s modified Eagle’s
medium (DMEM). The RCA-NTA cassettes were cotransfected
with a pAG60 by DNA-calcium phosphate coprecipitation
(27). Cells were selected for resistance to G418 (1
mg/ml). Pools and cell clones were generated and cultivated
in the presence and absence of doxycycline (2 g/ml).
Transfection of swine testis epitheloid (STE) cell line (kindly
provided by A. Saalmüller, Wien, Austria) was carried out
using essentially the same protocol as for NIH3T3 cells. Flow
cytometry was performed as described earlier (27) using
specific monoclonal antibodies (PharMingen, Hamburg, Germany)
to detect CD59 and DAF.
Determination of doxycyline plasma levels in pigs
A mouse-derived cell line NIH-TAluc with a stably integrated
doxycycline-responsive luciferase cassette was used to determine
doxycycline levels in plasma and fodder extracts.
Generation of transgenic pigs
Transgenic pigs were generated by pronuclear DNA microinjection
as described (30). In brief, zygotes were collected
from hormonally pretreated prepubertal German landrace
donor gilts 15–18 h after the second mating. Animals were
sacrificed, and zygotes were flushed from the excised oviducts.
The NTA constructs were released from vector backbones
by digesting the plasmids with BsrBI and Tth111I (New
England Biolabs (NEB), Frankfurt, Germany) and isolated by
gel electrophoresis. Approximately 10 pl of purified DNAs
(4–10 ng/l) were injected into one pronucleus of zygotes
after centrifugation for 6 min at 14,500 g to visualize the
pronuclei by concentrating the cytoplasmic lipids at one pole.
A total of 653 microinjected zygotes were surgically transferred
into the oviducts of 20 synchronized prepubertal gilts,
resulting in 80 piglets from which 11 could be identified as
transgenic by Southern blotting of the genomic DNA. For
Southern blotting, the genomic DNA was digested with PstI
(NEB) and blotted to Hybond membranes. The PstI digest
released internal fragments from the NTA-cassettes, which
were 2049 and 1658 bp for the CD59 and DAF-constructs,
respectively. The complete constructs were isolated from
vector backbones and used as probes after digoxigenin labeling.
Hybridization products were visualized by chemiluminescence.
Founder animals were bred with nontransgenic animals
to test for germline transmission. Transgenic F1 and
F2-animals were used for detailed analysis of the expression
pattern and doxycycline responsiveness. Animals were treated
according to institutional guidelines and experiments were
approved by an external animal welfare committee.
Detection of CD59 and DAF expression
Transgenic offspring and wild-type control animals were
sacrificed and tissue samples were obtained from the following
organs: heart, lung, liver, kidney, spleen, thymus, skeletal
muscle, pancreas, skin, brain, and aorta. Samples were used
for primary cell cultures or snap-frozen in liquid nitrogen and
used for RT–PCR, Northern blotting and immunohistological
analysis. For RT–PCR, total RNA was isolated using the
guanidinium thiocyanate-phenol-chloroform extraction. PCR
detection and Northern blotting of CD59 and DAF transcripts
were done as described recently (30). In brief, digoxigenin
labeled 605 and 613 bp antisense cRNAs for CD59 and DAF
were used for specific detection of the transgenic transcripts.
The calculated sizes for the bicistronic mRNAs were 2.3 and
3.0 kb for the CD59 and DAF encoding transcripts, respectively.
In addition to the 3.0 kb band a slightly faster migrating
fragment was specifically detected in the DAF Northern.
Apparently, the smaller fragment represented a degradation
product of the 3.0 kb mRNA. In some experiments tissues
collected from transgenic animals carrying a cytomegalovirus
(CMV) promoter-CD59 construct were used as controls (30).
A -actin (Actb) probe (31) served as an internal control.
E2 Vol. 20 June 2006 The FASEB Journal
KUES ET AL.

To detect CD59 and DAF, immunohistological staining was
performed on cryostat sections using biotinylated anti-human
mAB H19 (CD59) and mAB33572X (DAF/CD55), respectively
(both antibodies were from BD PharMingen). Human
heart tissue served as positive control. Specific antibody (Ab)
binding was detected by incubation with streptavidine-peroxidase
and 3-amino-9-ethylcarbazole (AEC) as substrate, cell
nuclei were counterstained with hematoxylin. Tissue samples
were evaluated at 100–200 magnifications.
Primary cell cultures of porcine fibroblasts were established
from subdermal tissues as described (30, 32) and employed
for expression analysis by Northern blotting or flow cytometry
(FACS).
Genomic DNA was isolated from porcine tissues by proteinase
K lysis. The following primers spanning the complete
promoter regions of DAF-NTA and CD59-NTA constructs were
used to amplify these regions by PCR: CMV-0, 5-AAA ATA
GGC GTA CAC GAG G; hDAF-1, 5-ATC ACT GAG TCC TTC
TCG CC and hCD59–1, 5-CCC TCA AGC GGG TTG TGA
CG. The PCR products were directly sequenced, employing
the CMV-O primer.
Application of doxycycline
Doxycycline was fed in the form of tablets (doxy 200®, CT
Arzneimittel GmbH, Berlin, Germany; one tablet contains
200 mg doxycycline). A daily dose of 3.3 mg/kg body weight
was applied for periods from 6 to 45 d. In one feeding group,
blood samples were taken during the course of the experiment
to determine doxycycline levels in plasma. Muscle
biopsies from the M. longissimus were obtained by a special
biopsy device routinely used in meat quality testing program
(33). Biopsies were taken from the longissimus muscle prior
to doxycycline treatment, and at different time points thereafter
and were analyzed by Northern blotting and immunohistology.
In some experiments, subdermal tissue pieces from
the biopsies were used to establish primary cell cultures.
Bioinformatic analysis of CpG islands
For CpG island prediction the MethPrimer program (http://
www.urogene.org/methprimer) was employed. The NTA-cassette
sequences were analyzed using the following criteria for
CpG island prediction: i) a CG content greater than 60%, ii)
a presence of CpG dinucleotides of greater than 0.6, and iii)
a DNA region of greater than 300 bp.
Detection of methylated CpG dinucleotides by bisulfite
sequencing
Bisulfite sequencing was done as described by Hajkova et al.
(34). In brief, 20 ng genomic DNA was digested with EcoRI
(NEB). Denatured DNA was embedded in 7 l of 20 mg/ml
low melting agarose (Biozym, Hess. Oldendorf, Germany),
cooled to form agarose beads, and incubated in 2.5 M
bisulfite-hydroquinone solution pH 5 (Roth, Hamburg, Germany)
for4hat50°C. PCR was carried out in a final vol of 100
l with individual agarose beads containing embedded
genomic DNA. PCR conditions were as follows: 1 PCR
reaction buffer (20 mM Tris-HCl pH 8.4, 50 mM KCl 2), 1.5
mM MgCl 2, 0.2 M dNTPs (Amersham Biosciences Europe,
Freiburg, Germany), and 0.6 M of each primer for 40 cycles.
The PCR fragments were separated by gel electrophoresis,
isolated and directly sequenced. Only sequences with 95%
cytosine conversion of non-CpGs were analyzed. Methylation
status of CpG dinucleotides was determined based on the
ratio of cytosines to converted cytosines. The following prim-
INDUCIBLE TRANSGENIC EXPRESSION IN A LARGE ANIMAL MODEL
ers were used to amplify the CMV minimal promoter of the
CD59-NTA construct, CMV-2bi, 5- GAA AGT TGA GTT CGG
TAT TT, CD59–2bi, 5- AAA AAT ATC CCA CCT TTT TC; for
the DAF-NTA construct the CMV-2bi primer in combination
with DAF-2bi, 5- CCA TTA ACT ACC CTT AAA AC was used.
RESULTS
Evaluation of autoregulatory RCA–NTA expression
cassettes in cell lines
We constructed an autoregulatory bicistronic tet-off
based cassette that supports single step transduction
(Fig. 1A) and in which the mRNA is driven by the tet
responsive promoter (P tTA). In two constructs carrying
either the human CD59 or DAF cDNAs (designated
CD59-NTA and DAF-NTA) the RCA reading frames are
followed by an internal ribosomal entry site (IRES) that
provides translation of the recombinant transactivator
(tTA). Except for the human cDNAs, both cassettes
were completely identical.
Mouse NIH 3T3 cells stably expressing the cassettes
showed autoactivation and expression of the respective
RCA (Fig. 1B). Expression was efficiently suppressed by
addition of doxycycline to the culture medium (Fig.
1B). In addition, swine testis epitheloid (STE) cells
were transfected with the RCA-NTA cassettes, and again
autoactivation and conditional transgene regulation
were found (not shown). Thus, autoregulatory bicistronic
expression cassettes support tight regulation of
human RCAs in xenogenic cells, suggesting that ubiquitous
activation could be achieved in vivo.
Generation of RCA-NTA transgenic pigs
Five hCD59-NTA and six DAF-NTA transgenic founder
animals were generated by pronuclear microinjection
of the respective cassette into porcine zygotes, from
which ten transgenic lines were established. Transgenic
juvenile and adult F1 and F2-offspring were used for
expression profiling in the absence of any tetracycline.
Remarkably, an intensive immunostaining indicative
for human RCA protein was found in single fibers of
striated muscle in 9 of the 10 lines (Table 1, Fig. 1C; 2–3
animals investigated per line). Depending on the line,
5–30% of the muscle fibers stained positive. Expression
in muscle was confirmed by Northern blotting with DAF
and CD59 specific probes, respectively. Contrary to the
tissue-independent design of the NTA cassette, Northern
blotting, immunohistology, and FACS revealed that
the animals did not express human RCAs in brain,
heart, kidney, tongue, liver, skin, lymph nodes, blood
and pancreas (summarized in Table 1). Apparently, the
(different) integration sites of the nine expressing lines
had no or only a marginal effect on the muscle fiberspecific
expression.
Integration of the entire bicistronic cassettes into the
porcine genome was confirmed by Southern blotting of
genomic DNA digested with restriction enzymes, cut-
E3

Figure 1. Design of the autoregulative NTA
expression cassette and conditional expression
of transgenes in cell lines and in singletransgenic
pigs. A) The P tTA promoter (28)
drives a bicistronic mRNA encoding a human
regulator of complement activation (RCA)
linked with a tet-off transactivator (tTA) via a
poliovirus IRES. Two constructs carrying the
human cDNAs encoding either CD59 (CD59-
NTA) orDAF(DAF-NTA) were used. Minimal
expression of the transactivator results in tTA
binding to the tet-operator sequences and
initiates an autoregulative loop. In the presence
of exogenous tetracycline the transactivator
is inactivated and transcription silenced.
B) Conditional expression of hDAF in cell
culture. NIH3T3 cells were stably transfected
with DAF-NTA. A cell pool and a single clone
(clone 12) were cultivated in presence (green
line) or absence (black line) of doxycycline.
Cells were harvested and DAF expression was
determined by indirect immunofluorescence using
flow cytometry. An overlay of the histograms
is presented with nontransfected NIH3T3 cells
(red line) as a control. C) Muscle fiber confined
expression of DAF and CD59 in transgenic pigs
bearing a single NTA-cassette. Longitudinal (upper
row) and cross sections (lower row) of
transgenic and wild-type pig muscles after specific
Ab staining are shown, nuclei are counterstained
with hematoxylin. Note that only individual
fibers displayed intense Ab staining,
whereas neighboring fibers are negative. No expression of the transgenes was detected in several other tissues (for details see
Table 1).
ting the NTA cassette internally near the ends (not
shown). To rule out the possibility, that transgenic
animals carried defective promoter sequences, the respective
elements were amplified from porcine
genomic DNA by PCR. Sequencing confirmed that
heptamerized tet-operator and CMV basal promoter
sequences were present in both, CD59-NTA and DAF-
NTA cassettes. To further rule out putative contamination
of the fodder with tetracycline and/or its derivatives,
fodder and plasma samples of transgenic pigs
were analyzed via a doxycycline sensitive reporter cell
line. All samples proved to be negative for tetracycline
activity (data not shown).
Enhanced tissue-independent expression of CD59 in
crossbred animals carrying two NTA-RCA cassettes
To investigate whether the unexpected mosaic expression
pattern in striated muscle was due to suboptimal
transactivator expression levels, tTA was expressed in
porcine primary fibroblasts from transgenic animals.
Although cotransfected tTA-responsive reporter genes
were activated, the chromosomal RCA-NTA constructs
remained unresponsive (data not shown) indicating
stable silencing of the chromosomal cassettes.
To test if the typical mosaic expression pattern in
transgenic pigs could be altered by increased threshold
levels of tTA in vivo, heterozygous transgenic animals
carrying either CD59-NTA or DAF-NTA were crossbred
to obtain double-transgenic animals. From three litters
with a total of 24 piglets the expected mendelian
distribution of transgene combinations was obtained;
i.e., 5 piglets (21%) were double-transgenic (CD59-NTA
DAF-NTA), 12 (50%) carried either the CD59 or DAF
cassette and 7 (29%) were nontransgenic. In addition,
a female and male double-transgenic sibling (CD59-
NTA DAF-NTA) were mated and produced nine
piglets, i.e., four piglets carrying both cassettes, four
piglets had one cassette and one nontransgenic offspring
was obtained. From the nine double-transgenic
animals, three were sacrificed at the age of 6 wk and 6
mo, respectively, and organs were analyzed for expression
of the transgenes. Muscle biopsies and blood
samples were analyzed from the other double-transgenic
animals. Interestingly, a selective up-regulation of
CD59 expression was found in double-transgenic animals
derived from crossbreeding L13 and L20 (Table
1). The CD59 mRNA levels were significantly (50–100
fold) elevated in three different muscles, i.e., Musculus
(M.) longissimus, front and hind leg muscles, in double-transgenic
animals over transgenic siblings carrying
only one CD59-NTA cassette (Fig. 2A). Immunohistological
staining revealed that virtually all fibers in
striated muscle stained positive for CD59 (Fig. 3A). In
addition, other organs, including liver, pancreas, kidney
and lung expressed the transgene at the mRNA
E4 Vol. 20 June 2006 The FASEB Journal
KUES ET AL.

TABLE 1. Expression patterns in animals carrying one and two NTA cassettes
Transgenic lines bearing one NTA cassette
DAF-NTA CD59-NTA
(Fig. 2B) and protein levels (Fig. 3A). RNA and protein
expression pattern of CD59 correlated well, e.g., muscle
and liver, which showed the highest mRNA levels
(Fig. 2A) also displayed the highest proportion of
anti-CD59 Ab stained cells (Fig. 3A). Tissues with lower
mRNAs levels, such as lung, showed only few positive
cells in the immunohistology. Importantly, in all examined
tissues the positive cells were strongly stained for
CD59, suggesting that the autoregulative up-regulation
worked well in this population of cells. However, DAF
mRNA and protein levels were not increased in the
same double-transgenic animals and immunoreactivity
remained confined to single muscle fibers (Fig. 3A).
Seven out of nine double-transgenic pigs, derived from
crossing transgenic lines L13 with L20 showed this
asymmetric over-expression of CD59.
The remaining two double-transgenic pigs, derived
from crossing L15 with L20, mimicked expression
patterns of their parental lines showing mosaic expression
in single muscle fibers. Individual muscle fibers
coexpressed both CD59 and DAF (Fig. 3B), while some
fibers expressed only CD59 (Fig. 3B, arrows), but not
DAF (Fig. 3B, circles), highlighting that in these fibers
high transactivator levels alone were not sufficient to
activate the DAF-NTA gene. Fibers with exclusive expression
of DAF were never detected.
Since none of the single-transgenic animals showed
this enhanced transgene expression, we argue that the
presence of two cassettes is necessary, but not always
sufficient for tissue independent expression. This finding
was confirmed by the widespread expression of
CD59 in a CD59-NTA homozygous animal (CD59-NTA
CD59-NTA) (data not shown).
Health status, development, and fertility of animals
bearing either one or two NTA-cassettes were not
compromised. All animals were not distinguishable
from their nontransgenic counterparts.
Transgenic animals with two cassettes
DAF-NTA CD59-NTA
L13 L20
(n7)
L15 L20
(n2)
L12 L13 L14 L15 L16 L17 L19 L20 L21 L22 DAF CD59 DAF CD59
Heart - - - - - - - - - - - - -
Liver - - - - - - - - - - - - -
Lung - - - - - - - - - - - - -
Kidney - - - - - - - - - - - - -
Pancreas - - - - - - - - - - - - -
Skeletal mus. -
Thymus - - - - - - - - - - n.d. n.d. n.d. n.d.
Lymphocytes - - n.d. n.d. n.d. n.d. n.d. - n.d. n.d * * - -
Fibroblasts n.d - n.d. n.d. n.d. n.d. n.d. - n.d. n.d. - n.d. n.d.
Summarized expression data obtained by Northern blotting, immunohistology and FACS; plus signs indicate low () to high ()
levels of expression, –: below detection limit, n.d.: not determined; *after mitogen stimulation.
INDUCIBLE TRANSGENIC EXPRESSION IN A LARGE ANIMAL MODEL
Figure 2. Asymmetric over-expression in pigs carrying two
cassettes. A) Overexpression of CD59-NTA transcripts in double-transgenic
siblings. Northern blot of total RNAs isolated
from fore limb (lane 1), hind-limb (lane 2) and M. longissimus
(lane 3) of a double-transgenic animal. Lanes 4–6 were
loaded with RNA from fore-limb, hind-limb, and M. longissimus
from a CD59-NTA single-transgenic sibling. Lanes 7 and
8 were loaded with samples from a wild-type animal and lanes
9 and 10 with RNA isolated from a CMV-CD59 transgenic
animal described previously (30). The CD59 transcripts in
lanes 1–3 are connected via an IRES element with the tet
transactivator resulting in a 2.3 kb transcript, whereas the
conventional CMV-hCD59 construct (lanes 9, 10) produces a
1.6 kb transcript. B) Tissue specific expression of CD59 and
DAF in double-transgenic animals. The gel was loaded with
(1) a RNA size marker and total RNA isolated from heart (2),
lung (3), liver (4), kidney (5) and skeletal muscle (6) and
probed with CD59 and DAF specific probes.
E5

Figure 3. Asymmetric expression of CD59 and DAF in doubletransgenic
animals. A) Asymmetric over expression of CD59
in different organs of double-transgenic animal #335. This
animal was produced by breeding L13 with L20. Note the
widespread expression of CD59 in muscle, liver and pancreas
as indicated by a red-brown precipitate. In contrast, DAF
expression is still confined to single muscle fibers (arrows). B)
Coexpression of CD59 and DAF in single muscle fibers of
double-transgenic animal #364 detected by immunostaining
of serial cross sections. This animal was generated by breeding
L15 with L20. Note that some fibers expressed exclusively
CD59 (arrows), but not DAF (dashed circles).
Conditional RCA-NTA regulation in single- and
double-transgenic animals
To evaluate the exogenous control of the autoregulated
tet-off cassettes, 12 single-transgenic and four
double-transgenic animals were fed with doxycycline
and muscle biopsies were taken before, during and
after antibiotic treatment. A daily dose of 3.3 mg
doxycycline/kg body weight for 6 d was found to be
effective to shut down transgene expression (Fig. 4).
This dose is well below the recommended effective dose
of 12 mg doxycycline/kg/day for antibiotic treatment
of pigs. RCA-NTA transcripts were virtually eliminated
by doxycycline feeding within 2–6 d. Thus, the expression
cassettes located at different chromosomal sites
could be readily switched off. Re-expression of RCA-
NTAs took unexpectedly long, and did not resume until
eight weeks after termination of the doxycycline application
(Fig. 4).
Tightly controlled expression of human RCA in white
blood cells
To analyze the regulatory capacity of the NTA cassettes,
we studied the expression patterns of DAF and CD59 by
flow cytometry on white blood cells collected from
seven double-transgenic animals (L13L20), and 2
single-transgenic (1 DAF, 1 CD59) pigs. No significant
expression of DAF or CD59 was found in lymphocytes
(resting and concanavalin A (Con A)-activated cells)
from the two single-transgenic pigs. (Fig. 5A). Absence
of DAF and CD59 was also typical for resting cells from
double-transgenic animals (Fig. 5B), although in one
animal a small number of CD59 expressing cells were
detected (data not shown). However, expression of
DAF and CD59 could be induced in cells from all
double-transgenic animals by activation with ConA.
The intensity of ConA-mediated up-regulation of the
two molecules was asymmetric showing strong expression
of CD59 and weak but significant up-regulation of
DAF. Expression of both molecules could be terminated
by culturing the cells with tetracycline for 48 h
(Fig. 5B), again providing evidence for a tight control
of gene expression from these cassettes.
Identification of CpG islands and determination of
the methylation status
Epigenetic mechanisms were hypothesized to be causatively
involved in the asymmetric expression of the two
RCA-NTA cassettes in double-transgenic animals and
the muscle fiber-specific expression in single-transgenic
Figure 4. Conditional transgene expression by doxycycline
feeding. Two double-transgenic pigs (#368, #369) were fed
with a daily dose of 3.3 mg/kg doxycycline for 6 d. As control,
a third double-transgenic animal (#366) was left untreated.
Muscle biopsies were taken at several time points before (day
0), during (day 2), and after (days 13, 19, 75, and 180) the
feeding regime, 5 g total RNA was loaded per lane and
analyzed by Northern blotting with RCA and -actin (ACTB)
specific probes. Note that the RCA-NTA transcripts disappeared
already after2dofdoxycycline feeding. Repression of
the RCAs resumed 8 wk after the end of doxycycline feeding.
The calculated size of the DAF-IRES-tTA mRNA was 3.0 kb.
E6 Vol. 20 June 2006 The FASEB Journal
KUES ET AL.

Figure 5. Expression patterns of hDAF and hCD59 on lymphocytes
from transgenic pigs. The cells were stained by
indirect immunofluorescence and analyzed on a FACSCalibur
flow cytometer. Closed histograms (thin lines) represent
fluorescence intensity obtained after incubation of the cells
with mouse anti-human DAF (IA10, IgG2a) or CD59 (H19,
IgG2a) monoclonal antibody followed by a second incubation
step with FITC-conjugated goat antimouse immunoglobulin
(FITC-immunoglobulin). Open histograms (bold lines) were
obtained after staining of the cells with FITC-immunoglobulin
only. A) Analysis of lymphocytes obtained from a single
hCD59 transgenic pig. Resting cells and cells, which had
been activated by culturing with Con A plus interleukin (IL)-2
for 48 h were studied. Similar results (absence of hDAF
and hCD59) were obtained when cells from a single DAF
INDUCIBLE TRANSGENIC EXPRESSION IN A LARGE ANIMAL MODEL
pigs. Bioinformatic analysis of the DAF-NTA cassette
revealed that the minimal CMV promoter within P tTA
and the 5coding region of the DAF cDNA together
contained a putative CpG island (Fig. 6A). In contrast,
no CpG island was predicted for the P tTA and the
5coding region of the CD59 gene (Fig. 6A).
Genomic DNA from muscle biopsies of single and
double-transgenic pigs was isolated, and analyzed by
bisulfite sequencing to assess the methylation status of
the NTA-promoter regions in the pig genome.
The promoter region of the CD59-NTA cassette was
completely methylated in single-transgenic animals,
while in double-transgenic animals only 50% of the
CpG dinucleotides were fully methylated (Fig. 6B). In
contrast, this region was essentially nonmethylated in
CD59-NTA cassettes from stably transfected STE cells.
An almost complete methylation of the CpG dinucleotides
around the transcription initiation site of the
DAF-NTA cassette was discovered either in single or
double-transgenic animals (Fig. 6C). Primary fibroblasts
isolated from biopsies also maintained this methylation
pattern (Fig. 6C). For comparison, the methylation
status of the DAF-NTA cassette was determined in
a pool of stably transfected NIH 3T3 cells and in two
cell clones, which expressed high levels of the DAF-NTA
construct. These cells possessed a relative low concentration
of methylation (Fig. 6C). Similarly, stably transfected
porcine STE cells showed weak methylation of
the promoter regions (Fig. 6C). Thus an inverse correlation
between the observed gene expression and the
methylation status of these cassettes is obvious. These
data indicate that the P tTA is prone to methylation in
transgenic pigs, in particular in combination with the
5coding region of the human DAF gene.
DISCUSSION
Here, we report the first conditional and broad transgene
expression in a domestic animal species using an
autoregulative tet-off system. The methylation of transgene
promoters correlated well with expression levels,
suggesting de novo methylation as a crucial mechanism
for expression of RCA-NTA constructs in these pigs.
The bicistronic, autoregulative cassettes were designed
transgenic pig or cells from wild-type nontransgenic control
animals were analyzed. B) Analysis of lymphocytes from a
double- transgenic pig. Expression of DAF and CD59 was first
examined on resting cells. The cells were then activated for
48 h with Con A plus IL-2 and expression of the two
molecules was reanalyzed (activated). Note, the expression of
both CD59 and DAF (arrows) in ConA activated cells. Cultivation
was extended for additional 48h in the absence or
presence of tetracycline (Tet, 1 g/ml). The histograms
shown in the bottom panels (Tet) indicated termination of
human RCA expression in tetracycline treated cells. Cells
which had been cultured for 96 h in the absence of tetracycline
showed the same asymmetric expression pattern (weak
DAF, strong CD59) as the 48 h activated cell population.
E7

Figure 6. CpG rich regions in NTA promoter regions and
methylation status. A) CpG island analysis of the DAF- and
CD59-NTA cassettes with the MethPrimer program. The plots
depict tet operator region, CMV basal promoter and the RCA
coding regions; CpG dinucleotides are indicated by red bars
below the plots; putative CpG islands are indicated as solid
blue areas. Note that the DAF-NTA construct carries a putative
CpG island, which covers the transcription start and the
5coding region. B) Methylation status of the CD59-NTA
transcription start region in transgenic pigs and stably transfected
STE cells. CpG dinucleotides are depicted as circles:
black, fully methylated; gray, half-methylated; white, nonmethylated.
C) Methylation status of the DAF-NTA transcription
start region in transgenic pigs, primary fibroblasts and
stably transfected NIH 3T3 and STE cells.
to be compatible with stable and widespread expression
and carried either CD59 or DAF, followed by an IRES
and the tTA coding sequence. The target genes were
chosen, since human CD59 and DAF are critically
involved in the suppression of the hyperacute rejection
of xenotransplanted porcine organs (35). For autoactivation,
a minimum basal expression of the minimal
promoter is required. The original axiome of the tet
system predicts that in the absence of tetracycline, tTA
binds to the tet operator sequences and activates transcription
(5, 6, 36). The presumed autoregulated function
of the NTA cassettes was found to be fulfilled in
NIH3T3 and porcine STE cells.
Unexpectedly, transgenic pigs carrying one NTA
cassette displayed confined expression in single striated
muscle fibers, irrespective of the transgene or the
integration site. Mosaic expression patterns have also
been described in tet-transgenic mice and, in some
cases, the highest expression levels were found in
skeletal muscle (7, 16, 18). In the present study, confinement
to the muscle compartment could be overcome
by crossbreeding selected double-transgenic pigs
carrying both the DAF-NTA and CD59-NTA cassettes.
This resulted in a widespread expression of CD59 in
muscle, liver, pancreas, lung and other tissues, whereas
DAF expression remained restricted to individual muscle
fibers.
The lack of a widespread expression of DAF/NTA
correlated with the methylation of critical parts of the
tTA dependent promoter and neighboring sequences
and is thus epigenetic in nature. Methylation is usually
associated with additional changes in histone conformation
and chromatin structure, rendering the DNA
region into a compressed state and leading to gene
silencing (37–39).
Although the CD59-NTA transgene did not possess a
predicted CpG island, bisulfite sequencing revealed
that the CpGs around the transcription start site were
fully methylated in single-transgenic animals and that
approximately half of the CpG dinucleotides were
methylated in double-transgenic animals. Studies with
Epstein-Barr virus have shown that even methylation of
few sites is sufficient to suppress transcription of a
promoter, and experiments with episomes have demonstrated
that methylation of as few as 7% of the CpG
sites can induce quiescence of a gene locus (40, 41).
Why individual skeletal muscle fibers showed a relaxed
transgene expression control of the NTA cassettes in
single-transgenic animals remains to be investigated.
We cannot rule out that simple gene dose effects led to
the widespread expression in double-transgenic animals.
However, we assume that unknown molecular
mechanisms during critical time windows have resulted
in the observed widespread expression in double-transgenic
pigs. It is well known that genomic methylation
and histone modifications undergo major changes during
development (42).
Our data indicate that de novo methylation may
interfere with proper expression of tetracycline sensitive
promoters with significant implications for the
generation of tet-transgenic animals as most of the
employed promoter sequences are based on the CMV
minimal promoter. Investigations of DMNT1 over-expressing
cell lines favor the concept that the sequence
context might play a crucial role in the methylation
sensitivity of CpG islands (43). This might explain the
high degree of variability in activator-dependent target
gene expression requiring screening for appropriately
responding mouse lines, as well as the here observed
asymmetric expression in pigs. Along this line it is
interesting that CpG depleted CMV promoter constructs
gave rise to long term expression in vivo (44).
Effective conditional transgene expression could be
E8 Vol. 20 June 2006 The FASEB Journal
KUES ET AL.

demonstrated in transgenic pigs and in white blood
cells. Feeding of transgenic pigs with a daily dose of 3.3
mg doxycycline per kg body weight terminated transgene
transcription in vivo. Re-expression of human
RCAs after termination of doxycycline application was
resumed by autoactivation after 8 wk. Whether this
delayed re-expression is due to a sluggish clearance of
doxycycline (15) or the architecture of the autoregulative
expression cassette remains to be determined. At
present we do not have evidence for specific metabolic
features or a tetracycline reservoir in the pig that could
explain the long interval from termination to re-expression
of the cassette. Measurements of doxycyline levels
in porcine plasma indicated a rapid decline after the
application. Analysis of the fodder for doxycycline
contaminations did not reveal any doxycycline residues.
Overall, these data show that the regulation of the
RCA-NTA cassettes is tight, once the expression is turned
off by doxycycline. Probably, time consuming stochastic
events re-express RCA-NTA cassettes and induce autoactivation.
However, in cell culture RCAs were re-expressed
within 6–10 d after withdrawal of doxycycline.
In conclusion, we have generated transgenic pigs
bearing a bicistronic tetracycline-responsive cassette
and demonstrated tightly controlled expression in a
large animal model for the first time. The usage of the
autoregulative bicistronic cassette supports efficient
single step transduction, which is of utmost importance
in view of the long generation intervals in large domestic
animals. Expression of RCAs and transactivator did
not compromise health status and fertility of transgenic
pigs. Design of the next generation of expression
cassettes will take into account potential methylation
prone sequences and should thus be compatible with
true ubiquitous transgene expression already in the
F0-generation. The use of optimized autoregulative
constructs in combination with improved gene transfer
techniques, such as somatic nuclear transfer or lentiviral
vectors will pave the way toward precisely controlled
transgene expression in farm animals for biomedical
and agricultural application (45).
The critical discussions and comments by J.W. Carnwath are
gratefully acknowledged. The authors thank K-G. Hadeler, H.H.
Döpke (Mariensee) and L. Schöberlein (Leipzig) for expert
help with the muscle biopsy device and A. Saalmüller (Wien) for
gift of the STE cell line. The excellent technical assistance of A.
Kanwischer (Hannover) and W. Mysegades, the introduction
into bisulfite sequencing by C. Gebert, as well as the expert
animal caretaking by H. Hornbostel and T. Peker are kindly
acknowledged. This work was supported by grants of the DFG
(SFB 265, Forschergruppe 535) and BMBF to H.N. Support of
the Kuratorium für Dialyze und Nierentransplantation to K.W. is
acknowledged.
Competing financial interests: The authors declare that they
have no competing financial interests in relation to this paper.
REFERENCES
1. Mayo, K.E., Warren, R., and Palmiter, R. D. (1982) The mouse
metallothionein-I gene is transcriptionally regulated by cad-
INDUCIBLE TRANSGENIC EXPRESSION IN A LARGE ANIMAL MODEL
mium following transfection into human or mouse cells. Cell 29,
99–108
2. Lee, F., Mulligan, R., Berg, P., and Ringold, G. (1981) Glucocorticoids
regulate expression of dihydrofolate reductase cDNA in
mouse mammary tumour virus chimaeric plasmids. Nature 294,
228–232
3. Miller, K.F., Bolt, D.J., Pursel, V.G., Hammer, R.E., Pinkert, C.A.,
Palmiter, R. D., and Brinster, R. L. (1989) Expression of human
or bovine growth hormone gene with a mouse metallothionein-1
promoter in transgenic swine alters the secretion of
porcine growth hormone and insulin-like growth factor-I. J.
Endocrinol. 120, 481–488
4. Pursel, V.G., Pinkert, C.A., Miller, K.F., Bolt, D.J., Campbell,
R.G., Palmiter, R.D., Brinster, R. L., and Hammer, R. E. (1989)
Genetic engineering of livestock. Science 244, 1281–1288
5. Lewandowski, M. (2001) Conditional control of gene expression
in the mouse. Nat. Rev. 2, 743–755
6. Corbel, S. C., and Rossi, F. M. (2002) Latest developments and
in vivo use of the Tet system: ex vivo and in vivo delivery of
tetracycline-regulated genes. Curr. Opin. Biotechnol. 13, 448–452
7. Furth, P.A., St Onge, L., Boger, H., Gruss, P., Gossen, M.,
Kistner, A., Bujard, H., and Hennighausen, L. (1994) Temporal
control of gene expression in transgenic mice by a
tetracycline-responsive promoter. Proc. Natl. Acad. Sci. U. S. A.
91, 9302–9306
8. Kistner, A., Gossen, M., Zimmermann, F., Jerecic, J., Ullmer, C.,
Lubbert, H., and Bujard, H. (1996) Doxycycline-mediated quantitative
and tissue-specific control of gene expression in transgenic
mice. Proc. Natl. Acad. Sci. U. S. A. 93, 10933–10938
9. Zhu, Z., Ma, B., Homer, R.J., Zheng, T., and Elias, J. A. (2001)
Use of the tetracycline controlled transcriptional silencer (tTS)
to eliminate transgene leak in inducible overexpression of
transgenic mice. J. Biol. Chem. 276, 25222–25229
10. Sakai, N., Thome, J., Newton, S.S., Chen, J., Kelz, M.B., Steffen,
C., Nestler, E. J., and Duman, R. S. (2002) Inducible and brain
region-specific CREB transgenic mice. Mol. Pharmacol. 61, 1453–
1464
11. Lindeberg, J., Mattsson, R., and Ebendal, T. (2002) Timing the
doxycycline yields different patterns of genomic recombination
in brain neurons with a new inducible Cre transgene. J. Neurosci.
Res 68, 248–253
12. Smith-Arica, J.R., Morelli, A.E., Larregina, A.T., Smith, J., Lowenstein,
P. R., and Castro, M. G. (2000) Cell-type-specific and
regulatable transgenesis in the adult brain: adenovirus-encoded
combined transcriptional targeting and inducible transgene
expression. Mol. Ther. 2, 579–587
13. Gunther, E.J., Belka, G.K., Wertheim, G.B., Wang, J., Hartman,
J.L., Boxer, R. B., and Chodosh, L. A. (2002) A novel doxycycline-inducible
system for the transgenic analysis of mammary
gland biology. FASEB J. 16, 283–292
14. Robertson, A., Perea, J., Tolmachova, T., Thomas, P. K., and
Huxley, C. (2002) Effects of mouse strain, position of integration
and tetracycline analogue on the tetracycline conditional
system in transgenic mice. Gene 282, 65–74
15. Stepensky, D., Kleinberg, L., and Hoffman, A. (2003) Bone as
an effect compartment. Clin. Pharmacokinet. 42, 863–881
16. Böger, H., and Gruss, P. (1999) Functional determinants for the
tetracycline- dependent transactivator tTA in transgenic mouse
embryos. Mech. Dev. 83, 141–153
17. Niemann, H., and Kues, W. A. (2003) Application of transgenesis
in livestock for agriculture and biomedicine. Anim. Reprod.
Sci. 79, 291–317
18. Schultze, N., Burki, Y., Lang, Y., Certa, U., and Bluethmann, H.
(1996) Efficient control of gene expression by single step
integration of the tetracycline system in transgenic mice. Nat.
Biotechnol. 14, 499–503
19. Kringstein, A.M., Rossi, F.M., Hofmann, A., and Blau, H. M.
(1998) Graded transcriptional response to different concentrations
of a single transactivator. Proc. Natl. Acad. Sci. U. S. A. 95,
13670–13675
20. Shockett, P., Difilippantonio, M., Hellman, N., and Schatz, D. G.
(1995) A modified tetracycline-regulated system provides autoregulatory,
inducible gene expression in cultured cells and
transgenic animals. Proc. Natl. Acad. Sci. U. S. A. 92, 6522–6526
21. Hofmann, A., Nolan, G. P., and Blau, H. M. (1996). Rapid
retroviral delivery of tetracycline-inducible genes in a single
E9

autoregulatory cassette. Proc. Natl. Acad. Sci. U. S. A. 93, 5185–
5190
22. Kühnel, F., Fritsch, C., Krause, S., Mundt, B., Wirth, T., Paul, Y.,
Malek, N.P., Zender, L., Manns, M. P., and Kubicka, S. (2004)
Doxycycline regulation in a single retroviral vector by an autoregulatory
loop facilitates controlled gene expression in liver
cells. Nucleic Acids Res. 32, e30
23. Markusic, D., Oude-Elferink, R., Das, A.T., Berkhout, B., and
Seppen, J. (2005) Comparison of single regulated lentiviral
vectors with rtTA expression driven by an auto regulatory loop
or a constitutive promoter. Nucleic Acids Res. 33, e63
24. Unsinger, J., Kröger, A., Hauser, H., and Wirth, D. (2001)
Retroviral vectors for the transduction of autoregulated bidirectional
expression cassettes. Mol. Ther. 4, 484–489
25. Unsinger, J., Lindenmaier, W., May, T., Hauser, H., and Wirth,
D. (2004) Stable and strictly controlled expression of LTRflanked
autoregulated expression cassettes upon adenoviral
transfer. Biochem. Biophys. Res. Commun. 319, 379–387
26. May, T., Hauser, H., and Wirth, D. (2004) Transcriptional
control of SV40 T-antigen expression allows a complete reversion
of immortalization. Nucleic Acids Res. 32, 5529–5538
27. Spitzer, D., Hauser, H., and Wirth, D. (1999) Complementprotected
amphotrophic retroviruses from murine packaging
cells. Hum. Gene Ther. 10, 1893–1902
28. Gossen, M., and Bujard, H. (1992) Tight control of gene
expression in mammalian cells by tetracycline-responsive promoters.
Proc. Natl. Acad. Sci. U. S. A. 89, 5547–5551
29. Dirks, W., Schaper, F., Kirchhoff, S., Morelle, C., and Hauser, H.
(1994) A multifunctional vector family for gene expression in
mammalian cells. Gene 149, 387–388
30. Niemann, H., Verhoeyen, E., Wonigeit, K., Lorenz, R., Hecker, J.,
Schwinzer, R., Hauser, H., Kues, W.A., Halter, R., Lemme, E., et al.
(2001) CMV early promoter induced expression of hCD59 in
porcine organs provides protection against hyperacute rejection.
Transplantation 72, 1898–1906
31. Kues, W.A., Brenner, H.R., Sakmann, B., and Witzemann, V.
(1995) Local neurotrophic repression of gene transcripts encoding
fetal AChRs at rat neuromusclular synapses. J. Cell Biol.
130, 949–957
32. Kues, W.A., Petersen, B., Mysegades, W., Carnwath, J.W., and
Niemann. H. (2005) Isolation of stem cell-like cells from murine
and porcine somatic tissue. Biol. Reprod. 72, 1020–1028
33. Schöberlein, L. (1976) Die Schussbiopsie - eine neue Methode zur
Entnahme von Muskelproben. Monatsh. Vet -Med. Jena 31, 457–460
34. Hajkova, P., el-Maarri, O., Engemann, S., Oswald, J., Olek, A.,
and Walter, J. (2002) DNA-methylation analysis by the bisulfiteassisted
genomic sequencing method. Methods Mol. Biol. 200,
143–154
35. White, D. (1996) Alteration of complement activity: a strategy
for xenotransplantation. Trends Biotechnol. 14, 3–5
36. Baron, U., Freundlieb, S., Gossen, M., and Bujard, H. (1995)
Coregulation of two gene activities by tetracycline via a bidirectional
promoter. Nuc. Acid Res. 17, 3605–3606
37. Jones, P. A. (1999) The DNA methylation paradox. Trends Genet.
15, 34–37
38. Antequera, F. (2003) Structure, function and evolution of CpG
island promoters. Cell Mol. Life Sci. 60, 1647–1658
39. Jones, P. A., and Baylin, S. B. (2002) The fundamental role of
epigenetic events in cancer. Nat. Rev. Genet. 3, 415–428
40. Robertson, K.D., Hayward, S.D., Ling, P.D., Samid, D., and
Ambinder, R. F. (1995) Transcriptional activation of the Epstein-Barr
virus latency C promoter after 5-azacytidine treatment:
evidence that demethylation of a single CpG site is
crucial. Mol. Cell. Biol. 15, 6150–6159
41. Hsieh, C. L. (1994) Dependence of transcriptional repression
on CpG methylation density. Mol. Cell. Biol. 14, 5487–5494
42. Reik, W., and Walter, J. (2001) Genomic imprinting: Parental
influence on the genome. Nat. Rev. Genet. 2, 21–32
43. Feltus, F.A., Lee, E.K., Costello, J.F., Plass, C., and Vertino, P. M.
(2003) Predicting aberrant CpG island methylation. Proc. Natl.
Acad. Sci. U. S. A. 100, 12253–12258
44. Yew, N.S., Zhao, H., Przybylska, M., Wu, I.H., Tousignant, J.D.,
Scheule, R. K., and Cheng, S. H. (2002) CpG depleted plasmid
DNA vectors with enhanced safety and long-term gene expression
in vivo. Mol. Ther. 5, 731–738
45. Kues, W. A., and Niemann, H. (2004) The contribution of farm
animals to human health. Trends Biotechnol. 22, 286–294
Received for publication November 15, 2005.
Accepted for publication February 14, 2006.
E10 Vol. 20 June 2006 The FASEB Journal
KUES ET AL.

Xenotransplantation 2006: 13: 345–356
Printed in Singapore. All rights reserved
doi: 10.1111/j.1399-3089.2006.00317.x
Health status of transgenic pigs expressing
the human complement regulatory protein
CD59
Deppenmeier S, Bock O, Mengel M, Niemann H, Kues W, Lemme E,
Wirth D, Wonigeit K, Kreipe H. Health status of transgenic pigs
expressing the human complement regulatory protein CD59.
Xenotransplantation 2006; 13: 345–356. Ó Blackwell Munksgaard, 2006
Abstract: Background: Microinjection of foreign DNA into pronuclei
of zygotes has been the method of choice for the production of transgenic
domestic animals. Following microinjection the transgene is randomly
integrated into the host genome which can be associated with
insertional mutagenesis and unwanted pathological side effects.
Methods: Here, we evaluated the health status of pigs transgenic for the
human regulator of complement activation (RCA) CD59 and conducted
a complete pathomorphological examination on 19 RCA transgenic pigs
at 1 to 32 months of age from nine transgenic lines. Nine wild-type
animals served as controls. Expression levels of human complement
regulator CD59 (hCD59) mRNA were measured by RT-PCR and distribution
of hCD59 protein was determined by immunohistochemistry.
Results: Albeit variable transgene expression levels, no specific pathomorphologic
phenotype associated with the presence of the transgene in
all analyzed pig lines could be detected.
Conclusions: Transgenic expression of this human RCA gene construct
is not correlated with a specific pathological phenotype in pigs. This is
crucial for the application of the technology and the use of transgenic
pigs for biomedical and agricultural applications.
Introduction
The critical shortage of human donor organs has
prompted considerable efforts in establishing
porcine to human xenotransplantation. The first
Copyright Ó Blackwell Munksgaard 2006
Stefanie Deppenmeier, 1,2 Oliver
Bock, 2 Michael Mengel, 2 Heiner
Niemann, 3 Wilfried Kues, 3 Erika
Lemme, 3 Dagmar Wirth, 4 Kurt
Wonigeit 5 and Hans Kreipe 2
1 Department of Pathology, School of Veterinary
Medicine Hannover, Hannover, 2 Department of
Pathology, Hannover Medical School, Hannover,
3 Department of Biotechnology, Institute of Animal
Breeding, Mariensee (FAL), Neustadt, 4 Department
of Gene Regulation and Differentiation, German
Research Center for Biotechnology, Braunschweig,
5 Klinik für Viszeral- und Transplantationschirurgie,
Hannover Medical School, Hannover, Germany
Key words: expression pattern – hCD59-transgenic
pigs – health status – phenotype –
xenotransplantation
Abbreviations: CMV: cytomegalovirus; DAF: decay
accelerating factor; DEPC: diethylpyrocarbonate;
EF1a: elongation factor 1 alpha; F1, F2: generation
number of transgenic offspring; FFPE: formalinefixed
paraffine-embedded; hCD59: human
complement regulator CD59; Ln./Lnn.: lymph node
(lymphonodus)/lymph nodes (lymphonodi); MCP:
membrane cofactor protein; PCR: polymerase chain
reaction; PCV: porcine circovirus; PRRSV: porcine
respiratory and reproduction syndrome virus;
RT-PCR: reverse transcriptase-polymerase chain
reaction; SPF: specific pathogen free; TNF: tumor
necrosis factor.
Address reprint requests to Professor Oliver Bock
MD, Institute of Pathology, Medizinische Hochschule
Hannover, Carl-Neuberg-Strasse 1, 30625 Hannover,
Germany (E-mail: bock.oliver@mh-hannover.de)
or Professor Heiner Niemann, Dept. Biotechnology,
Institute of Animal Breeding, (FAL) Mariensee, 31535
Neustadt, Germany (E-mail: niemann@tzv.fal.de)
Received 25 September 2005;
Accepted 9 April 2006
XENOTRANSPLANTATION
immunological barrier in xenotransplantation is the
hyperacute rejection response (HAR), which is
mediated by preformed xenoreactive antibodies
that are directed against the a-galactosyl-epitope
[1,2]. These antibodies activate the complement
345

Deppenmeier et al.
cascade of the organ recipient which results in a
rapid and irreversible destruction of the xenogenic
donor organ [3,4]. Transgenic overexpression of
human complement regulators such as CD59, CD55
[decay accelerating factor (DAF)] or CD46 [membrane
cofactor protein (MCP)] has been shown to
inhibit the complement cascade and reliably prevents
HAR [see 5–8]. The complement regulatory
protein human complement regulator CD59
(hCD59) inhibits formation of the membrane attack
complex at the end of the complement cascade [6–8].
Microinjection of foreign DNA into pronuclei of
zygotes has been the method of choice for the
production of transgenic domestic animals. However,
the technology is associated with a random
integration of the transgene and frequently an
unpredictable expression pattern in the transgenic
animals [9]. Due to the random integration and
variable expression patterns, insertional mutagenesis
and unwanted pathological side effects cannot
be ruled out and concerns have been raised about
animal welfare of animals resulting from this
approach [10,11]. Ectopic transgene expression
has been detected in some cases, but without any
obvious pathology [12,13]. Pathomorphological
phenotypes have been shown in transgenic and
non-transgenic offspring derived from microinjection,
in vitro fertilization and/or somatic cloning.
Overexpression of various growth hormone (GH)
constructs in transgenic pigs or sheep was associated
with a specific pathological phenotype, which
was avoided by improved GH constructs [14,15].
The large offspring syndrome [16], and specific
cardiopulmonary and placental lesions [17–19] and
lesions in the skeletal and muscle system [20,21]
have been observed as long-term consequences of
in vitro handling of bovine and ovine embryos.
However, a systematic analysis of potential pathological
side effects putatively associated with the
random integration and expression of a specific
transgene in transgenic domestic animals has not
yet been reported.
Here, we evaluated the health status of pigs
transgenic for the human complement regulator
protein CD59 and conducted a complete pathomorphological
examination on transgenic and wildtype
control animals. The transgenic pigs used in the
present study were hemizygous F1–F2 offspring
from nine transgenic lines. The founder animals had
been produced by pronuclear microinjection of
human regulator of complement activation (RCA)
constructs into porcine zygotes [22].
The main goals of the present study were to
determine (i) the health status of hCD59-transgenic
pigs by a detailed pathomorphological analysis,
and (ii) if transgenesis is correlated with specific
346
pathological changes in F1–F2 transgenic offspring.
In addition, the expression pattern of both
hCD59 mRNA and hCD59 protein in a large panel
of organs and tissues was determined.
Materials and methods
Animals
Nineteen German Landrace F1 and F2 hCD59transgenic
pigs (TG) from nine transgenic lines and
nine non-transgenic control pigs (WT), between 1
and 32 months of age were slaughtered at the
Institute for Animal Breeding, Mariensee. Both
groups were kept under identical specific pathogen
free (SPF) conditions. All animals were treated
according to institutional guidelines. The sex, age
and breeding line of the animals examined are
shown in Table 1. We selected a representative
number of animals from a total of nine different
transgenic lines with a rather broad range in age
for this study. This should render the results
representative for other pig populations derived
from this transgenic approach.
The vast majority of the animals analyzed in this
study were from cytomegalovirus promoter (CMV)hCD59
transgenic lines; in addition one animal with
a CMV-DAF transgene (from line 13) was analyzed.
The transgene expression patterns for line 5, carrying
a construct in which the CMV promoter (PCMV) drives expression of human CD59, have been
characterized previously [22]. Recently, transgenic
expression patterns of five lines (13, 17, 19, 20 and
21), carrying a tetracycline responsive promoter
(PtTA) have been described [23]. The expression
pattern from two lines (8 and 10) with a CMV driven
construct had not been published earlier. All
animals did not show any obvious health problems.
One animal (TG26) was from a double transgenic
background (hCD59 · hCD55).
Pathomorphological analysis
All pigs were killed and organs and tissues were
evaluated macroscopically for pathomorphological
changes. Lung and Lymphonodus pulmonalis were
tested by PCR for porcine circovirus type 2 (PCV
2) and for porcine respiratory and reproductive
syndrome virus (PRRSV) by a certified laboratory
(Laboklin, Bad Kissingen, Germany). These viruses
were included as they are emerging pathogens
that are now frequently found in domestic pig
populations. Histopathological examination
showed evidence (intracytoplasmic, basophilic
inclusion bodies in lymph nodes) for a PCV 2
infection in the animals.

Table 1. Age, sex and transgenic construct in pigs analyzed for pathologies
The following organs and tissues were fixed in
10% buffered formalin: skin (inner tight), skeletal
muscle (M. gracilis), heart (left ventricle, right
ventricle, septum), lung (Lobus cranialis, Lobus
caudalis), spleen, liver, kidney, urinary bladder,
pancreas, brain (cerebellum, cerebrum), thyroid
gland, lymphatic nodes (Ln. pulmonalis, Ln. cervicalis
superficialis, Lnn. ileofemorales, Lnn. mesenteriales),
esophagus, stomach, duodenum,
jejeunum, ileum, colon, and aorta. If the organs
and tissues did not show macroscopic lesions,
samples were taken from representative sites for
histopathological examination. If macroscopic lesions
were visible, the samples were taken from the
site of the lesion. After 24 h of fixation, samples
were paraffin-embedded, stained with hematoxylin–eosin
and histopathologically evaluated.
Determination of integration of the hCD59 construct
DNA extraction was performed as described previously
[24]. In brief, eight to 10 formalin-fixed,
paraffin-embedded (FFPE) samples derived from
heart, lung, spleen, liver, kidney, pancreas, brain,
skeletal muscle, and esophagus were employed for
genomic DNA isolation. The isolated DNA was
then adjusted to a final concentration of 50 ng/ll.
The human complement regulatory protein hCD59
Animal no. Age (months) Sex Construct Breeding line Litter size Stillborn G TG m TG f
WT1 8 Male – –
WT2 12 Male – –
WT3 15 Male – –
WT4 4 Male – –
WT5 18 Female – –
WT6 17 Female – –
WT7 21 Male – –
WT8 28 Male – –
WT9 1 Male – –
TG6 18 Male P CMV CD59 5 8 (4m, 4f) – F1 4 4
TG7 4 Female P CMV CD59 5 11 (3m, 8f) 1 F2 2 6
TG8 4 Female P CMV CD59 5 Sib. of TG7 1 F2 2 6
TG1 21 Female P CMV CD59-GFP 8 10 (6m, 4f) 1 F1 1 2
TG4 7 Male P CMV CD59-GFP 8 13 (7m, 6f) 2 F1 2 2
TG15 32 Female P CMV CD59-GFP 8 10 (4m, 6f) – F1 3 2
TG20 25 Male P CMV CD59-GFP 8 Sib. of TG4 2 F1 2 2
TG2 17 Female P CMV CD59-GFP 10 10 (3m, 7f) – F1 2 2
TG5 8 Female PCMV CD59-GFP 10 11 (5m, 6f) – F1 1 4
TG23 24 Male P tTA DAF-TA 13
TG13 7 Male P tTA CD59-TA 17
TG14 7 Male P tTA CD59-TA 19
TG19 15 Male P tTA CD59-TA 19
TG18 11 Male P tTA CD59-TA 20
TG21 16 Female P tTA CD59-TA 20
TG25 12 Female P tTA CD59-TA 20
TG27 1 Male P tTA CD59-TA 20
TG12 7 Male P tTA CD59-TA 21
TG26 1 Female P tTA CD59-TA 15 · 20
P tTA DAF-TA
GFP, enhanced green fluorescent protein; Sib, Sibling; G, generation; TG m, male transgenic piglets; TG f, female transgenic piglets; m, male; f, female.
Primers for amplification of hCD59 DNA were
based on the sequence of the hCD59 construct as
follows:
hCD59 forward: 5¢-GGTCATAGCCTGCAGT-
GCTACA-3¢,
hCD59 reverse: 5¢-AAATCAGATGAACAAT-
TGACGGC-3¢.
Primers for hCD59 generated a 77 bp product.
The sequence of tumor necrosis factor (TNF)
was chosen as control gene to prove successful
extraction of genomic DNA. The following TNFspecific
primers were employed (GenBank X54001):
TNF forward: 5¢-ATAGTATGAGGAGGAC-
TCGCTGAGC-3¢
TNF reverse: 5¢-ACATCCCATCTGTCCATG-
AGGTT-3¢.
The TNF primers generated a 94 bp product.
PCR amplification was performed in a Gene-
Amp Ò PCR System 2700 (Applied Biosystems,
Darmstadt, Germany) with a final reaction mixture
of 25 ll containing 250 nm of each primer, 0.5 units
of Platinum Taq Polymerase (Invitrogen, Karlsruhe,
Germany), 200 lm each of dATP, dCTP,
dTTP, and dGTP in 1x Platinum Taq reaction
buffer with 1.5 mm magnesium chloride and 5.0 ll
347

Deppenmeier et al.
DNA. The reaction mixture was preheated at 95°C
for 5 min, followed by 40 cycles at 95, 60, and 72°C,
30 s each. Final extension was performed for 5 min
at 72°C.
DNA derived from fibroblasts transfected with
the hCD59 construct served as positive controls.
DNA derived from organs and tissues of nontransgenic
control pigs and mock PCR (without
template) served as negative controls.
Analysis of hCD59 mRNA expression
Formalin-fixed, paraffin-embedded samples derived
from heart, lung, spleen, liver, kidney, pancreas,
brain, skeletal muscle, and esophagus of the
19 RCA-transgenic pigs were analyzed. For RNA
extraction from FFPE samples, a one-step protocol
was used as described previously [25]. Briefly, eight
to 10 sections ( 15 lm each) were cut from the
paraffin block with a microtome and placed directly
into a 1.5 ml screw cap-tube; 750 ll digestion
solution (4 m guanidinium isothiocyanate/0.75 m
sodium citrate/10% sarcosyl), 5.25 ll 0.1 b-mercaptoethanol
(Merck, Darmstadt, Germany) and
300 ll proteinase K solution (20 mg/ml in H2O;
Merck) were added, and the tubes were placed in a
thermoshaker for overnight incubation (55°C,
1400 g). The following day, the samples were
centrifuged at 4°C for 5 min at 14 000 g, and 1 ml
of each digested sample was transferred into a
2.0 ml tube. After addition of 100 ll 3m sodium
acetate (pH 5.2), 630 ll water-saturated phenol (pH
4.5 to 5.5), and 270 ll chloroform, the sample was
mixed thoroughly and stored on ice for 15 min.
After centrifugation at 4°C for 20 to 25 min at
14 000 g, the upper aqueous phase (approximately
1 ml) was pipetted into a fresh 2.0 ml tube; 1 ll
glycogen (20 mg/ml; Roche Molecular Diagnostics,
Mannheim, Germany) as an RNA carrier and 1 ml
2-propanol were added to the ribonucleic acidcontaining
aqueous phase. After mixing, the samples
were stored for at least 24 h at )20°C. After
precipitation, the samples were centrifuged at 4°C
for 20 min at 14 000 g. The RNA pellet was washed
with 70% ice-cold ethanol, air-dried, and dissolved
in 35 ll precooled DEPC-treated H 2O. The RNA
concentration was then measured spectrophotometrically.
Total RNA (1 lg), pretreated with RNase )
DNase (1 U/lg RNA; RQ1, Promega, Madison,
WI, USA), was then transcribed into complementary
DNA using 250 ng random hexamers (Amersham
Pharmacia, Freiburg, Germany) and 200 U
of SuperScript II Rnase ) Reverse Transcriptase
(Invitrogen) in a volume of 20 ll following the
manufacturer’s protocol. Negative controls were
348
performed by adding water instead of Reverse
Transcriptase.
Primers used for the hCD59 RT-PCR were
identical to the hCD59 DNA PCR (see above). The
housekeeping gene elongation factor 1 (EF1) a was
chosen as a positive control [26]. The following
sequences were used (GenBank XM203909):
EF1 a forward: 5¢-CAAAAAY(C/T)GAC-
CCACCAATGG-3¢
EF1 a reverse: 5¢-GGCCTGGATGGTTCAGG-
ATA-3¢.
The EF1 a RT-PCR generated a 68 bp product.
RT-PCR conditions were similar to the hCD59
PCR as described above.
RNA extracted from human kidney samples
served as positive controls. RNA derived from
various organs and tissues of non-transgenic control
pigs, of a hCD55-transgenic pig, and samples
without reverse transcriptase ()RT) served as
negative controls.
Immunohistochemistry for determination of hCD59 protein
expression
Immunohistochemistry was performed using a
tissue microarray technology as previously described
[27] employing the same FFPE samples as
for molecular analysis. For immunohistochemical
staining the tyramine amplification technique was
used as described [28]. Slides were deparaffinized,
dehydrated and rinsed in deionized water. Antigen
retrieval was carried out by incubation with
protease XIV (21.4 mg/50 ml aqua dest; Sigma-
Aldrich, Mu¨nchen, Germany) for 10 min. Endogenous
peroxidase blocking was performed with 3%
H 2O 2 (pH 7.5). Blocking of unspecific binding was
achieved by incubating with 0.5% casein for
10 min. To avoid unspecific binding to endogenous
biotin an incubation with avidin (Avidin/Biotin
blocking kit; Vector, Burlingame, CA, USA) for
10 min each was performed. To detect expression
of hCD59, a monoclonal mouse-anti-human
CD59-antibody [clone p282 (H19); BD PharMingen,
Heidelberg, Germany], diluted 1 : 200 was
applied and incubated overnight at 4°C. As secondary
antibody, biotinylated goat-anti-mouse-antibody
(Zytomed, Berlin, Germany) was applied in
dilution 1 : 900 for 30 min, followed by horseradish
peroxidase complex (Zytomed) diluted 1 : 500
was applied for 30 min. To amplify the reaction,
biotinylated tyramine with 0.003% H 2O 2 was
applied for 10 min. Biotinylation of tyramine was
performed as reported previously [27]. Incubation
with avidin-biotinylated alkaline phosphatase (Zytomed)
diluted 1 : 300 was performed for 30 min.

For color development, slides were incubated with
the chromogen fast red (1 mg fast red salt/1 ml fast
red buffer; Sigma-Aldrich) for 8 min, counterstained
with hemalum (dilution 1 : 3; Merck) and
thoroughly washed with buffer (0.1 m Tris–HCl,
pH 7.6/0.15 m NaCl/0.05% Tween 20) after each
incubation step. The staining pattern was evaluated
and the percentage of positively labeled cells
and their distribution pattern was assessed
() ¼ negative, + ¼ weak staining in up to 30%
of the cells, ++ ¼ moderate staining of 30% to
60% of the cells, +++ ¼ strong staining in
>60% of the cells). Human tonsillar tissue served
as positive control, whereas tissue derived from
non-transgenic pigs served as negative controls.
To ensure that the hCD59 staining pattern as
determined by screening of tissue arrays represented
the true overall staining pattern in transgenic
animals, whole tissue sections were stained and
evaluated accordingly in positive cases.
Results
Pathomorphological evaluation of transgenic pigs lines
expressing hCD59
Transgenic animals as well as non-transgenic
control pigs only rarely showed any pathological
lesions. Only in individual animals non-specific
pathologies were detected (Fig. 1). One non-transgenic
animal (WT3) had a bilateral, abdominal
cryptorchism. Another non-transgenic animal
(WT7) showed a moderate, focal, chronic, purulent
bronchopneumonia with multifocal minerali-
Fig. 1. Examples of histopathological
lesions in transgenic and non-transgenic
animals. (A) Lnn. ileofemorales (WT6):
Deposition of siderin-containing macrophages
(arrow) in the lymph node; (B)
Skin (WT7): mild, multifocal, perivascular
infiltration with lymphocytes, plasma cells
and single neutrophils (arrow); (C) Lung
(WT7): moderate, focal, chronic, purulent
bronchopneumonia with multifocal mineralization
(arrow); (D) Colon (TG7):
Balantidium coli (arrow) in the lumen (bar
100 lm).
The human complement regulatory protein hCD59
zation in the right frontal lobe of the lung. One
transgenic animal (TG4) had a severe, focal,
chronic, ulcerative gastritis in the pars proventricularis
and a severe, multifocal, follicular hyperplasia
of peribronchiolar follicles. One transgenic
animal (TG7) showed a severe, diffuse, chronic,
fibrous epi- and pericarditis and a mild, multifocal,
chronic, fibrous pleuritis in the lung. One transgenic
animal (TG15) had a moderate, focal,
chronic fibrosis of the liver capsule, and transgenic
animal TG20 showed histologically multifocal,
acute, single cell necroses of hepatocytes. One
transgenic animal (TG23) had multifocal, chronic
ossification in the mesenterium. In addition to
these specific lesions in individual animals, several
non-transgenic and transgenic animals showed
mild lesions in a variety of organs (Table 2,
Fig. 1) including mild, perivascular infiltration in
the skin, mild infiltration in the liver, mild, chronic
interstitial nephritis, mild infection with Balantidium
coli and deposition of siderin containing
macrophages in the Lnn. ileofemorales. Nonspecific
pathological signs were found in nontransgenic
control animals and transgenic animals
at the same ratio and to the same extent, and no
specific transgene related pathomorphology was
apparent.
PCV 2 could be detected in 65% of the transgenic
animals and 75% of the non-transgenic
animals. However, despite the existence of intracytoplasmic,
basophilic inclusion bodies in some
lymph nodes, no pathomorphological phenotype
typical for PCV 2-associated diseases, such as postweaning
multisystemic wastening syndrome
349

Deppenmeier et al.
Table 2. Lesions found in several animals
Organ Histopathological lesion Affected animals
(PMWS) or porcine dermatitis and nephropathy
syndrome (PDNS) were detected. PRRSV could
not be detected in any of the transgenic or control
animals.
Expression patterns of hCD59 mRNA in organs and tissues of
transgenic pigs
In general, the previously reported mosaic expression
patterns were confirmed [22,23]. Three animals
(TG18, TG19, TG25) expressed hCD59
mRNA in all organs examined. Twelve animals
(TG1, TG2, TG7, TG8, TG12, TG13, TG14,
TG15, TG20, TG21, TG26, T27) expressed
hCD59 mRNA only in a subset of organs and
tissues. The level of hCD59 mRNA expression
varied in organs and tissues within a single
transgenic animal as well as between different
animals (Table 4, Fig. 2). In four animals (TG4,
TG5, TG6, TG23) no hCD59 mRNA expression
could be detected. The hCD59 mRNA was
consistently demonstrated in positive controls
whereas in negative controls and samples without
reverse transcriptase ()RT) hCD59 mRNA
expression was never determined. EF1 a transcripts
could be detected in all samples indicating
Affected
animals (%)
Skin Mild, multifocal, perivascular infiltration with WT1, WT2, WT6, WT7
44% WT
lymphocytes, plasma cells and single neutrophils TG1, TG2, TG5, TG15, TG18, TG19, TG20, TG21
47% TG
Liver Mild, multifocal, infiltration with lymphocytes, WT3, WT4, WT6, WT7, WT8
56% WT
macrophages and single neutrophils
TG7, TG8, TG12, TG13, TG14, TG15, TG18, TG19, TG20, TG21, TG25 58% TG
Kidney Mild, multifocal, chronic, non-suppurative,
WT7
11% WT
interstitial nephritis
TG13, TG20, TG21
16% TG
Colon Balantidium coli in the lumen without
WT2
11% WT
inflammatory reaction
TG5, TG6, TG7, TG18
21% TG
Spleen Mild to moderate, multifocal, follicular hyperplasia WT3 11% WT
Ln. pulmonalis Multifocal, acute hemorrhages WT6, WT7
TG18, TG19, TG22, TG23, TG26
Follicular hyperplasia WT1, WT2, WT8
TG1, TG2, TG4, TG5, TG13, TG14, TG23, TG26
Edema and sinusoidal histiocytosis WT4, WT6, WT7
TG5, TG7, TG8, TG13, TG15, TG18, TG19, TG21
Lnn. mesenteriales Follicular hyperplasia WT2, WT3, WT4, WT5, WT6, WT8
TG4, TG5, TG7, TG12, TG13, TG15, TG18, TG19, TG20, TG21, TG23, TG25
Edema and sinusoidal histiocytosis WT4, WT7, WT8, WT9
TG4, TG8, TG13, TG14, TG18, TG19, TG21, TG25, TG26
Lnn. ileofemorales Follicular hyperplasia WT2, WT4
TG4, TG12, TG13, TG14, TG20
Edema and sinusoidal histiocytosis WT2, WT3, WT5, WT6, WT7, WT9
TG4, TG5, TG6, TG7, TG8, TG13, TG14, TG26, TG27
Siderin containing macrophages in the sinus WT3, WT5, WT6, WT7, WT9
TG7, TG8, TG15, TG19, TG20, TG23, TG26, TG27
Ln. cervicalis Follicular hyperplasia WT2
cran. superf.
TG4
Edema and sinusoidal histiocytosis WT2, WT4
TG5, TG7, TG8
350
22% WT
26% TG
33% WT
42% TG
33% WT
42% TG
67% WT
63% TG
44% WT
47% TG
22% WT
26% TG
66% WT
47% TG
56% WT
42% TG
11% WT
11% TG
22% WT
16% TG
successful RNA extraction, cDNA synthesis, and
RT-PCR. Samples without )RT were predominantly
negative, but some cases showed weak false
positive amplification products, probably due to an
incomplete DNase digestion.
As expected, hCD59 DNA could be detected in
all animals derived from the group of hCD59transgenic
animals (data not shown), confirming
transmission of the transgene over several generations.
Non-transgenic animals were negative for
hCD59-DNA.
Organ- and tissue-specific expression patterns of hCD59 protein
in transgenic animals
Thirteen of the 19 transgenic pigs showed cellular
expression of the hCD59 protein in various organs
and tissues (Table 3, Fig. 3). From these 13
animals, none showed a consistent expression
pattern of the transgene in all organs. Cellular
hCD59 protein expression could be demonstrated
only in a subset of organs and tissues, and with
remarkable variations between different animals.
In some animals a ‘‘patchy’’ expression pattern was
detected which was characterized by distinct positive
labeling of single cells in heart and kidney,

Table 3. Pattern of hCD59 protein expression in transgenic pigs
Skeletal
muscle Esophagus Duodenum Jejunum Ileum Colon
Urinary
bladder Pancreas Brain
L. Skin Heart Lung Spleen Liver Kidney
TG 6 (hCD59) 5 ++ End. ++ End. ) + End. + End. ) + End. +++ Acin. En. ++ End. ) ++ End. ) +End. ) ++ End.
TG 7 (hCD59) + End. + Card. ++ Alv., End. ) ) ) ) ) ) ) ) ) ) ) )
TG 8 (hCD59) ) ++ ++ Alv., End. ) + End. ) ) + Acin. ++ End. ) ++ End. + End. ) ++ End. ++ End.
TG1 (hCD59) 8 + End. ) ++ Alv., End. ) ) ++ End. ) ) ) ) ) ) ) ) )
TG 4 (hCD59) ) + End. ++ Alv., End ) ) ) ++ End. ) ) ) + End. ) ) ) ++ End.
TG 15 (hCD59) ) ++ End. ++ Alv., End. ) ) ++ End. ) + Acin. +++ End. ++ End. ) ) ) ) )
TG 20 (hCD59) +++ End. + End. ++ Alv., End. ) ) + End. ) ) ) ) ) ) ) ) )
TG2 (hCD59) 10 ) ) ) ) ) ) ) ) ) ) ) ) ) ) )
TG5 (hCD59) ) ) ) ) ) ) ) ) ) ) ) ) ) ) )
TG23 (hCD55) 13 ) ) ) ) ) ) ) ) ) ) ) ) ) ) )
TG13 (hCD59) 17 ) ) ) ) ) ) ) ) ) ) ) ) ) ) )
TG14 (hCD59) 19 ) ) ) ) ) ) ) ) ) ) ) ) ) ) )
TG19 (hCD59) ++ End. ++ End. +++ Alv., End. ) ++ End. + End. ) ) ) + Myoc. ) ) ) ) )
TG18 (hCD59) 20 +++ End. + End. +++ Alv., End. ) ) + End. ) ) ) ++ Myoc. ++ Myoc. ) ) ) ++ End.
TG21 (hCD59) ) ) ) ) ) ) ) ) ) ++ Myoc. ++ Myoc. ) ) ) )
TG25 (hCD59) ) ) ) ) ) ) ) ) ) + Myoc. + Myoc. ) ) ) )
TG27 (hCD59) ) ) ) ) ) ) ) ) ) + Myoc. + Myoc. ) ) ) )
TG12 (hCD59) 21 ) ) ) ) ) ) ) ) ) ) ) ) ) ) )
TG26 (hCD59+hCD55) 15 · 20 ) ) ) ) ) ) ) ) ) + Myoc. + Myoc. ) ) ) )
The human complement regulatory protein hCD59
Number and intensity of positively staining cells (referring to the tissue in general): +++ strong, ++ moderate, + weak, ) negative.
End., endothelial cells; Card., cardiomyocytes; Alv., alveolar epithelial cells; Ac., acinic cells; En., endocrine pancreas (islet cells); Myoc., myocytes.
351

Deppenmeier et al.
Table 4. Comparative analysis of hCD59 protein and mRNA expression in transgenic pigs
Heart Lung Spleen Liver Kidney Pancreas Brain
with neighboring cells remaining negative for the
hCD59 protein (Fig. 3). The following organs
showed a positive, intracytoplasmic staining for
Skeletal
muscle Esophagus
Prot. RNA Prot. RNA Prot. RNA Prot. RNA Prot. RNA Prot. RNA Prot. RNA Prot. RNA Prot. RNA
TG6 5 ++ ) ) ) + ) + ) ) ) +++ ) ++ ) ) ) ++ )
TG7 5 + ++(+) ++ ++ (+) ) ) ) ++ ) ) ) n.d. ) n.d. ) ) ) )
TG8 5 ++ ) ++ + ) ) + ++ ) ) + ) ++ ++ ) ) ++ )
TG1 8 ) ) ++ ) ) + ) ) ++ +++ ) ) ) ) ) ) ) )
TG4 8 + ) ++ ) ) ) ) ) ) ) ) ) ) ) ) ) + )
TG15 8 ++ ++ ++ ++ ) ++ ) ) ++ ) + ) +++ + ) ) ) ++
TG20 8 + ++ ++ + ) +++ ) ) + +++ ) ) ) + ) + ) ++
TG2 10 ) ) ) ) ) ++ ) ) ) ) ) ) ) ) ) ) ) )
TG5 10 ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) )
TG23 13 ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) )
TG13 17 ) ) ) ) ) ) ) ) ) + ) + ) ) ) + ) +
TG14 19 ) ) ) ) ) ++ ) ++ ) ++ ) + ) + ) ) ) )
TG19 19 ++ ++(+) +++ +++ ) +++ ++ +++ + +++ ) +(+) ) +++ + +++ ) +++
TG18 20 + +++ +++ ++ ) ++ ) ++ + ++ ) ++ ) +(+) ++ +++ ++ +++
TG21 20 ) + ) ++ ) ++(+) ) (+) ) ++(+) ) ) ) ) ++ +++ ++ ++(+)
TG25 20 ) ++ ) ++ ) ++ ) +++ ) ) ++ ) n.d. + +++ + +++
TG27 20 ) ) ) +(+) ) ) ) ) ) ++ ) ) ) ) + ++ + +
TG12 21 ) ) ) + ) +(+) ) ) ) + ) ) ) ) ) ) ) )
TG26 15
20
) ) ) ) ) ) ) ) ) ) ) ) ) ) + +(+) + +
n.d., not done.
+++ strong, ++(+) strong to moderate, ++ moderate, +(+) weak to moderate, + weak, ) negative.
352
Fig. 2. Variable hCD59 mRNA expression
as demonstrated for a hCD59 transgenic
animal. (A) hCD59 mRNA could be
detected by RT-PCR in heart, lung, spleen,
kidney, brain, muscle and esophagus
whereas liver and pancreas virtually
showed no expression of the transgene.
hCD59-transfected cells served as the
positive control. Non-transgenic pig
without expression. (B) RT-PCR detection
of EF1 a-transcripts.
hCD59 protein: skin, heart, lung, spleen, liver,
kidney, urinary bladder, skeletal muscle, esophagus,
duodenum, jejunum, ileum and colon. Endo-

thelial cells of small and medium blood vessels
expressed hCD59 protein. In the lung, not only
endothelial cells, but also alveolarepithelial cells
The human complement regulatory protein hCD59
Fig. 3. Representative staining pattern of hCD59 protein in a variety of organs derived from different transgenic animals. (A) Kidney
(TG1): expression in glomerular endothelial cells (arrow) and in the endothelial cells of an afferent arteriole (arrowhead); (B) Lung
(TG8): expression in alveolar epithelial cells type I (arrowhead) and type II (arrow); (C) Heart (TG7): expression in the cytoplasm of
a cardiomyocyte (arrow) without staining of the neighboring cells, ‘‘patchy pattern’’; (D) Pancreas (TG6): expression in acinary cells
of the exocrine pancreas and in single islet cells (arrows); (E) Pancreas (TG15): expression in acinary cells of the exocrine pancreas
(arrow), ‘‘patchy pattern’’, no staining of endothelial cells; (F) Heart (TG6): expression in endothelial cells (arrow); (G) Brain
(TG15): expression in endothelial cells (arrow); (H) Skin (TG6): expression in endothelial cells (arrow); (I) human tonsillar tissue used
as positive control: expression in endothelial cells; (J–O) negative controls of a non-transgenic pig (WT4): (J) kidney; (K) lung; (L)
heart; (M) pancreas; (N) brain; (O) skin. A, D, I, J, M, O: ·250; B, C, E, F, G, H, K, L, N: ·400 (bar 100 lm).
type I and II showed hCD59 labeling. In the
pancreas, acinic cells of the exocrine pancreas, and
islet cells of the endocrine pancreas showed hCD59
353

Deppenmeier et al.
protein expression. The acinic cells of the exocrine
pancreas of one animal (TG15) showed a patchy
expression pattern. The cytoplasm, especially the
outer membrane, of some cardiomyocytes in animal
TG7 stained patchy for hCD59. The myocytes
in the skeletal muscle and the muscular layer of the
esophagus in six animals (TG18, TG19, TG21,
TG25, TG26, TG27) showed a patchy expression
pattern of hCD59, with only a part of the skeletal
muscle cells showing a positive reaction. In the
kidney of one animal (TG1), endothelial cells of
the capillaries in the glomerula and afferent arteries
showed a positive staining, with only single glomerula
showing the positive reaction. Non-transgenic
animals never showed expression of hCD59protein.
Discussion
The study reported here is the first systemic
analysis to detect pathological side effects potentially
associated with expression of a specific
transgene, using hCD59 as a model. Results show
that in transgenic pigs produced by microinjection
of foreign DNA into pronuclei the health status is
not different from that of the wild-type control
animals. A total of 19 transgenic pigs from nine
lines were analyzed. As the production and breeding
of transgenic pigs is a time consuming, complex
and costly process, we restricted the number of
transgenic animals to be analyzed to one to four
animals per transgenic line and covered a rather
broad range of different ages. This approach
ensures representative results also for other transgenic
programs. Wild-type animals from the same
facility served as controls.
It is well known that random integration of a
foreign DNA could be associated with insertional
mutagenesis [9]. A major prerequisite for a potential
usage of transgenic porcine organs in xenotransplantation
is that animal health and welfare
are not compromised. Here, we show that microinjection
of foreign DNA is not associated with a
specific pathomorphological phenotype in pigs.
Some of the animals had chronic interstitial
nephritis, pneumonia or epi- and pericarditis.
These lesions are common pathological features
especially in older animals in modern pig populations
and were probably caused by previous viral
or bacterial infections [29]. Because of the chronic
nature of these lesions, the causative agent could
not be detected any more. Lesions in organs like
kidney or lung show that it is of crucial importance
to check the organs for transferable diseases before
xenotransplantation. The activation of spleen and
lymph nodes as shown by follicular hyperplasia,
354
edema and sinusoidal histiocytosis, can be attributed
to a previous challenge with unspecific pathogens.
As the animals were not maintained under
gnotobiotic conditions, but kept under SPF conditions,
a challenge with ubiquitous pathogens is
likely to occur. The deposition of siderin-containing
macrophages in the sinus of the ileofemoral
lymph nodes are likely remnants from ferric
injections which are commonly performed in pig
populations. Non-transgenic control animals and
transgenic animals were affected in approximately
the same ratio and to the same extent by the lesions
(Table 2). Prior to the use of porcine organs in
xenotransplantation, the donor animals must be
screened thoroughly for possible infections with
pathogens, because of the risk of transmitting these
pathogens to the host [5].
In the majority of the transgenic and nontransgenic
animals PCV 2 was detected by PCR.
PCV 2 is found widely within modern pig populations
and in most cases a PCV 2 infection is not
associated with clinical or pathomorphological
changes. In some cases the infection can be
associated with certain diseases, including PMWS
or PDNS [30]. In this study, none of the PCV IIpositive
transgenic and non-transgenic pigs showed
any signs of such PCV II-associated diseases.
In accordance with the original report a varying
expression pattern for hCD59 was detected in lines
5, 17, 19, 20 and 21. Lines 17, 19, 20 and 21 showed
a muscle fiber-confined expression of hCD59. In
some cases the mRNA, but not the protein could
be detected. This might be due to a higher
sensitivity of the PCR assay compared with the
immunohistology.
CD59 mRNA was variably expressed in the
tested animals. In few animals mRNA expression
of the transgene was not detected (Table 4). As
hCD59 protein was detected in heart, lung, and
skin of these animals (Table 3), this most likely
reflects RNA degradation in these samples.
Similar to the hCD59 mRNA, the protein
expression pattern was variable as well. Despite
the use of an ubiquitously active promoter (CMV)
no animal expressed the protein in all organs,
instead most animals expressed the transgene in a
subset of organs. In addition, a patchy expression
pattern could be detected in heart and kidney. A
likely explanation for the variable expression
pattern could be the promoter and/or the impact
of chromosomal flanking regions. The CMV promoter
had been selected because it is known to
induce a strong and ubiquitous transgenic expression
in cell lines and transgenic mice as well [31,32].
However, reports from different transgenic animal
models confirm our finding that CMV and

CMV-derived promoter expression can vary both
within different lines and even between tissues of a
single line, and can thus result in mosaic patterns
even within one tissue [33–36]. Recent studies and
own results point to de novo DNA methylation in
transgenic pigs as a mechanism to silence expression
[23,37]. Crossbreeding experiments of lines 13
and 20 resulted in a broad tissue-unspecific expression
of hCD59 [23] highlighting that breeding of
the existing lines might yield pigs with an ubiquitous
expression of human complement regulators.
In summary, no evidence for pathomorphological
changes was found in a representative number
of transgenic pigs from nine transgenic pig lines of
the F1 and F2 generation, including animals with
high levels of the transgenic expression in several
tissues. Results of this study provide compelling
evidence that stable integration of constructs
encoding the human complement regulatory protein
hCD59 into the pig genome and its expression
do not affect the health status of pigs. Results of
the present study are crucial for the application of
the technology and the use of transgenic pigs for
biomedical and agricultural applications.
Acknowledgments
The expert technical support by KG. Hadeler, H.
Hornbostel, W. Hasselbring and T. Peker are
gratefully acknowledged. H.N., K.W. and H.K
received support via SFB 265 from the DFG.
References
1. Galili U, Rachmilewitz EA, Peleg A, Flechner I. A
unique natural human IgG antibody with anti-a-galactosyl
specificity. J Exp Med 1984; 160: 1519.
2. Galili U, Clark MR, Shohet SB, Buehler J, Macher
BA. Evolutionary relationship between the natural anti-
Gal antibody and the Gala1–3Gal epitopes in primates.
Proc Natl Acad Sci USA 1987; 84: 1369.
3. Platt JL, Fischel RJ, Matas AJ et al. Immunopathology
of hyperacute xenograft rejection in a swine-to-primate
model. Transplantation 1991; 52: 214.
4. Rose AG, Cooper DKC. Venular thrombosis is the key
event in the pathogenesis of antibody-mediated cardiac
rejection. Xenotransplantation 2000; 7: 31.
5. Kues WA, Niemann H. The contribution of farm animals
to human health. Trends Biotechnol 2004; 22: 286.
6. Davies A, Simmons DL, Hale G et al. CD59, an
LY-6-like protein expressed in human lymphoid cells,
regulates the action of the complement membrane attack
complex on homologous cells. J Exp Med 1989; 170: 637.
7. Meri S, Morgan BP, Davies AR et al. Human protectin
(CD59), an 18,000–20,000 MW complement lysis restricting
factor, inhibits C5b-8 catalysed insertion of C9 into
lipid bilayers. Immunology 1990; 71: 1.
8. Rollins SA, Sims PJ. The complement-inhibitory activity
of CD59 resides in its capacity to block incorporation of
C9 into membrane C5b-9. J Immunol 1990; 144: 3478.
The human complement regulatory protein hCD59
9. Niemann H, Kues WA. Transgenic livestock: premises
and promises. Anim Reprod Sci 2000; 60–61: 277.
10. Fox MW. Genetic engineering biotechnology: animal
welfare and environmental concerns. Appl Anim Behav
Sci 1988; 20: 83.
11. Hughes BO, Hughes GS, Waddington D, Appleby
MC. Behavioural comparison of transgenic and control
sheep: movement order, behaviour on pasture and in
covered pens. J Anim Sci 1996; 63: 91.
12. Niemann H, Halter R, Carnwath JW et al. Expression
of human blood clotting factor VIII in the mammary
gland of transgenic sheep. Transgenic Res 1999; 8: 237.
13. Van Reenen CG, Meuwissen THE, Hopster H et al.
Transgenesis may affect farm animal welfare: a case for
systemic risk assessment. J Anim Sci 2001; 79: 1763.
14. Pursel VG, Pinkert CA, Miller KF et al. Genetic
engineering of livestock. Science 1989; 244: 1281.
15. Nottle MB, Nagashima H, Verma PJ et al. Production
and analysis of transgenic pigs containing a metallothionein
porcine growth hormone gene construct. In:
Murray JD, Anderson GB, Oberbauer AM, McGloughlin
MM, eds. Transgenic Animals in Agriculture.
New York, NY, USA: CABI Publ., 1999. 145–156.
16. Niemann H, Wrenzycki C. Alterations of expression of
developmentally important genes in preimplantation bovine
embryos by in vitro culture conditions: implications
for subsequent development. Theriogenology 2000; 53: 21.
17. Cibelli JB, Stice SL, Golueke PJ et al. Cloned transgenic
calves produced from nonquiescent fetal fibroblasts.
Science 1998; 280: 1256.
18. Hill JR, Roussel AJ, Cibelli JB et al. Clinical and
pathologic features of cloned transgenic calves and features
(13 case studies). Theriogenology 1999; 51: 1451.
19. Carter DB, Lai L, Park KW et al. Phenotyping of
transgenic cloned piglets. Cloning Stem Cells 2002; 4: 131.
20. Park KW, Cheong HT, Lai L et al. Production of nuclear
transfer-derived swine that express the enhanced green
fluorescent protein. Anim Biotechnol 2001; 12: 173.
21. Lai L, Kolber-Simonds D, Park KW et al. Production
of a-1,3-galactosyltransferase knockout pigs by nuclear
transfer cloning. Science 2002; 295: 1089.
22. Niemann H, Verhoeyen E, Wonigeit K et al. Cytomegalovirus
early promoter induced expression of hCD59
in porcine organs provides protection against hyperacute
rejection. Transplantation 2001; 72: 1898.
23. Kues WA, Schwinzer R, Wirth D et al. Epigenetic
silencing and tissue independent expression of a novel
tetracycline inducible system in double transgenic pigs.
FASEB J 2006; Express fj. 05-4515 fjev1.
24. Lehmann U, Kreipe H. Real time PCR analysis of DNA
and RNA extracted from formalin-fixed and paraffinembedded
biopsies. Methods 2001; 25: 409.
25. Bock O, Kreipe H, Lehmann U. One-step extraction of
RNA from archival biopsies. Anal Biochem 2001; 295: 116.
26. Gruber AD, Levine RA. In situ assessment of mRNA
accessibility in heterogenous tissue samples using elongation
factor-1a (EF-1a). Histochem Cell Biol 1997; 107: 411.
27. Von Wasielewski R, Mengel M, Wiese B et al. Tissue
array technology for testing interlaboratory and interobserver
reproducibility of immunohistochemical estrogen
receptor analysis in a large multicenter trial. Am J Clin
Pathol 2002; 118: 675.
28. Mengel M, Werner M, Von Wasielewski R. Concentration
dependent and adverse effects in immunohistochemistry
using the tyramine amplification technique.
Biochem J 1999; 31: 195.
355

Deppenmeier et al.
29. Jubb KVF, Kennedy PC, Palmer N. Pathology of
Domestic Animals, 4th edn, Vol. 2. San Diego, CA, USA:
Academic Press, 1993.
30. Krakowka S, Ellis JA, McNeilly F et al. Activation of
the immune system is the pivotal event in the production
of wasting disease in pigs infected with porcine circovirus-
2 (PCV-2). Vet Pathol 2001; 38: 31.
31. Boshart M, Weber F, Jahn G et al. A very strong
enhancer is located upstream of an immediate early gene
of human cytomegalovirus. Cell 1985; 41: 521.
32. Fodor WL, Williams BL, Matis LA et al. Expression
of a functional human complement inhibitor in a transgenic
pig as a model for the prevention xenogeneic
hyperacute organ reaction. Proc Natl Acad Sci USA 1994;
91: 11153.
33. Furth PA, Hennighausen L, Baker C, Beatty B,
Woychick R. The variability in activity of the universally
356
expressed human cytomegalovirus immediate early gene 1
enhancer/promotor in transgenic mice. Nucleic Acids Res
1991; 19: 6205.
34. McGrew MJ, Sherman A, Ellard FM et al. Efficient
production of germline transgenic chickens using lentiviral
vectors. EMBO Rep 2004; 5: 1.
35. Baskar JF, Smith PP, Nilaver G et al. The enhancer
domain of the human cytomegalovirus major immediateearly
Promotor determines cell type-specific expression in
transgenic mice. J Virol 1996; 70: 3207.
36. Furth PA, St Onge L, Boger H et al. Temporal control
of gene expression in transgenic mice by a tertracyclineresponsive
Promotor. Proc Natl Acad Sci USA 1994; 91:
9302.
37. Hofmann A, Kessler B, Ewerling S et al. Epigenetic
regulation of lentiviral transgene vectors in a large animal
model. Mol Ther 2006; 13: 59.

Arch Virol (2006)
DOI 10.1007/s00705-006-0868-y
Printed in The Netherlands
Brief Report
Inhibition of porcine endogenous retroviruses (PERVs) in primary
porcine cells by RNA interference using lentiviral vectors
B. Dieckhoff 1; , A. Karlas 1; , A. Hofmann 2 , W. A. Kues 3 , B. Petersen 3 , A. Pfeifer 2 , H. Niemann 3 ,
R. Kurth 1 , and J. Denner 1
1 Robert Koch-Institute, Berlin, Germany
2 Department of Pharmacy, Ludwig-Maximilians-University, M€unchen, Germany
3 Department of Biotechnology, Institute for Animal Science, Neustadt, Germany
Received July 14, 2006; accepted September 13, 2006; published online November 16, 2006
# Springer-Verlag 2006
Summary
A potential risk in pig-to-human xenotransplantation
is the transmission of PERVs to human recipients.
Here we show for the first time the inhibition of
PERV expression in primary porcine cells by RNA
interference using lentiviral vectors. Cells were
transduced with lentiviral vectors coding for short
hairpin (sh) RNAs directed against PERV. In all
primary porcine cells studied and in the porcine
kidney cell line PK-15, expression of PERV-mRNA
was significantly reduced as measured by real-time
PCR. Most importantly, expression of PERV proteins
was almost completely suppressed, as shown
by Western blot analysis. Thus, lentiviral shRNA
vectors could be used to knockdown PERV expression
and create transgenic pigs with a reduced risk of
PERV transmission during xenotransplantation.
The transplantation of porcine xenografts may offer
a potential way to overcome the shortage of
Authors contributed equally.
Author’s address: Dr. Joachim Denner, Robert
Koch-Institute, Nordufer 20, 13353 Berlin, Germany.
e-mail: DennerJ@rki.de
allogeneic organs. However, xenotransplantation
may be associated with the risk of transmission of
PERVs, which are integrated in the porcine genome
[3, 23] and have been found to be released as infectious
particles from normal pig cells [15, 17, 26].
Three subtypes of PERVs (A, B and C) are known
which mainly differ in the env region encoding for
the receptor-binding site [12, 23, 29]. PERV-A and
PERV-B are polytropic viruses and able to infect
human cells in vitro [16, 22, 25, 29, 30], whereas
PERV-C is an ecotropic virus. Even though PERVs
are able to infect human cells in vitro, no virus
transmission has been observed in previous experimental
and clinical xenotransplantations [6, 8, 21,
27]. However, in most of these approaches, the time
of contact was short and the immunosuppression
was weak. In contrast, the intended conditions for
future xenotransplantations include long-term transplantation
of porcine cells or organs, direct contact
of human and porcine cells, and a strong immunosuppression
to avoid rejection. PERV transmission
has also not been observed in pig-to-nonhuman primate
transplantations and infection experiments
[2, 14, 31]. However, the risk of PERV transmission
associated with tumours or immunodeficiencies
is still existent. Therefore, different strategies to

prevent PERV transmission have been developed,
such as the selection of low-producer animals [20,
28], the generation of an antiviral vaccine [4], and
the inhibition of PERV expression by RNA interference
[9, 18]. In these first experiments, inhibition
of PERV expression by small interfering RNAs
(siRNAs) was studied in PERV-infected human
cells.
In this study, we describe for the first time inhibition
of PERV expression in primary porcine cells
transduced by lentiviral vectors expressing anti-
PERV shRNA. We studied the genetic distribution,
the expression pattern of different PERV subtypes,
and the inhibitory effect of two different lentiviral
vectors on PERV expression.
In order to analyze the presence of PERV-A,
PERV-B and PERV-C proviruses, DNA was isolated
from three foetal fibroblast cultures (SE101, SE105
and P1F10) obtained from individual D25 (p.c.)
German landrace foetuses [11] as well as from
PK-15 cells, using the QIAamp DNA Blood Mini
Kit (Qiagen, Hilden, Germany), and a PCR was
Fig. 1. Analysis of PERV provirus integration and expression
in porcine primary fibroblasts and PK-15 cells. A
Detection of PERV proviruses in the genome of two independent
primary fibroblast cultures (SE101, P1 F10) and
PK-15 cells using PCR. B PERV expression in foetal fibroblasts
(SE101 and P1 F10) and in PK-15 cells using onestep
RT-PCR. In addition to specific primers for env-A,
env-B, env-C, primers specifically detecting full-length
and spliced env mRNA were used. Integrity of RNA was
determined by amplifying GAPDH
B. Dieckhoff et al.
performed using primers specific for env of subtypes
A, B [12] and C [29]. All proviruses were
found integrated in the genome of the primary
fibroblasts P1 F10 and SE101, whereas PK-15 cells
did not contain PERV C (Fig. 1A).
In order to study PERV expression, total RNA
was isolated (RNeasy Kit, Qiagen), and a onestep
reverse transcription (RT) PCR (Invitrogen,
Karlsruhe, Germany) was performed using the
same primers as described above as well as primers
allowing the discrimination between viral fulllength
RNA (forward: 5 0 TGCTGTTTGCATCAA
GACCGC, reverse: 5 0 ACAGACACTCAGAA
CAGAGAC) and spliced env-mRNA (forward: 5 0
TGCTGTTTGCATCAAGACCGC, reverse: 5 0
ATGGAGGCGAAGCTTAAGGGGA). The integrity
of the RNA was determined by amplifying the
housekeeping gene glyceraldehyde-3-phosphate
dehydrogenase (GAPDH, for: 5 0 CTGCCCCTT
CTG CTGATGC; rev: 5 0 TCC ACGATGCCGAA
GTTGTC). In all primary cells tested, full-length
mRNAs corresponding to the PERV subtypes A and
BandCaswellassplicedenv mRNA were detected
(Fig. 1B). Since no PERV-C proviruses were integrated
in PK-15 cells, no PERV-C-specific mRNA
was found (Fig. 1B). The presence of spliced env
mRNA indicates that Env protein may be generated
and consequently virus particles may be produced.
In our previous publications, different synthetic
siRNAs corresponding to several parts of the sequence
of PERV were designed and screened for
their ability to inhibit expression of PERV in infected
human 293 cells [9, 10]. The most effective
siRNA corresponded to a highly conserved sequence
in the pol gene (pol2); the target sequence
is identical in all functional PERV strains. Like
other siRNA used, the pol2 siRNA was able to inhibit
PERV-A and PERV-B [10]. Inserted into the
vector pSuper, permanent expression of this polspecific
shRNA was achieved, and efficient inhibition
of PERV expression was observed [9, 10]. This
pSuper-pol2 construct was chosen as a basis for
establishing a lentiviral expression system.
Two different lentiviral vectors, RRL-pGK-GFP
[5] (kindly provided by L. Naldini) and pLVTHM
[32] (kindly provided by D. Trono), which allow
expression of the corresponding short hairpin

Inhibition of PERV expression by RNA interference
Fig. 2. Schematic representation of the lentiviral vectors
RRL-pGK-GFP and pLVTHM. LTR long terminal repeat,
H1 polymerase III H1-RNA gene promotor, shRNA short
hairpin RNA, SIN self-inactivating element, cPPT central
polypurine tract, GFP green fluorescent protein, WPRE
post-transcriptional element of woodchuck hepatitis virus,
EF-1alfa elongation factor-1a promoter, teto tetracycline
operator, hPGK phosphoglycerate kinase promotor, loxP
locus of X-over of P1, recombination site of Cre recombinase
for bacteriophage P1
RNAs, were used (Fig. 2). They differed in the
promoters inducing the expression of the GFP reporter
(pLVTHM used an EF1a promoter, whereas
RRL-pGK-GFP used a PGK promoter) and in the
arrangement of shRNA and GFP expression cassettes.
In the case of the pLVTHM, the shRNAexpressing
cassette is located within the 3 0 -LTR
(long terminal repeat). The shRNA expression cassette
of the vector pSuper-pol2 was inserted into
pLVTHM and RRL-pGK-GFP using the restriction
enzymes EcoRI and ClaI, and EcoRI and HindIII
(New England Biolab, Frankfurt, Germany), respectively,
resulting in pLVTHM-pol2 and RRLpGK-GFP-pol2.
Lentiviral particles were obtained
by co-transfecting the packaging cell line 293T with
the envelope plasmid pCL-VSV-G, the packaging
plasmid psPAX2, the transfer vector pLVTHM,
and the transfer vector pLVTHM-pol2. Titration of
concentrated lentiviral particles was performed on
Hela cells as described (lentiweb.com). The titres
were 1.73 10 8 IU=ml for pLVTHM and 1.78
10 7 IU=ml for pLVTHM-pol2. RRL-pGK-GFPpol2
and RRL-pGK-GFP were produced as described
recently [7, 24]. The titres were 2.25
10 10 and 2.0 10 10 IU=ml, respectively.
For transduction of foetal fibroblasts and PK-15
cells, 1 10 5 cells were seeded in a 6-well culture
plate in the presence of 6 mg=ml polybrene in
DMEM and incubated with concentrated lentiviral
particles at a MOI of 2.5 for 5 days. By fluorescence
microscopy and flow cytometry, transduction
efficiencies of 90% were measured. In the case of
lower efficiencies, transduced cells were enriched
by cell sorting (MoFlo, Dako, Glostrup, Denmark)
or repeated addition of lentiviral particles. As a result,
transduction efficiencies of around 95% were
achieved.
Total RNA and protein were isolated from transduced
and non-transduced foetal fibroblasts and
PK-15 cells using TRI Reagent (Sigma, Steinheim,
Germany) and the RNeasy Kit (Qiagen). To measure
PERVexpression quantitatively, a SYBR Green
real-time RT-PCR was performed as described
previously [9]. An inhibition of PERV mRNA expression
of 82.5 and 78% was observed in foetal
fibroblasts SE101 and SE105 using the vector RRL-
PGK-GFP-pol2 (Fig. 3A). In addition, a one-step
RT real-time PCR (Invitrogen) was performed
using a FAM-labelled probe (5 0 FAM-AGAAGG
GACCTTGGCAGACTTTCT [3BQ1], Sigma),
primers specific for PERV gag (forward: 5 0
TCCAGGGCTCATAATTTGTC, reverse: 5 0 TGA
TGGCCATCCAACATCGA), and the Mx4000
multiplex quantitative PCR system (Stratagene,
La Jolla, USA). The assay revealed a coefficient
of correlation of 0.980 with an almost optimal efficiency
of amplification. For each reaction, 50 ng
total RNA was used. The amount of full-length
RNA was calculated relative to the constituted
amount of total RNA using a modification of the
CT
2 method [13], and the expression of PERV
in cells transduced with shRNA lentiviral particles
was compared with the expression in cells transduced
with the control vector as well as non-transduced
cells. An inhibition of PERV full-length
mRNA expression of 81.8% was observed in foetal
fibroblasts P1 F10 transduced with pLVTHM-pol2
(Fig. 3A). When P1 F10 cells that had been sorted
for GFP-positive cells in order to increase the number
of transduced cells (nearly 99%) were analysed,
the inhibition of PERV expression increased up
to 94.8%. Inhibition of PERV expression in trans-

B. Dieckhoff et al.
duced cells was stable and remained at 95% over
months (Fig. 3A). Finally, it is important to note that
expression of PERV in primary fibroblasts was very
low (0.2%) when compared with the expression in
virus-producing PK-15 cells (defined as 100%).
After showing that pLVTHM-pol2 and RRL-
PGK-GFP-pol2 were able to inhibit PERV expression
in foetal fibroblasts, their effect in another cell
type was studied. Epithelial PK-15 cells were transduced
with both lentiviral vectors, RRL-PGK-GFPpol2
and pLVTHM-pol2, at an efficiency of 95%
and showed an inhibited PERV expression of 65.8
and 73.5%, respectively (Fig. 3B), indicating that
PERV expression can be inhibited in different cell
types. PERV expression was also reduced in PHAtreated
PBMCs, which were difficult to analyse
since the transduction efficiency was relatively
low. However, after enrichment of GFP-expressing
PBMCs by fluorescence-activated cell sorting, an
inhibition of PERV full-length mRNA expression
of 75.2% was observed.
In order to analyse whether reduced expression
of PERV mRNA leads to a reduced expression of
viral proteins, protein samples of foetal fibroblasts
P1 F10 and PK-15 cells were analysed using a
Western blot assay. Analysing protein lysates of
transduced and non-transduced PK-15 cells (50 mg)
by Western blot with a goat anti-p27Gag-antiserum
[8], a reduced PERV expression was detected in
cells transduced with both lentiviral pol2 vectors
(Fig. 3C). Loading of equal protein amounts was
verified using antibodies against b-actin (Sigma).
However, even if 80 mg total protein lysate of fetal
fibroblasts P1 F10 was used, no Gag protein was
detected even in the non-transduced control cells,
1
Fig. 3. Expression of PERV in cells transduced with the
lentiviral vectors RRL-PGK-GFP-pol2 and pLVTHM-pol2
and in cells transduced with control vector as well as in
non-transduced cells (set 100%). A Three batches of foetal
fibroblasts and B PK-15 cells transduced with both vectors
were analysed at day 5 or at other time points after transduction
using one-step RT real-time PCR. C Western blots
showing expression of p27Gag in PK-15 cells transduced
with RRL-PGK-GFP-pol2 and pLVTHM-pol2 and in controls.
D RT activity in the supernatants of PK-15 cells
transduced with RRL-PGK-GFP-pol2 and pLVTHM-pol2,
and control cells

Inhibition of PERV expression by RNA interference
suggesting that the PERV protein expression in
these cells is under the detection level.
To analyse whether viral reverse transcriptase
(RT) activity was released into the supernatants of
control and transduced foetal fibroblasts P1 F10
and PK-15 cells, an RT activity assay was performed
(Cavidi Bio Tech, Uppsala, Sweden). Transduced
and control PK-15 cells were seeded at a density
of 5 10 4 cells in 24-well plates and RT activity
was measured in the supernatants after three
days. This assay demonstrated a reduced RT activity
in the supernatants of PK-15 cells transduced
with both lentiviral vectors, RRL-PGK-GFP-pol2
(5.78 mU=ml) and pLVTHM-pol2 (4.74 mU=ml),
compared with the expression of untreated control
cells (21.21 mU=ml) (Fig. 3D). In the supernatants
of fetal fibroblasts P1 F10, no RT activity (0 mU=ml)
was detected, confirming the low expression of
PERV even in untreated cells.
In this study, we show for the first time a significant
inhibition of PERV expression in primary
porcine cells by lentiviral vector-mediated RNA
interference. These data correlate with previous experiments
investigating PERV-specific RNA interference
in human cells infected with PERV-B
or with a recombinant PERV-A=C using synthetic
siRNAs and the pSuper vector system [9, 10, 18].
Lentiviral vectors were chosen, firstly, to increase
the transduction efficiency, and secondly, because
these vectors can be used to generate transgenic
pigs by injecting them into the perivitelline space
of porcine embryos [7], or transfected primary cells
can be employed in somatic nuclear transfer [19].
Expression of shRNA depends on the number
of integrated vectors per cell and on the promotor
activity. Although the expression cassette of
pLVTHM-pol2 is doubled after lentiviral integration
[32], no significant difference in the knockdown
efficiency could be detected compared to
RRL-pGK-GFP-pol2 (Fig. 3A, B). Due to the
strong polymerase III H1-RNA gene promoter,
which allows ubiquitous expression of shRNAs, a
single shRNA expression cassette per lentiviral vector
might be sufficient to express enough shRNAs
to reduce the PERV mRNA to a minimum. Moreover,
after integration of the lentiviral vector into
the host genome, the knockdown of PERV expres-
sion was stable in primary porcine cells for more
than 170 days (Fig. 3A).
Little is known about the expression of PERV in
different tissues and organs of normal and transgenic
pigs [1]. The data presented here suggest
that the expression of PERV may be inhibited in
different cell types including blood cells, which is
important for the use of cells and organs for
xenotransplantation. Systematic screening of PERV
expression in the first shRNA-transgenic animals
using real-time RT-PCR and of expression of the
shRNA using Northern blot analysis will show
whether PERV is suppressed in all tissues in vivo.
Taken together, the strategy described here could
lead to the generation of transgenic pigs with
greatly reduced PERV expression, providing safe
xenotransplantants, and is therefore of considerable
medical importance.
Acknowledgment
Supported by Deutsche Forschungsgemeinschaft, DFG,
DE729=4. We thank Deborah Mihica for excellent technical
support.
References
1. Akiyoshi DE, Denaro M, Zhu H, Greenstein JL,
Banerjee P, Fishman JA (1998) Identification of a
full-length cDNA for an endogenous retrovirus of miniature
swine. J Virol 72: 4503–4507
2. Denner J, Specke V, Schwendemann J, Tacke SJ (2001)
Porcine endogenous retroviruses (PERVs): adaptation
to human cells and attempts to infect small animals
and non-human primates. Ann Transplant 6: 25–33
3. Ericsson T, Oldmixon B, Blomberg J, Rosa M,
Patience C, Andersson G (2001) Identification of novel
porcine endogenous betaretrovirus sequences in miniature
swine. J Virol 75: 2765–2770
4. Fiebig U, Stephan O, Kurth R, Denner J (2003) Neutralizing
antibodies against conserved domains of p15E
of porcine endogenous retroviruses: basis for a vaccine
for xenotransplantation? Virology 307: 406–413
5. Follenzi A, Ailles LE, Bakovic S, Geuna M, Naldini L
(2000) Gene transfer by lentiviral vectors is limited
by nuclear translocation and rescued by HIV-1 pol
sequences. Nat Genet 25: 217–222
6. Garkavenko O, Croxson MC, Irgang M, Karlas A,
Denner J, Elliott RB (2004) Monitoring for presence
of potentially xenotic viruses in recipients of pig islet
xenotransplantation. J Clin Microbiol 42: 5353–5356

7. Hofmann A, Kessler B, Ewerling S, Weppert M, Vogg
B, Ludwig H, Stojkovic M, Boelhauve M, Brem G, Wolf
E, Pfeifer A (2003) Efficient transgenesis in farm animals
by lentiviral vectors. EMBO Rep 4: 1054–1060
8. Irgang M, Sauer IM, Karlas A, Zeilinger K, Gerlach JC,
Kurth R, Neuhaus P, Denner J (2003) Porcine endogenous
retroviruses: no infection in patients treated with
a bioreactor based on porcine liver cells. J Clin Virol
28: 141–154
9. Karlas A, Kurth R, Denner J (2004) Inhibition of porcine
endogenous retroviruses by RNA interference: increasing
the safety of xenotransplantation. Virology 325: 18–23
10. Karlas A (2006) Porcine endogene Retroviren und
Xenotransplantation: Evaluierung des Infektionsrisikos
und Strategien zur Hemmung der Virusreplikation mittels
RNA-Interferenz. Logos, Berlin
11. Kues WA, Petersen B, Mysegades W, Carnwath JW,
Niemann H (2005) Isolation of murine and porcine fetal
stem cells from somatic tissue. Biol Reprod 72(4): 1020
12. Le Tissier P, Stoye JP, Takeuchi Y, Patience C, Weiss RA
(1997) Two sets of human-tropic pig retrovirus. Nature
389: 681–682
13. Livak KJ, Schmittgen TD (2001) Analysis of relative
gene expression data using real-time quantitative
PCR and the 2(-Delta Delta C(T)) Method. Methods
25: 402–408
14. Loss M, Arends H, Winkler M, Przemeck M, Steinhoff
G, Rensing S, Kaup FJ, Hedrich HJ, Winkler ME,
Martin U (2001) Analysis of potential porcine endogenous
retrovirus (PERV) transmission in a whole-organ
xenotransplantation model without interfering microchimerism.
Transpl Int 14: 31–37
15. Martin U, Kiessig V, Blusch JH, Haverich A, von der
Helm K, Herden T, Steinhoff G (1998) Expression of pig
endogenous retrovirus by primary porcine endothelial
cells and infection of human cells. Lancet 352: 692–694
16. Martin U, Winkler ME, Id M, Radeke H, Arseniev L,
Takeuchi Y, Simon AR, Patience C, Haverich A,
Steinhoff G (2000) Productive infection of primary
human endothelial cells by pig endogenous retrovirus
(PERV). Xenotransplantation 7: 138–142
17. McIntyre MC, Kannan B, Solano-Aguilar GI, Wilson
CA, Bloom ET (2003) Detection of porcine endogenous
retrovirus in cultures of freshly isolated porcine bone
marrow cells. Xenotransplantation 10: 337–342
18. Miyagawa S, Nakatsu S, Nakagawa T, Kondo A,
Matsunami K, Hazama K, Yamada J, Tomonaga K,
Miyazawa T, Shirakura R (2005) Prevention of PERV
infections in pig to human xenotransplantation by the
RNA interference silences gene. J Biochem (Tokyo)
137: 503–508
19. Niemann H, Kues WA (2003) Application of transgenesis
in livestock for agriculture and biomedizine. Anim
Reprod Sci 79: 391–317
B. Dieckhoff et al.: Inhibition of PERV expression by RNA interference
20. Oldmixon BA, Wood JC, Ericsson TA, Wilson CA,
White-Scharf ME, Andersson G, Greenstein JL,
Schuurman HJ, Patience C (2002) Porcine endogenous
retrovirus transmission characteristics of an inbred herd
of miniature swine. J Virol 76: 3045–3048
21. Paradis K, Langford G, Long Z, Heneine W, Sandstrom
P, Switzer WM, Chapman LE, Lockey C, Onions D,
Otto E (1999) Search for cross-species transmission of
porcine endogenous retrovirus in patients treated with
living pig tissue. The XEN 111 Study Group. Science
285: 1236–1241
22. Patience C, Takeuchi Y, Weiss RA (1997) Infection of
human cells by an endogenous retrovirus of pigs. Nat
Med 3: 282–286
23. Patience C, Switzer WM, Takeuchi Y, Griffiths DJ,
Goward ME, Heneine W, Stoye JP, Weiss RA (2001)
Multiple groups of novel retroviral genomes in pigs and
related species. J Virol 75: 2771–2775
24. Pfeifer A, Ikawa M, Dayn Y, Verma IM (2002)
Transgenesis by lentiviral vectors: lack of gene silencing
in mammalian embryonic stem cells and preimplantation
embryos. Proc Natl Acad Sci USA 99:
2140–2145
25. Specke V, Rubant S, Denner J (2001) Productive infection
of human primary cells and cell lines with porcine
endogenous retroviruses. Virology 285: 177–180
26. Tacke SJ, Kurth R, Denner J (2000) Porcine endogenous
retroviruses inhibit human immune cell function: risk
for xenotransplantation? Virology 268: 87–93
27. Tacke SJ, Bodusch K, Berg A, Denner J (2001) Sensitive
and specific immunological detection methods for porcine
endogenous retroviruses applicable to experimental
and clinical xenotransplantation. Xenotransplantation 8:
125–135
28. Tacke SJ, Specke V, Denner J (2003) Differences in
release and determination of subtype of porcine endogenous
retroviruses (PERV) produced by stimulated
normal pig blood cells. Intervirology 46: 17–24
29. Takeuchi Y, Patience C, Magre S, Weiss RA, Banerjee
PT, Le Tissier P, Stoye JP (1998) Host range and
interference studies of three classes of pig endogenous
retrovirus. J Virol 72: 9986–9991
30. Wilson CA, Wong S, VanBrocklin M, Federspiel MJ
(2000) Extended analysis of the in vitro tropism of
porcine endogenous retrovirus. J Virol 74: 49–56
31. Winkler ME, Winkler M, Burian R, Hecker J, Loss M,
Przemeck M, Lorenz R, Patience C, Karlas A, Sommer
S, Denner J, Martin U (2005) Analysis of pig-to-human
porcine endogenous retrovirus transmission in a triplespecies
kidney xenotransplantation model. Transpl Int
17: 848–858. Epub 2005 Apr 29
32. Wiznerowicz M, Trono D (2003) Conditional suppression
of cellular genes: lentivirus vector-mediated druginducible
RNA interference. J Virol 77: 8957–8961

Parent-of-origin dependent gene-specific knock down in mouse embryos
Abstract
Khursheed Iqbal, Wilfried A. Kues, Heiner Niemann *
Department of Biotechnology, Institute for Animal Breeding, Mariensee, 31535 Neustadt, Germany
Received 10 April 2007
Available online 7 May 2007
In mice hemizygous for the Oct4-GFP transgene, the F1 embryos show parent-of-origin dependent expression of the marker gene. F1
embryos with a maternally derived OG2 allele (OG2 mat / ) express GFP in the oocyte and during preimplantation development until the
blastocyst stage indicating a maternal and embryonic expression pattern. F1-embryos with a paternally inherited OG2 allele (OG2 pat / )
express GFP from the 4- to 8-cell stage onwards showing only embryonic expression. This allows to study allele specific knock down of
GFP expression. RNA interference (RNAi) was highly efficient in embryos with the paternally inherited GFP allele, whereas embryos
with the maternally inherited GFP allele showed a delayed and less stringent suppression, indicating that the initial levels of the target
transcript and the half life of the protein affect RNAi efficacy. RT-PCR analysis revealed only minimum of GFP mRNA. These results
have implications for studies of gene silencing in mammalian embryos.
Ó 2007 Elsevier Inc. All rights reserved.
Keywords: Oct4-GFP transgene; RNA interference; Maternal inheritance; Paternal inheritance; Short interfering RNA; Preimplantation development;
Gene expression
Development of early mammalian embryos is characterized
by a switch from a maternal to an embryonic expression
program [1]. Maternally derived transcripts and
proteins are deposited in the oocyte and consumed after
fertilisation at least until the embryonic genome is activated.
The RNA binding protein Msy2 has been proposed
to stabilize maternal mRNAs in the oocyte [2].
The timing of the major onset of embryonic genome
transcription is species specific. In mouse embryos it occurs
at the 2-cell stage, in human embryos at the 4-cell stage,
and in bovine embryos at 8–16-cell stage. A ‘‘minor’’ genome
activation has been observed prior to the major genomic
activation. Some genes show a biphasic expression
pattern, in that maternally derived mRNAs and proteins
are present in the oocyte and that the gene are also actively
transcribed after embryonic activation.
It has been shown that RNA interference (RNAi)-mediated
gene knock down works in mammalian embryos for
several genes including E-cadherin, Mos, Plat, Oct4,
* Corresponding author. Fax: +49 5034 871 101.
E-mail address: niemann@tzv.fal.de (H. Niemann).
Biochemical and Biophysical Research Communications 358 (2007) 727–732
0006-291X/$ - see front matter Ó 2007 Elsevier Inc. All rights reserved.
doi:10.1016/j.bbrc.2007.04.155
www.elsevier.com/locate/ybbrc
Cox5a, Cox5b or Cox6b1 [3–9]. However, it is unknown
whether RNAi is equally effective for maternal and embryonic
transcripts. Maternal transcripts have a long half-life
in the range of days, whereas embryonic transcripts last
at most for minutes. In the present study, a breeding schedule
was applied to produce hemizygous embryos carrying
a marker transgene that permits a comparison of gene
silencing of the same allele expressed either maternally or
after embryonic genome activation. The zygotes analysed
in this study were hemizygous for a GFP transgene driven
by the promoter of the POU transcription factor Oct4
[10,11]. It has been previously shown that the Oct4 promoter
activates transcription in early blastomeres from
the 4- to 8-cell stage onward, in the inner cell mass
(ICM) of preimplantation embryos, in the epiblast and
eventually in the gametes [12]. The Oct4-GFP transgene
has been shown to be active in oocytes and both mRNA
and GFP protein are maternally stored in MII oocytes
and zygotes. Terminally differentiated spermatozoa, however,
do not express Oct4. Mating of homozygous OG2
males or females with non-transgenic mice, produced hemizygous
OG2 F1 embryos with either embryonic GFP

728 K. Iqbal et al. / Biochemical and Biophysical Research Communications 358 (2007) 727–732
expression after the 4-cell stage (OG2 pat / ), or zygotes
with maternal deposits of GFP mRNA and protein
(OG2 mat / ), i.e. maternal expression. Thus knock down
of one of two alleles of the target gene located at the same
integration site, sharing identical regulatory and structural
elements, and identical secondary structure of the transcripts
could be studied in two different modes of
expression.
Materials and methods
Production of zygotes hemizygous for the OG2 transgene. OG2 transgenic
mice (tg; Oct4 promoter-GFP) [10,11] were maintained as an inbred
homozygous line by sib matings. For the production of hemizygous OG2
zygotes, OG2 animals were mated with non-transgenic NMRI animals.
OG2 and NMRI females were superovulated by intraperitoneal injections
of 10 IU PMSG (pregnant mare serum gonadotropin, Intervet,
Unterschleißheim, Germany), followed by injections of 10 IU hCG
(human chorion gonadotropin, Intervet) 48 h later and mating with OG2
or NMRI males, respectively. Zygotes were collected by flushing the
oviducts of plugged females 22–24 h after hCG injection with phosphate
buffered saline (PBS) containing 0.3% (w/v) bovine serum albumin (BSA).
Cumulus cells were completely removed by a short treatment with 0.03%
hyaluronidase and zygotes were collected in PBS/0.3% BSA on a warming
plate. Animals were maintained and handled according to German
guidelines.
Injection of siRNA and in vitro culture. The lyophylised siRNAs were
dissolved at a concentration of 20 lM in a buffer consisting of 30 mM
HEPES/KOH (pH 7.4), 100 mM K-acetate, and 2 mM Mg-acetate and
stored frozen at 20 °Cin10ll aliquots. Denuded zygotes were washed in
PBS/0.3% BSA and transferred to a micromanipulation unit in a droplet
of PBS/0.3% BSA. Individual zygotes were fixed by suction to a holding
capillary, approximately 10 pl of siRNA solution was injected into the
cytoplasm using an Eppendorf transjector 5246 (Eppendorf, Hamburg,
Germany). Rhodamine conjugated siRNAs (Qiagen, Hilden, Germany)
with 3 0 -TT overhangs against GFP (upper strand: 5 0 -GCAAGCUGA
CCCUGAAGUUCAU) or with a random sequence (upper strand: 5 0 -UU
CUCCGAACGUGUCACGU) with no known homology to mammalian
genes were used for injection. Successful injections were verified by fluorescence
microscopy.
Fertilized embryos of both inheritance patterns were microinjected
with either the GFP-siRNA or the control random-siRNA, untreated
embryos were used as culture controls. Groups of 10 embryos were
cultured for 4.5 days in 50 ll microdrops of KSOM medium overlaid
with silicone oil at 37 °C in an atmosphere of 5% CO2 in air. For
fluorescence microscopy, a Zeiss Axiovert 35 M microscope equipped
with fluorescence optics for Hoechst 33342, GFP and rhodamine was
used [13]. Images were recorded on Ektachrome 320 T film (Kodak)
with a Contax167MT camera. The GFP fluorescence signals were
normalized by using a fixed exposure time of 15 s. 4-cell stage embryos
and blastocysts were collected for RT-PCR and stored frozen at
80 °C. At the end of the in vitro culture period developmental stage,
nuclei number and GFP mRNA levels were determined. For determination
of the number of nuclei per blastocyst, embryos were stained
with 1 lg/ml Hoechst 33342 for 5 min.
Determination of GFP transcript levels by RT-PCR. Poly(A) + RNA
was isolated from single embryos using a Dynabeads mRNA DIRECT
Kit (Dynal, Norway, Product number 610.11) as described [14]. The
mRNAs were reverse transcribed in a reaction mixture consisting of 1·
RT buffer (50 mM KCl, 10 mM Tris–HCl, pH 8.3, Perkin-Elmer), 50 mM
MgCl2, 1 mM dNTPs (Amersham, Brunswick, Germany), 20 IU RNase
inhibitor (Perkin-Elmer) and 50 U/ll reverse transcriptase (RT, Perkin-
Elmer) in a total volume of 20 ll using 2.5 ll of50lM random hexamer
primers (Perkin-Elmer Vaterstetten, Germany). The RT reaction was
carried out at 25 °C for 10 min and then 42 °C for 1 h followed by
denaturation at 99 °C for 5 min. The polymerase chain reaction (PCR)
was performed with the reverse transcribed product using 0.2 embryo
equivalents. The final volume of the PCR mixture was 50 ll (1· PCR
buffer, 20 mM Tris buffer–HCl (pH 8.4), 1.5 mM MgCl2, 200 lM dNTPs,
0.25 lM of each primer). The GFP primers were 5 0 -AGC ACG ACT TCT
TCA AGT CC and 5 0 -TGA AGT TCA CCT TGA TGC CG (annealing
temperature: 58 °C, 35 cycles). For poly(A) polymerase (also known as
Papola; Mouse Nomenclature Page, www.informatics.jax.org/mgihome)
amplification, the primers were 5 0 -CCT CAC TGC ACA ATA TGC CGT
CTT CAC CTG and 5 0 -AGC CAA TCC ACT GTT CTC CCA CCT TTA
CTC (annealing temperature 54 °C, 35 cycles). The PCR cycle numbers
were optimized to ensure that the reactions are in the linear range of
amplification. PCR amplicons were separated by electrophoresis on a 2%
agarose gel, and were recorded using a CCD camera (Quantix, Photometrics,
Munich Germany). Sequence identities of amplicons were identified
by sequencing.
Results
Hemizygous embryos with a maternally inherited Oct4-
GFP allele (OG2 mat / ) expressed GFP in oocytes and
zygotes; while embryos with a paternally inherited Oct4-
GFP allele initiated transcription of GFP after embryonic
activation and displayed GFP fluorescence at the 4–8-cell
stage (Fig. 1A). Pronuclear stage zygotes of both inheritance
patterns were used for siRNA injection, the siRNAs
were conjugated with rhodamine, thus successful injection
and metabolism of the siRNAs could be followed by fluorescence
microscopy (Fig. 1B and C). The majority of
embryos had reached the blastocyst stage at the end of
the culture period at day 4.5. Apparently the injection procedure
did not reduce the blastocyst rate compared to the
untreated control group (Table 1).
After injection of GFP-siRNA, green GFP fluorescence
was significantly suppressed in embryos with paternally
inherited Oct4-GFP during the entire observation period
(Fig. 2A) and 95% of blastocysts showed down-regulation
of GFP fluorescence (Table 1). On average, the GFP
mRNA levels were reduced by 97.4% in siRNA treated
(OG pat / )-blastocysts as determined by RT-PCR analysis
(Fig. 3A and B).
In contrast, embryos with a maternally inherited GFP
allele (OG2 mat / ) showed a delayed reduction of GFP
fluorescence after siRNA injection. All stages from zygote
to morula continued to display GFP fluorescence; a significant
knock down of GFP fluorescence became was only
apparent at the blastocyst stage (Fig. 2B).
The remaining GFP transcript levels in blastocyst stages
were low and not different between embryos with a maternally
(OG mat / ) or a paternal allele (OG pat / ) inherited
allele (Fig. 3C) indicating that maternal and embryonic
transcripts were equally susceptible to RNAi. To determine
whether maternally derived GFP transcripts were degraded
slower after RNAi injection, OG mat / zygotes were
injected with GFP-siRNA and early 4-cell stages were
analysed by RT-PCR. At this time point, embryonic transcription
of the Oct4-GFP transgene had yet not started.
RT-PCR indicated only minimum levels of GFP transcripts
(data not shown), suggesting that predominantly

Fig. 1. (A) Expression of GFP in F1-embryos with hemizygous OG2 allele from paternal (OG2 pat / ) or maternal (OG2 mat / ) inheritance in zygotes, 2cell
embryos, morulae and blastocysts. (B) Schematic drawing of rhodamine conjugated siRNA. (C) Injection of siRNA-rhodamine in (OG2 mat / )
zygotes. Top, brightfield image; middle, GFP fluorescence; bottom, rhodamine fluorescence in injected zygote and injection capillary.
Table 1
Knock down of GFP in (OG pat / ) and (OG mat / ) mouse embryos
the protein turnover time of GFP contributed to the
delayed down-regulation.
Injection of a random siRNA with no known murine
complementary sequence did not affect GFP fluorescence.
Rhodamine fluorescence was detected in the cytoplasm of
all embryonic stages up to the blastocyst, indicating slow
degradation of the synthetic siRNAs (data not shown).
Discussion
K. Iqbal et al. / Biochemical and Biophysical Research Communications 358 (2007) 727–732 729
No. of
zygotes
No. of morulae with knockdown
of GFP/total (%)
Here, we show that a single injection of a synthetic siR-
NA into the cytoplasm of mouse zygotes is sufficient to
induce allele specific silencing during embryonic development.
Employing hemizygous F1 embryos with parent-oforigin
dependent expression pattern of the OG2 transgene,
allowed discriminating between embryonic and maternal
No. of blastocysts with
knockdown of GFP/total (%)
(OG pat / )
GFP-siRNA injected 210 60/172 (93%) 133/140 (95%)
Random-siRNA
injected
31 0/25 (0%) 0/19 (0%)
Untreated control 60 0/53 (0%) 0/47 (0%)
(OG mat / )
GFP-siRNA injected 94 0/79 (0%) 66/66 (100%)
Untreated control 47 0/39 (0%) 0/35 (0%)
origin of gene expression. Silencing was highly efficient in
embryos carrying a paternally inherited GFP allele
(OG2 pat / ). In this setting the siRNA was injected 2–3 cell
cycles prior to activation of the GFP allele. Nascent GFP
transcripts apparently were targeted and subsequently
degraded. The long-term knock down of GFP in OG2 pat /
blastocysts up to day 4.5 led us to speculate that the duration
of silencing might last to implantation. This suggests that it
would be possible to silence genes during the peri- and
postimplantation period and to dissect critical pathways in
this important period of gestation. Current methodology
to target these stages [15–17] is complicated and time
consuming. It is not yet known at which developmental stage
the unspecific interferon mediated response becomes
prevalent, thus the application of siRNAs might be superior
to the commonly used long double stranded (ds)RNA.

730 K. Iqbal et al. / Biochemical and Biophysical Research Communications 358 (2007) 727–732
Fig. 2. Knock down of GFP expression in hemizygous embryos with either a paternally or a maternally inherited GFP allele. 2-cell stage, morula and
blastocyst stages are shown under brightfield and GFP fluorescence conditions.
Fig. 3. RT-PCR detection of GFP mRNA in siRNA injected embryos. (A) OG pat / embryos: lane 1, untreated embryo; lane 2, untreated, no reverse
transcriptase (RT); lane 3, GFP-siRNA injected; lane 4, no RT; M, 100 bp DNA ladder; lane 5, no template. Poly(A) polymerase was amplified as control
transcript. (B) OG mat / embryos: lane 1, GFP-siRNA injected; lane 2, GFP-siRNA injected, no RT; lane 3, untreated embryo; lane 4, untreated embryo,
no RT; M, 100 bp ladder; lane 5, no template. (C) Knock down efficiency of GFP transcripts in hemizygous OG pat / and OG mat / blastocysts (3
replicates; SD).
RNAi was discovered in nematodes and plants [18,19],
where long dsRNAs of 500–1000 bp specifically suppress
expression of complementary transcripts. In most mammalian
cell types, dsRNA causes a non-specific effect mediated
by an interferon mediated response [20,21]. This non-specific
interferon response is not observed in early embryonic stages
of mammals. It has been shown that specific RNA interference
can be achieved in mammalian embryos by the injection
of long dsRNA [3–6,8]. Processing of the injected dsRNAs
by cellular RNaseIII-like endoribonuclease (Dicer) leads to
the release of several different short interfering (si)RNAs
[22] in the embryo, of which some might be functional as specific
RNAi. Commonly, only 1 out of 4 tested siRNAs gives
specific gene knock down [23,24]. However, off target effects
and siRNA overload [25] cannot be excluded if dsRNA is
used for injection into mammalian embryos.

An important finding of this study is that the onset and
efficiency of gene knock down in embryos critically depend
on whether the target gene is expressed from the maternal
or embryonic genome. In OG2 mat / embryos, which
already carry maternal GFP mRNAs and protein at the
time of injection, knock down was delayed and significant
GFP fluorescence remained up to the 16-cell stage. Efficient
reduction of GFP expression was observed in blastocysts,
albeit with higher residual GFP fluorescence than in siR-
NA treated OG2 pat / embryos. In mouse LA-9 cells the
half-life of GFP was determined to be 26 h [26], thus confirming
that genes with maternal expression can be
silenced, but turnover rates of maternal RNA and protein
may delay the inhibitory effects of RNAi.
Previously, it has been shown that both maternal and
embryonic target genes could be silenced, e.g E-cadherin,
Mos, Plat, Oct4, Cox5a, Cox5b or Cox6b1 [3–7]. However,
due to the unique orchestration of gene expression in mammalian
embryos with a switch from maternal to embryonic
expression, RNAi experiments for transcripts with a biphasic
expression pattern might be obscured. Phenotypic
changes of RNAi in embryos could be masked in cases
when proteins with long half lives or slow turnover rates
are still active, although transcripts have already been
knocked down.
The data presented here provide important clues for gene
silencing in mammalian preimplantation embryos. The
siRNA approach could also be suitable for species other than
mouse in which genomic sequencing is not yet complete [27].
Synthesis of siRNAs requires knowledge of short sequence
regions and the effects of synthetic siRNA are transient,
attributed to degradation of the original molecules, unless
transgenic delivery of siRNA is employed [23]. However, it
seems to be worthwhile to further investigate the stability
of synthetic siRNAs in embryos and to determine their
efficacy in pre- and peri-implantation stages. A potential
application of synthetic siRNA injection in embryos is the
knockdown of gene functions with long term consequences
for the developing organism. For example, it has been shown
that a specific telomere elongation program acts at
morula–blastocyst transition [28], a transient knock down
of telomerase in this critical time window should help to
elucidate the biological relevance of this mechanism.
Acknowledgments
The expert technical assistance of E. Lemme is gratefully
acknowledged. Khursheed Iqbal is in the Ph.D. program of
Hannover Biomedical Research School (HBRS). Khursheed
Iqbal was supported by a grant from Goyaike
S.A.A.C.I. Y F., Buenos Aires, Argentina.
References
K. Iqbal et al. / Biochemical and Biophysical Research Communications 358 (2007) 727–732 731
[1] R.M. Schultz, The molecular foundations of the maternal to zygotic
transition in the preimplantation embryo, Hum. Reprod. Update 8
(2002) 323–331.
[2] J. Yu, N.B. Hecht, R.M. Schutz, Expression of MSY2 in mouse
oocytes and preimplantation embryos, Biol. Reprod. 65 (2001) 1260–
1270.
[3] P. Svoboda, P. Stein, H. Hayashi, R.M. Schultz, Selective reduction
of dormant maternal mRNAs in mouse oocytes by RNA interference,
Development 127 (2000) 4147–4156.
[4] F. Wianny, M. Zernicka-Goetz, Specific interference with gene
function by double-stranded RNA in early mouse development,
Nat. Cell Biol. 2 (2000) 70–75.
[5] B. Plusa, S. Frankenberg, A. Chalmers, A.K. Hadjantonakis, C.A.
Moore, N. Papalopulu, V.E. Papaioannou, D.M. Glover, M.
Zernicka-Goetz, Downregulation of Par3 and aPKC function directs
cells towards the ICM in the preimplantation mouse embryo, J. Cell
Sci. 118 (2004) 505–515.
[6] F. Paradis, C. Vigneault, C. Robert, M.A. Sirard, RNA interference
as a tool to study gene function in bovine oocytes, Mol. Reprod. Dev.
70 (2005) 111–121.
[7] K. Nganvongpanit, H. Müller, B. Rings, M. Gilles, D. Jennen, M.
Hoelker, E. Tholen, K. Schellander, D. Tesfaye, Targeted suppression
of E-cadherin gene expression in bovine preimplantation embryo by
RNA interference technology using double stranded RNA, Mol.
Reprod. Dev. 73 (2005) 153–163.
[8] M.R. Shin, X.S. Cui, J.H. Jun, Y.J. Jeong, N.H. Kim, Identification
of mouse blastocyst genes that are downregulated by double-stranded
RNA-mediated knockdown of Oct4 expression, Mol. Reprod. Dev.
70 (2005) 390–396.
[9] X.S. Cui, X.Y. Li, Y.J. Jeong, J.H. Jun, N.H. Kim, Gene expression
of cox5a, 5b, or 6b1 and their roles in preimplantation mouse
embryos, Biol. Reprod. 72 (2006) 601–610.
[10] R. Anderson, T.K. Copeland, H. Scholer, J. Heasman, C. Wylie, The
onset of germ cell migration in the mouse embryo, Mech. Dev. 91
(2000) 61–68.
[11] P.E. Szabo, K. Huebner, H. Scholer, J.R. Mann, Allele-specific
expression of imprinted genes in mouse migratory primordial germ
cells, Mech. Dev. 115 (2002) 157–160.
[12] Y.I. Yeom, G. Fuhrmann, C.E. Ovitt, A. Brehm, K. Ohbo, M. Gross,
K. Huebner, H.R. Scholer, Germline regulatory element of Oct4
specific for the totipotent cycle of embryonal cells, Development 122
(1996) 881–894.
[13] W.A. Kues, B. Petersen, W. Mysegades, J.W. Carnwath, H.
Niemann, Isolation of murine and porcine fetal stem cells from
somatic tissue, Biol. Reprod. 72 (2005) 1020–1028.
[14] P.S. Yadav, W.A. Kues, D. Herrmann, J.W. Carnwath, H. Niemann,
Bovine ICM derived cells express the Oct4 ortholog, Mol. Reprod.
Dev. 72 (2005) 182–190.
[15] G. Mellitzer, M. Hallonet, L. Chen, S.L. Ang, Spatial and temporal
‘knock downs’ of gene expression by electroporation of dsRNA and
morpholinos into early periimplantation embryos, Mech. Dev. 118
(2002) 57–63.
[16] F. Caligari, A.M. Marzesco, R. Kittler, F. Buchholz, W.B. Huttner,
Tissue specific RNA interference in post-implantation mouse embryos
using directional electroporation and whole embryo culture, Differentiation
72 (2004) 92–102.
[17] M.L. Soares, S. Haraguchi, M.E. Torres-Padilla, T. Kalmar, L.
Carpenter, G. Bell, A. Morrison, C.J.A. Ring, N.J. Clarke, D.M.
Glover, M. Zernicka-Goetz, Functional studies of signalling pathways
in peri-implantation development of the mouse embryo by
RNAi, BMC Dev. Biol. 5 (2005) 1–11.
[18] A. Fire, S. Xu, M.K. Montgomery, S.A. Kostas, S.E. Driver,
C. Mello, Potent and specific genetic interference by doublestranded
RNA in Caenorhabditis elegans, Nature 391 (1998)
809–811.
[19] R.A. Jorgensen, R.G. Atkinson, R.L. Forster, W.J. Lucas, An RNAbased
information superhighway in plants, Science 279 (1998) 1486–
1487.
[20] P.A. Sharp, RNA interference-2001, Genes Dev. 15 (2001) 485–490.
[21] R.H.A. Plasterk, RNA silencing: the genomes immune system,
Science 296 (2002) 1263–1265.

732 K. Iqbal et al. / Biochemical and Biophysical Research Communications 358 (2007) 727–732
[22] S.M. Elbashir, J. Harborth, W. Lendeckel, A. Yalcin, K. Weber,
T. Tuschl, Duplexes of 21-nucleotide RNAs mediate RNA
interference in cultured mammalian cells, Nature 411 (2001)
494–498.
[23] D.A. Rubinson, C.P. Dillon, A.V. Kwiatkowski, C. Sievers, L. Yang,
J. Kopinja, D.L. Rooney, M.M. Ihrig, M.T. McManus, F.B. Gertler,
A lentivirus based system to functionally silence genes in primary
mammalian cells, stem cells and transgenic mice by RNA interference,
Nat. Genet. 33 (2003) 401–406.
[24] D. Gong, J.E. Ferrell Jr., Picking a winner: new mechanistic
insights into the design of effective siRNAs, Trends Biotechnol. 22
(2004) 451–454.
[25] D. Grimm, K.L. Streetz, C.L. Jopling, T.A. Storm, K. Pandey, C.R.
Davis, P. Marion, F. Salazar, M.A. Kay, Fatality in mice due to
oversaturation of cellular microRNA/short hairpin RNA, Nature 441
(2006) 537–541.
[26] P. Corish, C. Tyler-Smith, Attenuation of green fluorescent protein
half-life in mammalian cells, Protein Eng. 12 (1999) 1035–1040.
[27] W.A. Kues, H. Niemann, The contribution of farm animals to human
health, Trends Biotechnol. 22 (2004) 286–294.
[28] S. Schaetzlein, A. Lucas-Hahn, E. Lemme, W.A. Kues, M. Dorsch,
M.P. Manns, H. Niemann, K.L. Rudolph, Telomere length is reset
during early mammalian embryogenesis, Proc. Natl. Acad. Sci. USA
101 (2004) 8034–8038.

CLONING AND STEM CELLS
Volume 9, Number 3, 2007
© Mary Ann Liebert, Inc.
DOI: 10.1089/clo.2006.0009
Production of Viable Pigs from Fetal Somatic Stem Cells
NADINE HORNEN, WILFRIED A. KUES, JOSEPH W. CARNWATH,
ANDREA LUCAS-HAHN, BJÖRN PETERSEN, PETRA HASSEL, and HEINER NIEMANN
ABSTRACT
Fetal somatic stem cells (FSSCs) are a novel type of somatic stem cells that have recently been
discovered in primary fibroblast cultures from pigs and other species. The goal of the present
study was to produce viable piglets from FSSCs. NT complexes were prepared from both
FSSCs and porcine fetal fibroblasts (pFF) to permit comparison of these two donor cell types.
FSSCs from isolated attached colonies were compared with pFF in their ability to form blastocysts
upon use in NT. Fusion and cleavage rates were similar between the two groups, while
blastocyst rates were significantly higher when using pFF as donor cells. FSSCs of three different
size categories derived from dissociation of spheroids yielded similar results. The use
of FSSCs of 15–20 m in size yielded similar cleavage and blastocyst rates as fetal fibroblasts.
In the final experiment NT complexes produced from FSSCs were transferred to foster mothers.
After transfer to prepubertal gilts, three of seven recipients established pregnancies and
delivered seven piglets, of which three piglets were viable and showed normal development.
Results for the first time demonstrate that FSSCs are able to produce cloned embryos, and
that pregnancies can be established and viable piglets can be produced.
INTRODUCTION
SOMATIC CELL NUCLEAR TRANSFER (NT) is a useful
technology for basic research and the production
of transgenic animals. NT permits targeted
modification of the genome of the donor
cells by homologous recombination and production
of genetically identical groups of transgenic
animals (Denning et al., 2001). Since the first somatic
clone “Dolly” (Wilmut et al., 1997), 11 other
mammalian species have been cloned successfully
by the same technique (Baguisi et al., 1999;
Betthauser et al., 2000; Campbell et al., 1996;
Cibelli et al., 1998; Chesne et al., 2002; Galli et al.,
2003; Lee et al., 2005a; Li et al., 2006; Onishi et al.,
2000; Polejaeva et al., 2000; Shin et al., 2002;
Wakayama et al., 1998; Woods et al., 2003; Zhou
et al., 2003). However, despite intensive efforts
Department of Biotechnology, Institut für Tierzucht, Mariensee Neustadt, Germany.
364
cloning, efficiency in most species is still low. In
pigs, on average 1%–3% of reconstructed embryos
survive to birth (Harrison et al., 2004; Kues
and Niemann, 2004). The differentiation status of
the donor cells has been assumed to contribute to
the success of cloning since correct epigenetic reprogramming
and the resulting changes in transcriptional
control are the main processes involved
in creating an embryo from a somatic
nucleus (Jaenisch et al., 2002). Nuclear reprogramming
is a physiological process which takes
place after fertilization and in early cleavage
stages to regulate gene expression during embryogenesis.
The reprogramming includes remodeling
of the chromatin structure, changes in
DNA-methylation, regulation of the expression of
imprinted genes, regeneration of telomere length,
and inactivation of the X-chromosome (Han et al.,

FSSCS IN SOMATIC CELL NUCLEAR TRANSFER 365
2003; Westphal, 2005). In somatic cell nuclear
transfer the chromatin structure of the differentiated
nucleus must be removed and remodeled to
initiate the embryogenic process after fusion of
the donor cell nucleus with the enucleated oocyte
(Gurdon et al., 2003; Westphal, 2005). Presumably,
reprogramming to the embryonic state
should be completed before the onset of embryonic
gene expression (EGA) (Jaenisch et al., 2002).
In bovine development, EGA occurs between the
8- and 16-cell stage; in the pig, it occurs at the
four-cell stage (Lequarre et al., 2003; Maddox-
Hyttel et al., 2001). This additional time for remodeling
could explain the higher cloning efficiency
in bovine nuclear transfer because the
transferred nucleus would have more time to be
reprogrammed.
Stem cells, as well as differentiated cells, have
been successfully used as donor cells, at least to
the extent that they gave development to the blastocyst
stage. Many of these embryos, however,
failed to develop further after transfer to foster
mothers (Kato et al., 2000; Wakayama and Yanagimachi,
2001). The terminally differentiated cells
used include lymphocytes and cardiomyocytes,
but all result in rather low efficiency (Hochedlinger
and Jaenisch, 2002; Inoue et al., 2005;
Schwarzer et al., 2006). In mice the use of embryonic
stem cells (ES cells) increased the efficiency
from 1%–3% to 15% (offspring/transferred
embryos) (Wakayama et al., 1999). True ES cells
have not yet been isolated from livestock (Gjorret
and Maddox-Hyttel, 2005).
Adult stem cells are undifferentiated cells in a
differentiated tissue. They are able to proliferate,
self-renew, and give rise to differentiated daughter
cells. In adult tissue, they are responsible for
regeneration and maintainance of homeostasis.
Many different types of adult tissue harbor stem
cells including bone marrow, brain, epidermis,
blood, liver, skin, eye, gut, pancreas, and skeletal
muscle (Schoeler, 2004). We have recently described
the derivation of fetal somatic stem cells
(FSSCs) from explant cultures of various species
(Kues et al., 2005). These cells do not show signs
of senescence in high density culture, lose fibroblast
markers, and express markers of pluri- or
totipotency-like OCT4, AP, and STAT3. FSSCs
could be more amenable to reprogramming, and
would thus be a new source of donor cells in somatic
cell nuclear transfer or cell therapy approaches
(Kues et al., 2005). However, the isolation
and integration into an existing nuclear
transfer protocol had not yet been investigated,
and was the subject of this research.
MATERIALS AND METHODS
Cell culture
A porcine fetus was obtained by hysterectomy
of a pregnant gilt at day 25. It was washed twice
in Dulbecco phosphate-buffered saline solution
(D-6650, Sigma, St. Louis, MO). Head, legs, and
viscera were removed and remaining tissue was
sliced into 1–2-mm sections. Tissue slices were
placed in drops of recalcified bovine plasma (e.g.,
9 parts bovine plasma, P-4639, Sigma (St. Louis,
MO) 1 part 0.5 M CaCl2) in a tissue culture flask
(#9025, TPP, Switzerland). Supplementation of
plasma with calcium is required for fixation of
tissue. After agglutination of the plasma drops,
DMEM (Dulbecco Modified Eagle Medium)
medium was added (supplemented with 2 mM
glutamine, 1% nonessential amino acids, 0.1 mM
mercaptoethanol, 100 U/mL penicillin, 100
g/mL streptomycin, all from Sigma) 10% fetal
calf serum (FCS, Gibco, Karlsruhe, Germany)],
and somatic explant cultures were incubated in a
humidified 95% air, 5% CO2 atmosphere at 37°C.
Outgrowing cells were trypsinized and subpassaged
twice prior to cryopreservation.
Five to 6 days prior to nuclear transfer, cells
FIG. 1. 3D colonies with surrounding monolayer of fibroblasts
(original magnification 100).

366
FIG. 2. Floating spheroids in suspension culture (original
magnification 100).
were thawed and reseeded on tissue culture test
plates (92406, Fa. TPP, Switzerland) with
DMEM 10% FCS. The cell cycle of the fetal fibroblasts
was synchronized in G0/G1 by serum
deprivation in DMEM with reduced FCS content
(0.5%) 48 h before nuclear transfer. Growth of
FSSCs was induced by DMEM culture medium
with increased serum content (30%). FSSCs were
maintained either as attached cells, in which case
3D colonies formed on the confluent culture (Fig.
1), or in a suspension culture which permits the
growth of free floating spheroids (Fig. 2). For nuclear
transfer, 3D colonies were isolated from surrounding
fibroblasts by aspirating with a 100 L
pipette (Fig. 3), floating spheroids were pelleted
and washed with PBS. Cells were dissociated
by incubation for 10–15 min in 0.025% EDTA/
trypsin, pelleted, washed once in TL-HEPES containing
10% FCS, once in serum-free TL-HEPES,
and resuspended in TL-HEPES.
Collection and culture of
cumulus–oocyte complexes
Ovaries from prepubertal gilts were collected
from local abattoirs. Oocytes with at least three
complete layers of cumulus cells were collected
and matured in vitro for 40 h (Hoelker et al., 2005).
Then, matured oocytes were transferred to TL-
HEPES supplemented with 0.1% hyaluronidase
and incubated for 5 min. Cumulus cells were re-
moved by repeated pipetting. Denuded oocytes
were transferred to TL-HEPES covered with mineral
oil (Silicone fluid DC200, #35135, Fa. Serva
Biochemica, Heidelberg).
Nuclear transfer
Denuded oocytes were enucleated by removing
the first polar body and the metaphase plate
under UV-light control after Hoechst 33342 staining
of the oocytes. A single donor cell was placed
into the perivitelline space (Hoelker et al., 2005).
Oocyte donor cell complexes were placed between
two platinum electrodes and fused with
one DC pulse of 1 kV/cm for 99 sec (Multiporator,
Eppendorf, Hamburg). Oocyte-donor cell
complexes and 50–60 nonmanipulated oocytes
(parthenogenetic controls) were activated in an
activation chamber (Bügel-Fusionskammer, Fa.
Krüss, Hamburg) with one DC pulse of 1 kV/cm
for 45 sec (Hoelker et al., 2005). Then the complexes
were activated chemically by exposure
to NCSU23 with 2 mM 6-dimethylaminopurin
for 3 h.
Culture of embryos to blastocysts
HORNEN ET AL.
After activation up to 60 reconstructed embryos
and parthenogenetic controls were each
placed in 500 L NCSU23 in one well of a fourwell
dish. Embryos were cultured for 7 days in
an incubation chamber (Nuclear Incubation
Chamber; Billups-Rothenberg Inc., Del Mar, CA)
at 38°C with 5% CO2, 5% O2, and 90% N2. After
7 days of in vitro culture, embryos were stained
with 1 g/mL Hoechst 33342 to determine the
number of nuclei using a fluorescence microscope.
To determine the number of inner cell mass
cells and trophectoderm cells, embryos were dif-
FIG. 3. Isolation of 3D colonies by aspiration.

FSSCS IN SOMATIC CELL NUCLEAR TRANSFER 367
ferentially stained. Blastocysts were incubated in
a permeabilizing solution containing the ionic detergent
Triton X-100 and the fluorochrome propidium
iodide to stain trophectoderm cells for 50
sec. Thereafter blastocysts were incubated in a
second solution containing 100% ethanol for fixation
and the fluorochrome Hoechst 33342 for
staining the inner cell mass cells for 4 min. Fixed
and stained blastocysts were analyzed with a fluorescence
microscope at 100 magnification
(Thouas et al., 2001).
Embryo transfers
Embryos cloned from FSSCs were surgically
transferred into the oviducts of gilts that were
synchronized to the reconstructed embryos
(Walker et al., 2002), immediately after activation.
Maintenance of pregnancies was supported by induction
of accessory corpora lutea injecting 1000
IU PMSG injected i.m. at day 12 after embryo
transfer (Pregnant Mare’s Serum Gonadotropin,
Intergonan ® i.m., Intervet, Tönisvorst) and 500 IU
hCG (human Chorionic Gonadotropin, Ovogest ® ,
Intervet, Tönisvorst) 72 h later. Recipients were
examined ultrasonographically at days 22 and 35
following embryo transfer. Piglets were delivered
on days 116–119 after embryo transfer. Animal
handling was in accordance with institutional
guidelines.
Microsatellite analysis
Parentage was analyzed in piglets derived
from somatic cell nuclear transfer to confirm genetic
identity of the piglets with the donor cells
used for somatic cell nuclear transfer. The microsatellite
analysis was performed as descibed
before (Hoelker et al., 2005). Eleven porcine DNA
microsatellite markers were used (S0002, S0068,
S0090, S0101, S0178, SW69, SW 632, SW 857, SW
911, SW 951, and SW1122).
Experimental design
The first three experiments were designed to
determine which FSSC preparation was most
suitable to nuclear transfer based on in vitro culture
to the blastocyst stage. The assay was to compare
the development of these FSSC derived embryos
to that of embryos reconstructed from
porcine fetal fibroblasts which our laboratory
uses routinely for nuclear transfer. In the first experiment,
FSSCs from isolated attached colonies
were compared with fetal fibroblasts as donor
cells. In the second experiment, FSSCs of different
size categories, that is, 14 m, 15–20 m,
23–28 m, isolated from spheroids were compared.
In the third experiment, blastocysts were
cloned from medium size FSSCs (15–20 m) derived
from spheroids and compared with that of
fetal fibroblasts. In the final experiment, cloned
zygotes produced from FSSC nuclear donor cells
were transferred to foster mothers. Spheroids
were not serum deprived prior to use in nuclear
transfer. The different cell size of spheroids does
not correspond with different cell cycle stages,
but is thought to be related to the differentiation
status of stem cells.
Statistical analysis
Fusion rate, the cleavage rate, the blastocyst
rate, the number of nuclei in the blastocysts, and
the percentage of ICM cells compared to the total
cell number of the blastocysts were analyzed
by “Sigma Stat” (Jandel Scientific Coorporation,
Germany). Results are based on 4–10 replicates
per experiment, and are expressed as means
(mean SD). A probability value of p 0.05 was
considered to be statistically significant.
RESULTS
Experiment 1
In the experiment to determine whether
FSSCs removed from selected three-dimensional
colonies by trypsinization were better nuclear
donors than primary fibroblasts, the blastocyst
rate of FSSC reconstituted embryos was significantly
lower than the blastocyst rate of the fibroblast
group (6.4% 3.5% vs. 24.9% 8.6%).
Parthenogenetic embryos used as control for development
without nuclear transfer gave a blastocyst
rate of 44.3% 9.1%. Cleaveage rates and
the mean cell number of the blastocysts in all
three groups were not different (Table 1). In this
experiment, a wide distribution of sizes was observed
within the trypsinized population of
FSSCs.
Experiment 2
In this experiment to determine whether the
size of FSSC donor cells was an important factor,
FSSCs of different sizes were isolated from spher-

368
oids and used as donor cells. A comparison of the
blastocyst rates, cleavage rates, and mean cell
number from the three different cell sizes and for
the parthenogenetic controls is shown in Table 2.
There was no significant difference which could
be attributed to the size of the donor cells and the
blastocyst rate for the parthenogenetic controls
was normal (33.2% 8.8%).
Experiment 3
In the experiment to determine whether FSSC
donor cells derived from spheroids were better
or worse than fibroblasts, there was no significant
difference between the two cell types with respect
to blastocyst rate, cleavage rate, or mean number
of cells in the blastocysts (Table 3). Differential
staining, revealed no significant differences between
the two cell types with respect to the number
of ICM cells, the number of TE cells, total
number of cells, or the number of cells in the ICM
as a proportion of the total cell number (Table 4).
Experiment 4
TABLE 1. BLASTOCYST RATES, CLEAVAGE RATES, AND MEAN CELL NUMBER OF BLASTOCYSTS
OF EMBRYOS DERIVED FROM 3D COLONIES AND FETAL FIBROBLASTS
Cleavage rate Blastocyst rate Cell number of blastocysts
Experimental groups n (%) (%) (mean SD)
FSSCs 138 64.8 17.3 6.4 3.5 a 32 80
Fetal fibroblasts 166 82.5 5.60 24.9 8.6 b 31 13
Parthenogenetic 356 81.6 11.7 44.3 9.1 b 32 11
a p 0.05, six replications.
In this experiment to evaluate the quality of reconstituted
embryos by their capacity for in vivo
development, embryos cloned from FSSCs were
transferred to synchronized foster mothers, and
at 25 days three of the seven recipients were pregnant.
A second ultrasound examination at 32 days
showed that these three animals were still preg-
nant. The eighth recipient died shortly after surgery
for reasons unrelated to the experiment and
was not included in the analysis. The three sows
which remained pregnant delivered a total of
seven female piglets. Three of the piglets survived
and showed normal development (Figs. 4
and 5). Microsatellite analysis confirmed that the
piglets had been derived from the FSSCs. The
other four piglets had normal birthweights and
no obvious deformaties. A detailed pathological
examination suggested that they had developed
normally.
DISCUSSION
HORNEN ET AL.
Successful nuclear transfer depends on correct
and complete epigenetic reprogramming of the
donor cell nucleus to convert the genome of a differentiated
somatic cell into the totipotent state
(Gurdon and Colman, 1999). It has been suggested
that a less differentiated nuclear donor
cell could be more efficiently reprogrammed
(Jaenisch et al., 2002) and, indeed, in the mouse,
cloning from pluripotent embryonic stem cells resulted
in higher rates of development than
cloning with differentiated donor cells (Wakayama
et al., 1999). Embryonic stem cells have not
yet been isolated from livestock species; however,
we recently reported a cell culture system that enriches
a subpopulation of FSSCs in the pig, the
TABLE 2. BLASTOCYST RATES, CLEAVAGE RATES, AND MEAN CELL NUMBER OF EMBRYOS
RECONSTRUCTED WITH SPHEROID FSSCS OFDIFFERENT SIZE CLASSES
Cleavage rate Blastocyst rate Cell number of blastocysts
Experimental groups n (%) (%) (mean SD)
Small’ FSSCs 145 83.5 7.8 15.3 7.9 32 13
Medium’ FSSCs 135 83.1 1.6 17.6 6.8 34 13
Large’ FSSCs 142 83.2 5.8 10.4 2.7 31 16
Parthenogenetic 259 88.8 8.9 33.2 8.8 34 11
controls
Five replications.

FSSCS IN SOMATIC CELL NUCLEAR TRANSFER 369
TABLE 3. BLASTOCYST RATES, CLEAVAGE RATES, AND MEAN CELL NUMBER OF BLASTOCYSTS
OF EMBRYOS DERIVED FROM SPHEROID FSSCS AND FETAL FIBROBLASTS
Cleavage rate Blastocyst rate Cell number of blastocysts
Experimental groups n (%) (%) (mean SD)
FSSCs 348 80.7 5.9 18.4 5.6 35 11
Fetal fibroblasts 322 86.1 6.7 21.4 5.6 37 13
Parthenogenetic 586 84.2 7.3 36.1 5.8 34 11
Ten replications.
cow, and the mouse. These FSSCs exhibit many
of the characteristics of pluripotent ES cells (Kues
et al., 2005), including absence of senescence in a
high-density culture, loss of typical fibroblast
markers, and expression of typical stem cell
markers such as OCT4, AP, and STAT3. Injection
of mouse FSSCs into the blastocoel resulted in
chimerism in fetal mesenchymal organs, and occasionally
labeled cells were identified in the genital
ridge (Kues et al., 2005). We hypothesized that
FSSCs would require less reprogramming than
more differentiated cell types, and could evolve
as a novel source of donor cells in somatic nuclear
transfer.
In the present study, we report the birth of the
first cloned piglets from somatic stem cells and
demonstrate the capacity of FSSCs for in vivo development.
After transferring 70–100 reconstituted
embryos to each recipient, three of seven
gilts (42.9%) became pregnant. Harrison et al.
(2004) reported a higher efficiency with fetal fibroblasts
and recent experience in our laboratory
is similar.
An early observation of the FSSC population
in culture revealed different cellular morphologies
depending on culture conditions. Before going
directly to the in vivo experiments, it was necessary
to evaluate the developmental competence
of these different classes of FSSC. The FSSCs
could be grown as three dimensional colonies by
allowing them to grow first as a high density culture
attached to a dish. The FSSCs could also be
grown as spheroid cultures by suspension cul-
ture. In both cases it was necessary to trypsinize
the cell aggregates to obtain single cells for nuclear
transfer, and in both cases, the trypsinization
resulted in a range of cell sizes.
In removing three-dimensional colonies from
the culture dish prior to EDTA/trypsin treatment,
it was impossible to avoid some degree of
contamination by the fibroblasts which form a
monolayer on the surface of the dish and provide
a substrate for colony growth. Trypsinization of
these colonies released some fibroblasts into the
single cell suspension which must be avoided
when the cells were to be used as nuclear donor
cells. Spheroid cultures did not have this disadvantage,
and thus were expected to provide pure
FSSC samples. Another problem with using the
three-dimensional cultures as sources of donor
cells was the extended period of exposure to the
EDTA/trypsin treatment which was necessary to
give single-cell suspensions. Indeed, one explanation
for the low blastocyst rate in the first experiment
could be attributed to the stress of
trypsin isolation on these donor cells. This idea is
supported by the fact that many damaged cells
could be observed in these preparations. In subsequent
experiments, in addition to changing to
suspension cultured FSSC cells, we also were able
to shorten the EDTA/trypsin treatment.
When using fetal fibroblasts as NT donor cells,
it is desirable to select small round cells which
have been demonstrated to be typical for the
G0/G1 phase of the cell cycle (Boquest et al.,
1999). Fetal fibroblast cultures have a greater
TABLE 4. RESULTS OF DIFFERENTIAL STAINING OF THE BLASTOCYSTS
WITH FSSCS ORFETAL FIBROBLASTS AS DONOR CELLS
Number of Number of ICM cells/total
Experimental Blastocysts ICM cells TE cells Total cell number cell number
groups n (mean SD) (mean SD) (m) (%)
FSSCs 24 16 5 22 12 39 14 41.7 14.3
Fetal fibroblasts 25 17 8 24 10 39 11 42.3 17.3
Six replications.

370
FIG. 4. The three vital piglets 1 day after birth.
number of cells with this favoured morphology
after 48 h of serum deprivation. Unfortunately,
cultures of FSSCs, both 3D colonies and spheroids,
are heterogeneous with regard to cell size,
and it is necessary to make a choice when selecting
cells for nuclear donation. The FSSCs of
“medium” size corresponded to the size of the fetal
fibroblasts. Interestingly, the results of the second
experiment showed no significant difference
in development which could be related to donor
cell size. This indicates that cell size is not an appropriate
selection criterion for NT with FSSCs.
Having determined that a more homogeneous
and more viable population of FSSCs could be
isolated from suspension produced spheroids
and having learned that cell size was not an important
trait for selection, the next step was to directly
compare fibroblasts and FSSCs with respect
to the developmental potential of embryos produced
from these two types of nuclear donor
cells. It is obvious that medium-size FSSCs isolated
from spheroids have the same developmental
potential after nuclear transfer as fetal fibroblasts
(20%). For comparison, the blastocyst
rates reported with various types of differentiated
porcine nuclear donor cells range from
10.3% to 37% (Boquest et al., 2002; Hyun et al.,
2003; Kim et al., 2006; Lee et al., 2003a, 2003b,
2005b, 2005c). It is difficult to compare the results
from different laboratories due to the many
methodological differences with regard oocyte
HORNEN ET AL.
source (in vivo vs. in vitro maturation, young or
adult sows, slaughterhouse derived or fresh
ovaries, etc.). In some instances, there is no visual
control of enucleation success, which means that
enucleation may not have been achieved in all instances
(Boquest et al., 2002; Hyun et al., 2003; Lee
et al., 2003b). Lee et al. (2003b) injected donor cells
into the cytoplasm of oocytes and obtained a blastocyst
rate of 37%. Other laboratories have looked
at various types of less differentiated donor cells.
For example, dedifferentiated preadipocytes
gave a blastocyst rate of 20.8% (Tomii et al., 2005).
Zhu et al. (2004) obtained blastocyst rates of 25%
with porcine skin-derived stem cells (PSOS),
Bosch et al. (2006) used porcine mesenchymal
stem cells (MSC) as donors and reported a blastocyst
rate of 4.1% and Sung et al. (2006) used
long-term and short-term repopulating hematopoietic
stem cells and hematopoietic progenitor
cells as donors and reported morula/blastocyst
rates of 4.1%–10.6%.
The present experiments used a nuclear transfer
protocol which had been optimized for fetal
fibroblasts. FSSCs are different from fibroblasts
in that they exhibit several different morphologies
depending on culture conditions. This presumably
reflects physiological differences as
well, so it is likely that a nuclear transfer protocol
specifically optimized for FSSC would give increased
the cloning efficiency.
Comparison of the quality of fetal fibroblast
and FSSC derived cloned embryos (i.e., total cell
number and the ratio of ICM cells to the total cell
number) showed that there was no significant difference
between the two types of donor cell. The
total cell numbers for both groups were similar
to cell counts previously reported (Park et al.,
2001a, 2001b, 2001c, 2002). In general, total cell
numbers of in vivo produced blastocysts or IVP
FIG. 5. Piglets at age of 2.5 months.

FSSCS IN SOMATIC CELL NUCLEAR TRANSFER 371
embryos are higher than those reported for
cloned embryos. This may be due to the fact that
optimal culture conditions have not yet been developed
for cloned porcine embryos (Niemann
and Rath, 2001). Indeed, the current status of
porcine preimplantation embryo culture is far behind
that of bovine or mouse embryo culture
where significantly higher blastocyst rates are
routine. We have achieved a degree of improvement
in that the proportion of ICM cells to the total
number of cells in the blastocysts was higher
than previously reported for cloned embryos
(Koo et al., 2004). Normal fetal development requires
an adequate number of both ICM and TE
cells for implantation (Tam, 1988). Bovine cloned
blastocysts often show a higher total cell number
and a higher proportion of ICM cells than IVF or
in vivo developed embryos (Koo et al., 2002). A
distortion in this ratio can be associated with malformations
of the placenta and early fetal loss
(Koo et al., 2002). In our in vivo experiment, we
did not observe malformations of the placentas
or abortions. In contrast to bovine cloning experiments,
the number of TE cells was normal and
the number of ICM cells was increased (Koo et
al., 2004). The increase of ICM cells was observed
for both FSSCs and fetal fibroblasts. These embryos
still do not match the total cell number or
the ICM/TE ratios of normal embryos developing
in vivo, but the increase in ICM cells indicates
that progress is being made toward developing
an optimized somatic nuclear transfer protocol.
Stem cell markers including Oct4 and alkaline
phosphatase (AP) should facilitate separation of
FSSC from contaminating fibroblasts (Yeom et al.,
1996; Kues et al., 2005). One possibility for improving
the selection of FSSC donor cells could
be to transfect the population with a gene construct
consisting of Oct4 as a promotor and an appropriate
flurorescent reporter gene or even an
antibiotic resistance gene. This would enable one
to isolate pure FSSCs with high efficiency. Another
possibility would be the use of antibodies
against stem cell specific surface markers either
to visualize FSSCs or to purify them by FACS.
Human CD133 (formerly AC133) is one such
pluripotent stem cells marker (Miraglia et al.,
1997; Yin et al., 1997); however, its presence on
FSSCs has not yet been shown.
In conclusion, results of this study show that
FSSCs have at least the same in vitro developmental
potential as fetal fibroblasts using an established
nuclear transfer protocol and are able
to generate vital piglets following embryo transfer.
Improved selection and handling of the
FSSCs could increase the efficiency.
ACKNOWLEDGMENTS
This work was supported by the H. Wilhelm
Schaumann Foundation.
REFERENCES
Baguisi, A., Behboodi, E., Melican, D.T., et al. (1999). Production
of goats by somatic cell nuclear transfer. Nat.
Biotechnol. 17, 456–461.
Betthauser, J., Forsberg, E., Augenstein, M., et al. (2000).
Production of cloned pigs from in vitro systems. Nat.
Biotechnol. 18, 1055–1059.
Boquest, A.C., Day, B.N., and Prather, R.S. (1999). Flow
cytometric cell cycle analysis of cultured porcine fetal
fibroblast cells. Biol. Reprod. 60, 1013–1019.
Boquest, A.C., Grupen, C.G., Harrison, S.J., et al. (2002).
Production of cloned pigs from cultured fetal fibroblast
cells. Biol. Reprod. 66, 1283–1287.
Bosch, P., Pratt, S.L., and Stice, S.L. (2006). Isolation, characterization,
gene modification, and nuclear reprogramming
of porcine mesenchymal stem cells. Biol. Reprod.
74, 46–57.
Campbell, K.H.S., McWhir, J., Ritchie, W.A., et al. (1996).
Sheep cloned by nuclear transfer from a cultured cell
line. Nature 380, 64–66.
Chesne, P., Adenot, P.G., Viglietta, C., et al. (2002). Cloned
rabbits produced by nuclear transfer from adult somatic
cells. Nat. Biotechnol. 20, 366–369.
Cibelli, J.B., Stice, S.L., Golueke, P.J., et al. (1998). Cloned
transgenic calves produced from nonquiescent fetal fibroblasts.
Science 280, 1256–1258.
Denning, C., Dickinson, P., Burl, S., et al. (2001). Gene targeting
in primary fetal fibroblasts from sheep and pig.
Cloning Stem Cells 3, 221–231.
Galli, C., Lagutina, I., Crotti, G., et al. (2003). A cloned
horse born to its dam twin—a birth announcement calls
for a rethink on the immunological demands of pregnancy.
Nature 424, 635.
Gjorret, J.O., and Maddox-Hyttel, P. (2005). Attempts towards
derivation and establishment of bovine embryonic
stem cell-like cultures. Reprod. Fertil. Dev. 17, 113–124.
Gurdon, J.B., and Colman, A. (1999). The future of
cloning. Nature 402, 743–746.
Gurdon, J.B., Byrne, J.A., and Simonsson, S. (2003). Nuclear
reprogramming and stem cell creation. Proc. Natl.
Acad. Sci. USA 100, 11819–11822.
Han, Y.M., Kang, Y.K., Koo, D.B., et al. (2003). Nuclear reprogramming
of cloned embryos produced in vitro.
Theriogenology 59, 33–44.
Harrison, S., Boquest, A., Grupen, C., et al. (2004). An efficient
method for producing alpha(1,3)-galactosyl-

372
transferase gene knockout pigs. Cloning Stem Cells 6,
327–331.
Hochedlinger, K., and Jaenisch, R. (2002). Monoclonal
mice generated by nuclear transfer from mature B and
T donor cells. Nature 415, 1035–1038.
Hoelker, M., Petersen, B., Hassel, P., et al. (2005). Duration
of in vitro maturation of recipient oocytes affects
blastocyst development of cloned porcine embryos.
Cloning Stem Cells 7, 35–44.
Hyun, S.H., Lee, G.S., Kim, D.Y., et al. (2003). Effect of
maturation media and oocytes derived from sows or
gilts on the development of cloned pig embryos. Theriogenology
59, 1641–1649.
Inoue, K., Wakao, H., Ogonuki, N., et al. (2005). Generation
of cloned mice by direct nuclear transfer from natural
killer T cells. Curr. Biol. 15, 1114–1118.
Jaenisch, R., Eggan, K., Humpherys, D., et al. (2002). Nuclear
cloning, stem cells, and genomic reprogramming.
Cloning Stem Cells 4, 389–396.
Kato, Y., Tani, T., and Tsunoda, Y. (2000). Cloning of
calves from various somatic cell types of male and female
adult, newborn and fetal cows. J. Reprod. Fertil.
120, 231–237.
Kim, H.S., Lee, G.S., Kim, J.H., et al. (2006). Expression of
leptin ligand and receptor and effect of exogenous leptin
supplement on in vitro development of porcine embryos.
Theriogenology 65, 831–844.
Koo, D.B., Kang, Y.K., Choi, Y.H., et al. (2002). Aberrant
allocations of inner cell mass and trophectoderm cells
in bovine nuclear transfer blastocysts. Biol. Reprod. 67,
487–492.
Koo, D.B., Kang, Y.K., Park, J.S., et al. (2004). A paucity
of structural integrity in cloned porcine blastocysts produced
in vitro. Theriogenology 62, 779–789.
Kues, W.A., and Niemann, H. (2004). The contribution of
farm animals to human health. Trends Biotechnol. 22,
286–294.
Kues, W.A., Petersen, B., Mysegades, W., et al. (2005). Isolation
of murine and porcine fetal stem cells from somatic
tissue. Biol. Reprod. 72, 1020–1028.
Lee, G.S., Kim, H.S., Hyun, S.H., et al. (2003a). Improved
developmental competence of cloned porcine embryos
with different energy supplements and chemical activation.
Mol. Reprod. Dev. 66, 17–23.
Lee, J.W., Wu, S.C., Tian, X.C., et al. (2003b). Production
of cloned pigs by whole-cell intracytoplasmic microinjection.
Biol. Reprod. 69, 995–1001.
Lee, B.C., Kim, M.K., Jang, G., et al. (2005a). Dogs cloned
from adult somatic cells. Nature 436, 641.
Lee, G.S., Kim, H.S., Hyun, S.H., et al. (2005b). Effect of
epidermal growth factor in preimplantation development
of porcine cloned embryos. Mol. Reprod. Dev. 71,
45–51.
Lee, G.S., Kim, H.S., Hyun, S.H., et al. (2005c). Production
of transgenic cloned piglets from genetically transformed
fetal fibroblasts selected by green fluorescent
protein. Theriogenology 63, 973–991.
Lequarre, A.S., Marchandise, J., Moreau, B., et al. (2003).
Cell cycle duration at the time of maternal zygotic transition
for in vitro produced bovine embryos: effect of
HORNEN ET AL.
oxygen tension and transcription inhibition. Biol. Reprod.
69, 1707–1713.
Li, Z., Sun, X., Chen, J., et al. (2006). Cloned ferrets produced
by somatic cell nuclear transfer. Dev. Biol. 293,
439–448.
Maddox-Hyttel, P., Dinnyes, A., Laurincik, J., et al. (2001).
Gene expression during pre- and peri-implantation embryonic
development in pigs. Reprod. Suppl. 58, 175–
189.
Miraglia, S., Godfrey, W., Yin, A.H., et al. (1997). A novel
five-transmembrane hematopoietic stem cell antigen:
isolation, characterization, and molecular cloning.
Blood 90, 5013–5021.
Niemann, H., and Rath, D. (2001). Progress in reproductive
biotechnology in swine. Theriogenology 56, 1291–1304.
Onishi, A., Iwamoto, M., Akita, T., et al. (2000). Pig
cloning by microinjection of fetal fibroblast nuclei. Science
289, 1188–1190.
Park, K.W., Cheong, H.T., Lai, L.X., et al. (2001a). Production
of nuclear transfer-derived swine that express
the enhanced green fluorescent protein. Anim. Biotechnol.
12, 173.
Park, K.W., Kuhholzer, B., Lai, L.X., et al. (2001b). Development
and expression of the green fluorescent protein
in porcine embryos derived from nuclear transfer of
transgenic granulosa-derived cells. Anim. Reprod. Sci.
68, 111–120.
Park, K.W., Lai, L.X., Cheong, H.T., et al. (2001c). Developmental
potential of porcine nuclear transfer embryos
derived from transgenic fetal fibroblasts infected with
the gene for the green fluorescent protein: comparison
of different fusion/activation conditions. Biol. Reprod.
65, 1681–1685.
Park, K.W., Lai, L.X., Cheong, H.T., et al. (2002). Mosaic
gene expression in nuclear transfer-derived embryos
and the production of cloned transgenic pigs from earderived
fibroblasts. Biol. Reprod. 66, 1001–1005.
Polejaeva, I.A., Chen, S.H., Vaught, T.D., et al. (2000).
Cloned pigs produced by nuclear transfer from adult
somatic cells. Nature 407, 86–90.
Schoeler, H.R. (2004). [The potential of stem cells. A
status update]. Bundesgesundheitsblatt. Gesundheitsforschung.
Gesundheitsschutz. 47, 565–577.
Schwarzer, M., Carnwath, J.W., Lucas-Hahn, A., et al.
(2006). Isolation of bovine cardiomyocytes for reprogramming
studies based on nuclear transfer. Cloning
Stem Cells 8, 150–158.
Shin, T., Kraemer, D., Pryor, J., et al. (2002). A cat cloned
by nuclear transplantation. Nature 415, 859.
Sung, L.Y., Gao, S., Shen, H., et al. (2006). Differentiated
cells are more efficient than adult stem cells for cloning
by somatic cell nuclear transfer. Nat. Genet. 38, 1323–
1328.
Tam, P.P.L. (1988). Postimplantation development of
mitomycin-C-treated mouse blastocysts. Teratology 37,
205–212.
Thouas, G.A., Korfiatis, N.A., French, A.J., et al. (2001).
Simplified technique for differential staining of inner
cell mass and trophectoderm cells of mouse and bovine
blastocysts. Reprod. Biomed. Online. 3, 25–29.

FSSCS IN SOMATIC CELL NUCLEAR TRANSFER 373
Tomii, R., Kurome, M., Ochiai, T., et al. (2005). Production
of cloned pigs by nuclear transfer of preadipocytes
established from adult mature adipocytes. Cloning
Stem Cells 7, 279–288.
Wakayama, T., and Yanagimachi, R. (2001). Mouse
cloning with nucleus donor cells of different age and
type. Mol. Reprod. Dev. 58, 376–383.
Wakayama, T., Perry, A.C.F., Zuccotti, M., et al. (1998). Fullterm
development of mice from enucleated oocytes injected
with cumulus cell nuclei. Nature 394, 369–374.
Wakayama, T., Rodriguez, I., Perry, A.C.F., et al. (1999).
Mice cloned from embryonic stem cells. Proc. Natl.
Acad. Sci. USA 96, 14984–14989.
Walker, S.C., Shin, T., Zaunbrecher, G.M., et al. (2002). A
highly efficient method for porcine cloning by nuclear
transfer using in vitro-matured oocytes. Cloning Stem
Cells 4, 105–112.
Westphal, H. (2005). Restoring stemness. Differentiation
73, 447–451.
Wilmut, I., Schnieke, A.E., McWhir, J., et al. (1997). Viable
offspring derived from fetal and adult mammalian
cells. Nature 385, 810–813.
Woods, G.L., White, K.L., Vanderwall, D.K., et al. (2003).
A mule cloned from fetal cells by nuclear transfer. Science
301, 1063.
Yeom, Y.I., Fuhrmann, G., Ovitt, C.E., et al. (1996).
Germline regulatory element of Oct-4 specific for the
totipotent cycle of embryonal cells. Development 122,
881–894.
Yin, A.H., Miraglia, S., Zanjani, E.D., et al. (1997). AC133,
a novel marker for human hematopoietic stem and progenitor
cells. Blood 90, 5002–5012.
Zhou, Q., Renard, J.P., Le Friec, G., et al. (2003). Generation
of fertile cloned rats by regulating oocyte activation.
Science 302, 1179.
Zhu, H., Craig, J.A., Dyce, P.W., et al. (2004). Embryos derived
from porcine skin-derived stem cells exhibit enhanced
preimplantation development. Biol. Reprod. 71,
1890–1897.
Address reprint requests to:
Heiner Niemann
Department of Biotechnology
Institut für Tierzucht
D-31535 Neustadt, Germany
E-mail: niemann@tzv.fal.de

CSIRO PUBLISHING
Reproduction, Fertility and Development, 2007, 19, 762–770 www.publish.csiro.au/journals/rfd
Transgenic farm animals: an update
Heiner Niemann A,B and Wilfried A. Kues A
A Department of Biotechnology, Institute for Animal Breeding, Mariensee, 31535 Neustadt, Germany.
B Corresponding author. Email: niemann@tzv.fal.de
Abstract. The first transgenic livestock species were reported in 1985. Since then microinjection of foreign DNA
into pronuclei of zygotes has been the method of choice. It is now being replaced by more efficient protocols based on
somatic nuclear transfer that also permit targeted genetic modifications. Lentiviral vectors and small interfering ribonucleic
acid (siRNA) technology are also becoming important tools for transgenesis. In 2006 the European Medicines Agency
(EMEA) gave green light for the commercialistion of the first recombinant protein produced in the milk of transgenic
animals. Recombinant antithrombin III will be launched as ATryn for prophylactic treatment of patients with congenital
antithrombin deficiency. This important milestone will boost the research activities in farm animal transgenesis. Recent
developments in transgenic techniques of farm animals are discussed in this review.
Additional keywords: conditional transgene expression, gene pharming, lentiviral mediated transgenesis, pronuclear
DNA injection, RNA interference, somatic cloning, xenotransplantation.
Introduction
The first transgenic livestock were produced in 1985 via microinjection
of foreign DNA into pronuclei of zygotes (Hammer
et al. 1985). As microinjection has several significant shortcomings,
including random integration into the host genome, low
efficiency and frequent incidence of mosaicism, research has
focussed on alternate methodologies for improving the generation
of transgenic livestock (Kues and Niemann 2004; Table 1).
These include sperm mediated DNA transfer (Gandolfi 1998;
Squires 1999; Chang et al. 2002; Lavitrano et al. 2002), the
intracytoplasmic injection (ICSI) of sperm heads carrying foreign
DNA (Perry et al. 1999), injection or infection of oocytes
or embryos by viral vectors (Haskell and Bowen 1995; Chan
et al. 1998; Hofmann et al. 2003; Whitelaw et al. 2004) or the
use of nuclear transfer (Schnieke et al. 1997; Cibelli et al. 1998;
Baguisi et al. 1999). Further qualitative improvements may be
derived from technologies that allow targeted modifications of
the genome (Dai et al. 2002; Lai et al. 2002), or conditional
instead of a constitutive expression of transgenes (Kues et al.
2006). Other important developments are the usage of large
genomic constructs to optimise expression, the application of
RNA interference to knock down specific genes and the use of
episomal vectors that might allow a more consistent expression
owing to the absence of position effects (Manzini et al. 2006).
Pharmaceutical production in the mammary gland
of transgenic animals
Gene ‘pharming’ entails the production of recombinant human
pharmaceutical proteins in the mammary gland of transgenic
animals.This technology can overcome the limitations of current
recombinant production systems for pharmaceutical proteins
(Meade et al. 1999; Rudolph 1999). The mammary gland is
the preferred production site mainly because of the quantities
of protein that can be produced by employing various mammary
gland-specific promoter and the ease of production and
purification (Meade et al. 1999; Rudolph 1999).
Numerous proteins have been produced at large amounts
in the mammary gland of transgenic sheep, goat, cattle, pigs
and rabbits and have been advanced to clinical trials (Kues and
Niemann 2004). Phase III trials for antithrombin III (ATIII)
(ATryn from GTC Biotherapeutics, Framingham, MA, USA)
produced in the mammary gland of transgenic goats have been
completed and the recombinant product has been approved as
a drug by the European Medicines Agency (EMEA) in August
2006. The protein is expected to be on the market as a fully
registered drug in 2007. Successful drug registration of ATryn
demonstrated the usefulness and solidity of this approach and
will accelerate registration of further products from this process,
as well as stimulate research and commercial activity in
this area. Other recombinant proteins from the udder are recombinant
C1 inhibitor (Pharming BV, Leiden, The Netherlands)
produced in the milk of transgenic rabbits, α-antitrypsin (α-AT)
and tissue plasminogen activator (tPA), which have all progressed
to advanced clinical trials (Kues and Niemann 2004).
The enzyme α-glucosidase (Pharming BV) from the milk of
transgenic rabbits has orphan drug registration and has been
successfully used for the treatment of Pompe’s disease (Van den
Hout et al. 2001). An overview of the current list of recombinant
pharmaceutical proteins advanced state to commercial exploitation
is given in Table 2 (Echelard et al. 2006). The use of somatic
nuclear transfer accelerates production of transgenic animals
with high mammary gland specific synthesis of recombinant
proteins (Fig. 1).
Another production site for recombinant products is the blood
of transgenic animals.Transgenic cattle were cloned that produce
© CSIRO 2007 10.1071/RD07040 1031-3613/07/060762

Transgenic farm animals: an update Reproduction, Fertility and Development 763
Table 1. Milestones (live offspring) in transgenesis and somatic cloning in farm animals
Modified from Niemann et al. 2005
Year Milestone Strategy Reference
1985 First transgenic sheep and pigs Microinjection of DNA into one pronucleus of a zygote Hammer et al. 1985
1986 Embryonic cloning of sheep Nuclear transfer using embryonic cells as donor cells Willadsen 1986
1997 Cloning of sheep with somatic donor cells Nuclear transfer using adult somatic donor cells Wilmut et al. 1997
1997 Transgenic sheep produced by nuclear transfer Random integration of the construct Schnieke et al. 1997
1998 Transgenic cattle produced from fetal fibroblasts and Random integration of the construct Cibelli et al. 1998
nuclear transfer
1998 Generation of transgenic cattle by MMLV injection Infection of oocytes with helper viruses Chan et al. 1998
2000 Gene targeting in sheep Gene replacement and nuclear transfer McCreath et al. 2000
2002 Trans-chromosomal cattle Artificial chromosome Kuroiwa et al. 2002
2002 Knockout in pigs Heterozygous knockout Dai et al. 2002, Lai et al. 2002
2003 Homozygous gene knockout in pigs Homozygous knock-out Phelps et al. 2003
2003 Transgenic pigs via lentiviral injection Gene transfer into zygotes via lentiviruses Hofmann et al. 2003
2006 Conditional transgene expression in pigs (tet-off) Pronuclear DNA injection and crossbreeding Kues et al. 2006
Table 2. List of therapeutic proteins produced in the milk of transgenic animal that are currently in
commercial development
HAE, Hereditary angioedema; AFP, α-fetoprotein; HGH, human growth hormone; Mab, monoclonal antibody.
Modified from Echelard et al. 2006
Products Companies Production Developmental stage
animal
ATryn (recombinant human GTC Biotherapeutics Goat EU: EMEA approved
antithrombin III) US: Phase 3
C1 Esterase Inhibitor Pharming Rabbit Phase 3 for HAE
MM-093 (AFP) Merrimack and GTC Biotherapeutics Goat Phase 2 for RA
Alpha-Glucosidase Pharming Rabbit Phase 2, on hold
HGH BioSidus Cow Preclinical
Albumin GTC Biotherapeutics Cow Preclinical
Fibrinogen Pharming Cow Preclinical
Collagen Pharming Cow Preclinical
Lactoferrin Pharming Cow Preclinical
Alpha-1 Antitrypsin GTC Biotherapeutics Goat Preclinical
Malaria vaccine GTC Biotherapeutics Goat Preclinical
CD 137 (4–1BB) MAb GTC Biotherapeutics Goat Preclinical
a recombinant bi-specific antibody in their blood. This antibody
is stable after purification from serum and active in mediating
target-cell-restricted T-cell stimulation and tumour cell killing
(Grosse-Hovest et al. 2004).
To ensure safety of recombinant products, guidelines developed
by the Food and Drug Administration (FDA) of the USA
require monitoring of the animals’ health, validation of the gene
construct, characterisation of the isolated recombinant protein,
as well as performance of the transgenic animals over several
generations. This has been taken into account when developing
the ‘gene pharming’ concept, for example by using exclusively
animals from prion-disease-free countries (New Zealand) and
keeping the production animals under strict hygienic conditions.
Porcine-to-human xenotransplantation
The progress in organ transplantation technology has led to an
acute shortage of appropriate organs, and cadaveric or live organ
donation can by far not meet the demand in western societies.
To close the growing gap between demand and availability of
appropriate organs, porcine xenografts from domesticated pigs
are considered the solution of choice (Bach 1998; Platt and
Lin 1998; Kues and Niemann 2004). Essential prerequisites for
successful xenotransplantation are: (1) overcoming the immunological
hurdles; (2) prevention of transmission of pathogens from
the donor animal to the human recipient; and (3) compatibility
of the donor organs with the human organ in terms of anatomy
and physiology.
The main strategies that have been successfully explored for
a long-term suppression of the first immunological hurdle, i.e.
the hyperacute rejection (HAR) of porcine xenografts, are the
synthesis of human complement regulatory proteins (RCAs) in
transgenic pigs (Cozzi and White 1995; Bach 1998; Platt and Lin
1998) and/or the knockout of antigenic structures on the surface
of the porcine organ that cause HAR, i.e. the α-gal-epitopes
(Phelps et al. 2003; Kuwaki et al. 2005; Yamada et al. 2005).
Survival rates after transplantation of porcine RCA transgenic

764 Reproduction, Fertility and Development H. Niemann and W. A. Kues
Generate construct/cell lines
Nuclear transfer
F0 Female goat births
F0 Induced lactation
F0 Natural lactation
Research material
Pre-clinical material
Phase 1 material
F1 Females/male births
F1 Females natural lactation
F2 Females natural lactaton
Bridging/Phase 3 material
DNA 0.5 yr 1 yr 1.5 yr 2 yr 2.5 yr 3 yr 3.5 yr 4 yr
Fig. 1. Timeline for the production of recombinant proteins in the mammary gland of transgenic goats via somatic
cloning (modified from Echelard et al. 2006).
hearts or kidneys to immune-suppressed non-human primates
ranged from 23 to 135 days. Overall, current data show that HAR
can be overcome in a clinically acceptable manner by expressing
human complement regulators in transgenic pigs (Bach 1998).
The usefulness of porcine organs with a knockout for the
1,3-α-galactosyltransferase (α-gal) gene in a xenotransplantation
situation has been demonstrated. Survival rates reached 2–6
months upon transplantation of porcine hearts or kidneys from
α-gal-knockout pigs to baboons (Kuwaki et al. 2005; Yamada
et al. 2005). However, donor pigs with multiple transgenes critical
in other immunological barriers are thought to be required
for a prolonged survival of >6 months of porcine organs in nonhuman
primates. We have recently produced triple transgenic
pigs to suppress the coagulatory disorder frequently found after
porcine-to-primate xenotransplantation by expressing human
thrombomodulin (hTM) or human heme-oxygenase-1 (hHO-1)
on top of two RCAs (Petersen et al. 2006). A consistent survival
of porcine xenografts for more than 6 months in non-human primate
recipients is thought to be necessary for starting clinical
trials with human patients.
Recent research has revealed that the risk of porcine endogenous
retrovirus (PERV) transmission to human patients is low,
paving the way for preclinical testing of xenografts (Switzer et al.
2001; Irgang et al. 2003). RNA interference (RNAi) is a promising
approach to knock down PERV expression in porcine cells
(Dieckhoff et al. 2007), which could then be used in nuclear
transfer. Guidelines for the clinical application of porcine xenotransplants
are already available in the USA and are currently
being developed in several other countries. The compatibility
between porcine and human organs, remains to a large extent an
enigma, but preliminary information regarding the function of
porcine kidneys and heart in non-human primates are promising
in this respect (Ibrahim et al. 2006).
Transgenic animals in agriculture
Agricultural applications of transgenic animals are lagging
behind the biomedical area (Kues and Niemann 2004). Table 3
shows an overview on the various attempts to produce animals
transgenic for agricultural traits. An important step towards the
production of healthier pork has been made by the first pigs
transgenic for a desaturase gene derived either from spinach
or Caenorhabditis elegans. These pigs produced a higher ratio
of polyunsaturated versus saturated fatty acids in their muscles
clearly indicating the potential of rendering more healthier pork
in the near future (Niemann 2004; Saeki et al. 2004; Lai et al.
2006).A human diet rich in non-saturated fatty acids is correlated
with a reduced risk of stroke and coronary diseases. In the pig, it
has been shown that transgenic expression of a bovine lactalbumin
construct in sow milk resulted in higher lactose contents and
greater milk yields, which correlated with a better survival and
development of the piglets (Wheeler et al. 2001). The increased
survival of piglets at weaning provides significant benefits to
animal welfare and the producer. Phytase transgenic pigs have
been developed to address the problem of manure-based environmental
pollution. These pigs carry a bacterial phytase gene
under the transcriptional control of a salivary gland specific
promoter, which allows the pigs to digest plant phytate. Without
the bacterial enzyme, the phytate phosphorus passes undigested
into manure and pollutes the environment. With the bacterial
enzyme, the fecal phosphorus output was reduced up to 75%
(Golovan et al. 2001). These environmentally friendly pigs are
expected to enter commercial production chains within the next
few years.
The physicochemical properties of milk are mainly affected
by the ratio of casein variants making them a prime target for the
improvement of milk composition. The bovine casein ratio can
be altered by overexpression of β- and κ-casein clearly underpinning
the potential for improvements in the functional properties
of bovine milk (Brophy et al. 2003). Mastitis is a preeminent
health problem in modern dairy cattle production causing significant
economic losses. Lysostaphin has been shown to confer
specific resistance against mastitis caused by Staphylococcus
aureus. Cows have been cloned from transgenic donor cells that
express a lysostaphin gene construct in the mammary gland,

Transgenic farm animals: an update Reproduction, Fertility and Development 765
Table 3. Overview on successful transgenic livestock for agricultural production
Transgenic trait Key molecule Construct Gene transfer method Species Reference
Increased growth rate, less body fat Growth hormone (GH) hMT-pGH Microinjection Pig Nottle et al. 1999
Increased growth rate, less body fat Insulin-like growth factor-1 (IGF-1) mMT-hIGF-1 Microinjection Pig Pursel et al. 1999
Increased level of poly-un-saturated Desaturase (from spinach) maP2-FAD2 Microinjection Pig Saeki et al. 2004
fatty acids in pork
Increased level of poly-un-saturated Desaturase (from C. elegans) CAGGS-hfat-1 Somatic cloning Pig Lai et al. 2006
fatty acids in pork
Phosphate metabolism Phytase PSP-APPA Microinjection Pig Golovan et al. 2001
Milk composition (lactose increase) α-lactalbumin genomic bovine Microinjection Pig Wheeler et al. 2001
α-lactalbumin
Influenza resistance Mx protein mMx1-Mx Microinjection Pig Müller et al. 1992
Enhanced disease resistance IgA α,K-α,K Microinjection Pig, sheep Lo et al. 1991
Wool growth Insulin-like growth factor-1 (IGF-1) Ker-IGF-1 Microinjection Sheep Damak et al. 1996a,
1996b
Visna Virus resistance Visna virus envelope visna LTR-env Microinjection Sheep Clements et al. 1994
Ovine prion locus Prion protein (PrP) targeting vector Somatic cloning Sheep Denning et al. 2001
(homol. recomb.) (animals dead
shortly after birth)
Milk fat composition Stearoyl desaturase β-lactogl-SCD Microinjection Goat Reh et al. 2004
Milk composition (increase of β-casein κ-casein genomic CSN2 Somatic cloning Cattle Brophy et al. 2003
whey proteins) CSN-CSN-3
Milk composition (increase of human lactoferrin α-s2cas-mLF Microinjection Cattle Platenburg et al. 1994
lactoferrin)
Staph. aureus mastitis resistance Lysostaphin ovine β-lactogl- Somatic cloning Cattle Wall et al. 2005
lysostaphin
rendering the animals mastitis-resistant (Wall et al. 2005). The
advent to detailed genomic maps and appropriate tools for the
genetic engineering of livestock species will accelerate and
enhance transgenic animal production for specific production
purposes.
Transgenic pets
As can be seen above, transgenic approaches have focussed on
livestock species either for biomedical or agricultural purposes.
Recent applications of transgenic technology relate to the development
of new varieties of ornamental fish. Transgenic medaka
(Oryzias latipes, rice fish) with a fluorescent green colour were
described in 2001 (Chou et al. 2001) and subsequently approved
for sale in Taiwan. The fluorescent medaka is currently marketed
by the Taiwanese company Taikong (www.azoo.com.tw).
GloFish is a trademarked transgenic zebra fish (Danio rerio)
expressing a red fluorescent protein from a sea anemone under
the transcriptional control of a muscle-specific promoter (Gong
et al. 2003). In addition, green and yellow fluorescent proteins
have been introduced into stable transgenic lines, resulting
in fishes with different flurorescence (Fig. 2). Yorktown Technologies
(www.glofish.com) started commercial sales of the
transgenic zebrafish in the USA at retail prices of approximately
US$5.00. Thus, GloFish has become the first transgenic animal
readily available in the USA.A recent report of the FDA revealed
no evidence that Glofish represent a risk (US FDA 2003). Commercialisation
of fluorescent fish has gone forward in several
countries other than the USA, such as Taiwan, Malaysia, and
Hong Kong, whereas marketing in Australia, Canada and the
European Union is prohibited.
Transgenic application in other pet species, such as dog or cat,
is hypothetical at present, but may become more widespread
when more efficient gene transfer technologies are developed
and specific genetic traits can be targeted. Some of the emerging
technologies relevant in this context are described below.
Emerging technologies
Lentiviral transgenesis
Lentiviruses have been shown to be efficient vectors for the delivery
of genes into oocytes and zygotes. Injection of lentiviruses
into the perivitelline space of porcine zygotes resulted in a high
proportion of transgenic offspring, from which expressing transgenic
lines could be established (Hofmann et al. 2003; Whitelaw
et al. 2004). The production of transgenic cattle via lentiviral
vectors required the injection into the perivitelline space of
oocytes (Hofmann et al. 2004). Lentiviral gene transfer in livestock
is compatible with unprecedented high rates of transgenic
animals. Whether multiple integration of lentiviral vectors into
the host genome is associated with unwanted side effects, such
as oncogene activation or insertional mutagenesis, remains to be
investigated. However, the silencing of lentiviral sequences in
transgenic lines (Hofmann et al. 2006) and the high frequency
of mosaicism in founder animals requires further research.
Conditional transgenesis in farm animals
Recently, we reported the first tetracycline-controlled transgene
expression in a farm animal (Kues et al. 2006). An autoregulative
tetracycline-responsive bicistronic expression cassette
(NTA) was introduced into the pig genome via pronuclear DNA
injection (Fig. 3a). The NTA cassette was designed to give

766 Reproduction, Fertility and Development H. Niemann and W. A. Kues
Fig. 2. Transgenic zebrafishes expressing different fluorescent proteins. The image was taken under natural white
light (reproduced with permission from www.glofish.com). Owing to high expression of the fluorescent proteins
the fishes appear brightly coloured.
ubiquitous expression of human RCAs independent of cellular
transcription cofactors. Expression from this construct could be
inhibited reversibly by feeding the animals doxycycline (tet-off
system). In 10 transgenic pig lines carrying one NTA cassette,
the transgene was silenced in all tissues with the exception of
skeletal muscle, where the transgene was expressed in discrete
muscle fibres (Niemann and Kues 2003). Interestingly, crossbreeding
to produce animals with two NTA cassettes resulted in
reactivation of the silenced NTA cassettes and a strong and broad
tissue-independent, tetracycline-sensitive RCA expression pattern
(Fig. 3b). The extent of reactivation in the double transgenic
pigs correlated inversely with the methylation status of the NTA
cassettes, and probably reflected effects of the different integration
sites. This shows that selective crossbreeding of transgenic
pig lines can overcome epigenetic silencing.This approach highlights
the importance to study epigenetic (trans)-gene regulation
in the pig (Fig. 3c).
Artificial chromosomes as transgene vectors
Artificial chromosomes have the potential to carry very large
pieces of DNA that are maintained as episomal entities (Niemann
and Kues 2003). A human artificial chromosome (HAC) containing
the entire sequences of the human immunoglobulin
heavy and light chain loci has been introduced into bovine
fibroblasts, which were then used in nuclear transfer. Transchromosomal
bovine offspring were obtained that expressed
human immunoglobulin in their blood. This system could be
a significant step forward in the production of human therapeutic
polyclonal antibodies (Kuroiwa et al. 2002). Follow-up
studies showed that the HAC was maintained in most animals
over several years in the first generation cattle (Robl et al. 2007).
Whether HACs separate correctly during meiotic cell divisions
remains to be shown.
Spermatogonial transgenesis
Transplantation of primordial germ cells into the testes is
an alternative approach to generate transgenic animals. Initial
experiments in mice showed that the depletion of endogenous
spermatogenonial stem cells by treatment with the chemical
busulfan before transplantation is effective and compatible with
re-colonisation by donor cells. Transmission of the donor haplotype
to the next generation after germ-cell transplantation has
been achieved in goats (Honaramooz et al. 2003). Current major
obstacles of this strategy are the lack of efficient in vitro culture
methods for primordial germ/prospermatogonial cells and the
lack of efficient gene transfer techniques into these cells.
RNA interference mediated gene knock down
RNA interference is a conserved post-transcriptional gene
regulatory process in most biological systems, including
fungi, plants and animals. The common mechanistic elements
are double stranded small interfering RNAs (siRNA) with
19–23 nucleotides, which specifically bind to complementary
sequences of their target mRNAs. The target mRNAs are then
degraded by endonuclease activity and no protein is translated
(Plasterk 2002). RNA interference is involved in gene regulation
and specifically to control/suppress the translation of mRNAs
from endogenous and exogenous viral elements and can be used
for therapeutic purposes (Dallas and Vlassow 2006).
For a transient gene knock down, synthetic siRNAs are transfected
in cells or early embryos (Clark and Whitelaw 2003; Iqbal
et al. 2007). For stable gene repression the siRNA sequences
must be incorporated into a gene construct. The combination of
siRNA with the lentiviral vector technology is a highly effective
tool in this respect. RNAi knockdown of PERV has been
shown in porcine primary cells (Dieckhoff et al. 2007), as
well as the knockdown of the prion protein gene (PRNP) in

Transgenic farm animals: an update Reproduction, Fertility and Development 767
(a)
(b)
(c)
Genotype
L13
L15
2.3 kb
Closed
(heterochromatin)
Open
(euchromatin)
RCA
Transactivator
ptTA RCA IRES tTA pA
Inactivated by
exogenous
tetracycline
(AAA) n
1 2 3 4 5 6 7 8 9
DNA demethylation
Histone acetylation
Transcription
DNA methylation
Histone deacetylation
Fig. 3. Conditional expression of transgenes in pigs and epigenetic regulation.
(a) Design of an autoregulative cassette, encoding a regulator of
complement activation (RCA) and a tetracycline sensitive transactivator
(tTA), separated by an internal ribosomal entry sequence (IRES). Basal
expression of the construct results in the translation of tTA and subsequently
in autoregulative up-regulation, by binding of tTA to the promoter (ptTA).
Exogenous tetracycline binds and inactivates the transactivator (tet-off),
resulting in down-regulation of transcription. (b) Reactivation of silenced
transgenes by line crossbreeding. Animals of lines 13 and 15, which are
hemizygous carriers for one autoregulative cassette, were crossbred to obtain
double transgenic offspring. Specific detection of RCA mRNA levels by
Northern blotting of muscle biopsies from nine siblings. Animals that carried
one cassette, either from line 13 (L13) or line 15 (L15), expressed low
levels of the transgene (lane 1, 3, 4, 6 and 9); these low expression levels
were also found in the parent animals. Siblings that carried both cassette
(lane 2, 5, 7 and 8) showed 50–100 times higher transcript levels. (c) Epigenetic
regulation of gene expression. Simplified diagram showing that DNA
regions may switch between a closed and an open confirmation. Epigenetic
modification of the DNA by methylation of CG-dinucleotids and of the histones
by acetylation contribute to these changes and may fix the DNA in
one mode. In the open confirmation (euchromatin) the DNA is accessible
to DNA binding protein, like transcription factors and RNA polymerase II,
and transcription can be activated. In the closed mode (heterochromatin) a
gene locus is silenced.
cattle embryos (Golding et al. 2006). Germline transmission of
lentiviral siRNA has been shown in rats over three generations
(Tenenhaus Dann et al. 2006). In contrast to knock out technologies,
which require time consuming breeding strategies, RNAi
can easily be integrated into existing breeding lines.
Health and welfare of transgenic farm animals
Owing to integration and expression of transgenes, insertional
mutagenesis and unwanted pathological side effects cannot be
ruled out and concerns have been raised about the health of
transgenic farm animals (Van Reenen et al. 2001). Transgenic
farm animals have been produced since 1985 by pronuclear
DNA injection, but only few systematic studies investigated
the health status in cohorts of these animals. Overexpression
of human growth hormone in pigs and sheep was associated
with specific pathological phenotypes, which could be avoided
by advanced constructs (Nottle et al. 1999). In pigs transgenic
for human decay accelerating factor (hDAF), maintained
at qualified pathogen free conditions, the haematology and
blood chemistry were normal compared with transgenic animals
(Tucker et al. 2002). With the exception of a slightly exceeded
growth rate, no abnormalities were found. A detailed pathomorphological
examination of nine lines of hemizygous pigs
expressing human RCAs revealed no adverse effects correlating
with transgene expression (Deppenmeier et al. 2006), providing
clear evidence that transgenesis per se does not compromise
animal health and welfare. Several of the investigated animals
carried a bicistronic expression cassette, driving hCD59 and the
tetracycline transactivator (Kues et al. 2006), suggesting that
multi-transgenic animals are compatible with a normal health
status. The hemizygous lines were fertile and produced normal
litter sizes. However, attempts to breed these lines to homozygosity
resulted in very small litter sizes in the first generation,
likely reflecting inbreeding depression. In mice, several inbreeding
rounds are necessary for extinction of a specific line (Taft
et al. 2006).
Cloning of mammals by somatic nuclear transfer is still
tainted by low success rate of live offspring, typically with a
range of 1–5% of transferred embryos surviving to term (Kues
and Niemann 2004). Recently, we have obtained significant
improvement of porcine cloning success by better selection and
optimised treatment of the recipients, specifically by providing a
24-h asynchrony between the pre-ovulatory oviducts of the recipients
and the reconstructed embryos. Presumably, this gave the
embryos additional time to achieve the necessary level of nuclear
reprogramming. A second major improvement was a switch to
peripubertal recipients synchronised with Altrenogest feeding
over 15 days (Regumate, Cilag-Janssen, Neuss, Germany, 20 mg
per animal per day) rather than using the first oestrus of prepubertal
gilts (Walker et al. 2002). This resulted in pregnancy rates of
∼80% and only slightly reduced litter size (Petersen et al. 2007).
High embryonic and fetal attrition rates of cloned animals are
specifically observed in ruminants that seem to be particularly
susceptible to epigenetic aberrations. Cardiopulmonary and placental
lesions and lesions in the skeletal and muscle system have
been observed in cloned cattle (Hill et al. 1999). The observed
adverse effects seem to be related to the cloning procedure

768 Reproduction, Fertility and Development H. Niemann and W. A. Kues
per se and not primarily to transgenic modification, as similar
adverse effects are also seen in cloned cattle without genetic
modification (Panarace et al. 2006). In contrast, transgenic
cloned pigs that survived the neonatal period are apparently normal
in all haematologial and biochemical parameters (Carter
et al. 2002).
Studies with sufficient numbers of transgenic farm animals
produced by emerging technologies, such as lentiviral and spermatogonial
transgenesis, or expressing new constructs, like HAC
and siRNA, will be necessary to assess the safety of these
transgenic approaches.
Outlook
Recent advances in genomic technologies in farm animals
present not only a major opportunity to address significant
limitations in agricultural production, but also offer exciting
prospects for medical research, significantly extending the
important role of animals as models of human health and disease
(Niemann et al. 2007). Developments in animal genomics
have broadly followed the route that the human genome field
has led, both in terms of completeness of data and in developing
tools and applications as demonstrated by the recent availability
of advanced drafts of the maps of the bovine, chicken, dog and
bee genomes. The possibility of extending knowledge through
deliberately engineering change in the genome is unique to animals
and is currently being developed through the integration
of advanced molecular tools and breeding technologies. However,
the full realisation of this exciting potential is handicapped
by gaps in our understanding of embryo genomics and the epigenetic
changes that are critical in the production of healthy
offspring.
The convergence of the recent advances in reproductive
technologies with the tools of molecular biology opens a new
dimension for animal breeding. Major prerequisites are the continuous
refinement of reproductive biotechnologies and a rapid
completion and refinement of livestock genomic maps. Embryonic
stem cells (ES-cells) play a critical role in this context.
Despite numerous efforts, no ES-cells with germ line contribution
have been established from mammals other than the mouse.
ES-like cells, i.e. cells that share several parameters with true EScells,
have been reported in several species. The time period over
which these cells could be maintained in culture varied from 13
weeks to 3 years (Gjørret and Maddox-Hyttel 2005; Yadav et al.
2005). Derivation of true ES cells in farm animals will permit
exploitation of the full power of recombinant DNA technology
in animal breeding and will thus be critical to develop sustainable
and diversified animal production systems. We anticipate
genetically modified animals will soon play a significant role in
the biomedical field. Agricultural application might be further
down the track given the complexity of some of the economically
important traits.
Acknowledgements
The financial support by a grant from the DFG (FOR 535) is gratefully
acknowledged. This review contains in parts data from Niemann, H., Kues,
W. A., and Carnwath, J. W. (2005). Transgenic farm animals: present and
future. Rev. Sci. Tech. OIE 24, 285–298.
References
Bach, F. H. (1998). Xenotransplantation: problems and prospects.Annu. Rev.
Med. 49, 301–310. doi:10.1146/ANNUREV.MED.49.1.301
Baguisi, A., Behboodi, E., Melican, D., Pollock, J. S., Destrempes, M. M.,
et al. (1999). Production of goats by somatic cell nuclear transfer.
Nat. Biotechnol. 17, 456–461. doi:10.1038/8632
Brophy, B., Smolenski, G.,Wheeler,T.,Wells, D., L’Huillier, P., and Laible, G.
(2003). Cloned transgenic cattle produce milk with higher levels of bcasein
and k-casein. Nat. Biotechnol. 21, 157–162. doi:10.1038/
NBT783
Carter, B. D., Lai, L., Park, K.-W., Samuel, M., Lattimer, J. C., Jordan, K. R.,
Estes, D. M., Besch-Williford, C., and Prather, R. (2002). Phenotyping
of transgenic cloned pigs. Cloning Stem Cells 4, 131–145.
doi:10.1089/153623002320253319
Chan, A. W., Homan, E. J., Ballou, L. U., Burns, J. C., and Bremel, R. D.
(1998). Transgenic cattle produced by reverse-transcribed gene transfer
in oocytes. Proc. Natl. Acad. Sci. USA 95, 14028–14033.
doi:10.1073/PNAS.95.24.14028
Chang, K., Qian, J., Jiang, M., Liu, Y. H., Wu, M. C., et al.
(2002). Effective generation of transgenic pigs and mice by
linker based sperm-mediated gene transfer. BMC Biotechnol. 2,
5. http://www.biomedcentral.com/1472-6750/2/5. doi:10.1186/1472-
6750-2-5
Cibelli, J. B., Stice, S. L., Golueke, P. L., Kane, J. J., Jerry, J., Blackwell, C.,
Ponce de Leon, F. A., and Robl, J. M. (1998). Transgenic bovine
chimeric offspring produced from somatic cell-derived stem like cells.
Nat. Biotechnol. 16, 642–646. doi:10.1038/NBT0798-642
Chou, C. Y., Horng, L. S., and Tsai, H. J. (2001). Uniform GFP-expression
in transgenic medaka (Oryzias latipes) at the F0 generation. Transgenic
Res. 10, 303–315. doi:10.1023/A:1016671513425
Clark, J., and Whitelaw, B. (2003). A future for transgenic livestock. Nat.
Rev. Genet. 4, 825–833. doi:10.1038/NRG1183
Clements, J. E., Wall, R. J., Narayan, O., Hauer, D., Schoborg, R., Sheffer, D.,
Powell, A., Carruth, L. M., Zink, M. C., and Rexroad, C. E. (1994).
Development of transgenic sheep that express the visna virus envelope
gene. Virology 200, 370–380. doi:10.1006/VIRO.1994.1201
Cozzi, E., and White, D. J. G. (1995). The generation of transgenic
pigs as potential organ donors for humans. Nat. Med. 1, 964–966.
doi:10.1038/NM0995-964
Dai, Y., Vaught, T. D., Boone, J., Chen, S. H., Phelps, C. J., et al. (2002).
Targeted disruption of the alpha1,3-galactosyltransferase gene in cloned
pigs. Nat. Biotechnol. 20, 251–255. doi:10.1038/NBT0302-251
Dallas, A., and Vlassow, A. (2006). RNAi: A novel antisense technology and
its therapeutic potential. Med. Sci. Monit. 12, RA67–RA74.
Damak, S., Jay, N. P., Barrell, G. K., and Bullock, D. W. (1996a). Targeting
gene expression to the wool follicle in transgenic sheep. Biotechnology
(N. Y.) 14, 181–184. doi:10.1038/NBT0296-181
Damak, S., Su, H., Jay, N. P., and Bullock, D. W. (1996b). Improved wool
production in transgenic sheep expressing insulin-like growth factor 1.
Biotechnology (N. Y.) 14, 185–188. doi:10.1038/NBT0296-185
Denning, C., Burl, S., Ainslie, A., Bracken, J., Dinnyes, A., et al. (2001).
Deletion of the alpha(1,3)galactosyl transferase (GGTA1) gene and
the prion protein (PrP) gene in sheep. Nat. Biotechnol. 19, 559–562.
doi:10.1038/89313
Deppenmeier, S., Bock, O., Mengel, M., Niemann, H., Kues, W., Lemme, E.,
Wirth, D.,Wonigeit, K., and Kreipe, H. (2006). Health status of transgenic
pig lines expressing human complement regulator protein CD59. Xenotransplantation
13, 345–356. doi:10.1111/J.1399-3089.2006.00317.X
Dieckhoff, B., Karlas, A., Hofmann, A., Kues, W. A., Petersen, B.,
Pfeifer, A., Niemann, H., Kurth, R., and Denner, J. (2007). Inhibition
of porcine endogenous retroviruses (PERVs) in primary porcine cells
by RNA interference using lentiviral vectors. Arch. Virol. 152, 629–634.
doi:10.1007/S00705-006-0868-Y

Transgenic farm animals: an update Reproduction, Fertility and Development 769
Echelard, Y., Ziomek, C., and Meade, H. (2006). Production of recombinant
therapeutic proteins in the milk of transgenic animals. BioPharm Intern.
2 (August 2006). http://www.biopharminternational.com/biopharm/
content. pp. 1–7.
Gandolfi, F. (1998). Spermatozoa, DNA binding and transgenic animals.
Transgenic Res. 7, 147–155. doi:10.1023/A:1008828627735
Gjørret, J. O., and Maddox-Hyttel, P. (2005). Attempts towards derivation
and establishment of bovine embryonic stem cell-like cultures. Reprod.
Fertil. Dev. 17, 113–124. doi:10.1071/RD04117
Golding, M. C., Long, C. R., Carmell, M. A., Hannon, G. J., and
Westhusin, M. E. (2006). Suppression of prion protein in livestock
by RNA interference. Proc. Natl. Acad. Sci. USA 103, 5285–5290.
doi:10.1073/PNAS.0600813103
Golovan, S. P., Meidinger, R. G.,Ajakaiye,A., Cottrill, M.,Wiederkehr, M. Z.,
et al. (2001). Pigs expressing salivary phytase produce low-phosphorus
manure. Nat. Biotechnol. 19, 741–745. doi:10.1038/90788
Gong, W., Wan, H., Tay, T. L., Wang, H., Chen, M., andYan, T. (2003). Development
of transgenic fish for ornamental and bioreactor by strong expression
of fluorescent proteins in the skeletal muscle. Biochem. Biophys.
Res. Commun. 308, 58–63. doi:10.1016/S0006-291X(03)01282-8
Grosse-Hovest, L., Muller, S., Minoia, R., Wolf, E., Zakhartchenko, V., et al.
(2004). Cloned transgenic farm animals produce a bispecific antibody
for T cell-mediated tumor cell killing. Proc. Natl. Acad. Sci. USA 101,
6858–6863. doi:10.1073/PNAS.0308487101
Hammer, R. E., Pursel, V. G., Rexroad, C. E., Jr, Wall, R. J., Bolt, D. J.,
Ebert, K. M., Palmiter, R. D., and Brinster, R. L. (1985). Production
of transgenic rabbits, sheep and pigs by microinjection. Nature 315,
680–683. doi:10.1038/315680A0
Haskell, R. E., and Bowen, R. A. (1995). Efficient production of transgenic
cattle by retroviral infection of early embryos. Mol. Reprod. Dev. 40,
386–390. doi:10.1002/MRD.1080400316
Hill, J. R., Roussel, A. J., Cibelli, J. B., Edwards, J. F., Hooper, N. L.,
et al. (1999). Clinical and pathologic features of cloned transgenic
calves and fetuses (13 case study). Theriogenology 51, 1451–1465.
doi:10.1016/S0093-691X(99)00089-8
Hofmann, A., Kessler, B., Ewerling, S., Weppert, M., Vogg, B., et al. (2003).
Efficient transgenesis in farm animals by lentiviral vectors. EMBO Rep.
4, 1054–1060. doi:10.1038/SJ.EMBOR.7400007
Hofmann, A., Zakhartchenko, V., Weppert, M., Sebald, H., Wenigerkind, H.,
Brem, G., Wolf, E., and Pfeifer, A. (2004). Generation of transgenic
cattle by lentiviral gene transfer into oocytes. Biol. Reprod. 71, 405–409.
doi:10.1095/BIOLREPROD.104.028472
Hofmann, A., Kessler, B., Ewerling, S., Kabermann, A., Brem, G.,
Wolf, E., and Pfeifer, A. (2006). Epigenetic regulation of lentiviral
transgene vectors in a large animal model. Mol. Ther. 13, 59–66.
doi:10.1016/J.YMTHE.2005.07.685
Honaramooz, A., Behboodi, E., Megee, S. O., Overton, S. A.,
Galantino-Homer, H., Echelard, Y., and Dobrinski, I. (2003). Fertility
and germline transmission of donor haplotype following germ cell
transplantation in immunocompetent goats. Biol. Reprod. 69, 1260–
1264. doi:10.1095/BIOLREPROD.103.018788
Ibrahim, Z., Busch, J., Awwad, M., Wagner, R., Wells, K., and
Cooper, D. K. C. (2006). Selected physiologic compatibilities and
incompatibilities between human and porcine organ systems. Xenotransplantation
13, 488–499. doi:10.1111/J.1399-3089.2006.00346.X
Iqbal, K., Kues, W., and Niemann, H. (2007). Parent-of-origin dependent
gene specific knockdown in mouse embryos. Bioph. Bioch. Res. Com.
358, 727–732. doi:10.1016/JBBRC.2007.04.155
Irgang, M., Sauer, I. M., Karlas, A., Zeilinger, K., Gerlach, J., Kurth, R.,
Neuhaus, P., and Denner, J. (2003). Porcine endogenous retroviruses: no
infection in patients treated with a bioreactor based on porcine liver cells.
J. Clin. Virol. 28, 141–154. doi:10.1016/S1386-6532(02)00275-5
Kues, W. A., and Niemann, H. (2004). The contribution of farm animals to
human health.Trends Biotechnol. 22, 286–294. doi:10.1016/J.TIBTECH.
2004.04.003
Kues, W. A., Schwinzer, R., Wirth, D., Verhoeyen, E., Lemme, E.,
Herrmann, D., Barg-Kues, B., Hauser, H., Wonigeit, H., and Niemann, H.
(2006). Epigenetic silencing and tissue independent expression of a novel
tetracycline inducible system in double-transgenic pigs. FASEB J. 20,
E1–E10. doi:10.1096/FJ.05-5415FJE
Kuroiwa, Y., Kasinathan, P., Choi, Y. J., Naeem, R., Tomizuka, K.,
et al. (2002). Cloned transchromosomic calves producing human
immunoglobulin. Nat. Biotechnol. 20, 889–894. doi:10.1038/
NBT727
Kuwaki, K., Tseng, Y. L., Dor, F. J., Shimizu, A., House, S. L., et al.
(2005). Heart transplantation in baboons usion α1,3-glactosyltransferase
knock out pigs as donors: initial experiments. Nat. Med. 11, 29–31.
doi:10.1038/NM1171
Lai, L., Kolber-Simonds, D., Park, K. W., Cheong, H. T., Greenstein, J. L.,
et al. (2002). Production of alpha-1,3-galactosyltransferase knockout
pigs by nuclear transfer cloning. Science 295, 1089–1092.
doi:10.1126/SCIENCE.1068228
Lai, L., Kang, J. X., Li, R., Wang, J., Witt, W. T., et al. (2006). Generation of
cloned transgenic pigs rich in omega-3 fatty acids. Nat. Biotechnol. 24,
435–436. doi:10.1038/NBT1198
Lavitrano, M., Bacci, M. L., Forni, M., Lazzereschi, D., Di Stefano, C.,
et al. (2002). Efficient production by sperm-mediated gene transfer
of human decay accelerating factor (hDAF) transgenic pigs for
xenotransplantation. Proc. Natl. Acad. Sci. USA 99, 14230–14235.
doi:10.1073/PNAS.222550299
Lo, D., Pursel, V., Linton, P. J., Sandgren, E., Behringer, R., Rexroad, C.,
Palmiter, R. D., and Brinster, R. L. (1991). Expression of mouse IgA
by transgenic mice, pigs and sheep. Eur. J. Immunol. 21, 1001–1006.
doi:10.1002/EJI.1830210421
Manzini, S., Vargiolu, A., Stehle, I. M., Bacci, M. L., Cerrito, M. G.,
et al. (2006). Genetically modified pigs produced with a nonviral
episomal vector. Proc. Natl. Acad. Sci. USA 103, 17672–17677.
doi:10.1073/PNAS.0604938103
McCreath, K. J., Howcroft, J., Campbell, K. H., Colman, A., Schnieke, A. E.,
and Kind, A. J. (2000). Production of gene-targeted sheep by
nuclear transfer from cultured somatic cells. Nature 405, 1066–1069.
doi:10.1038/35016604
Meade, H. M., Echelard, Y., Ziomek, C. A., Young, M. W., Harvey, M.,
Cloe, E. S., Groet, S., Smith, T. E., and Curling, J. M. (1999). Expression
of recombinant proteins in the milk of transgenic animals. In ‘Gene
Expression Systems. Using Nature for the Art of Expression’. (Eds
J. M. Fernandez and J. P. Hoeffler.) pp. 399–427. (Academic Press: San
Diego, CA.)
Müller, M., Brenig, B., Winnacker, E. L., and Brem, G. (1992). Transgenic
pigs carrying cDNA copies encoding the murine Mx1 protein which
confers resistance to influenza virus infection. Gene 121, 263–270.
doi:10.1016/0378-1119(92)90130-H
Niemann, H. (2004). Transgenic pigs expressing plant genes. Proc. Natl.
Acad. Sci. USA 101, 7211–7212. doi:10.1073/PNAS.0402011101
Niemann, H., and Kues, W. A. (2003). Application of transgenesis on livestock
for agriculture and biomedicine. Anim. Reprod. Sci. 79, 291–317.
doi:10.1016/S0378-4320(03)00169-6
Niemann, H., Kues, W. A., and Carnwath, J. W. (2005). Transgenic farm
animals: present and future. OIE-Report: Biotechnology applications
in animal health and production, Revue scientifique et technique 24,
285–291.
Niemann, H., Carnwath, J. W., and Kues, W. (2007). Application of
array technology to mammalian embryos. Theriogenology, in press.
doi:10.1016/J.THERIOGENOLOGY.2007.05.041

770 Reproduction, Fertility and Development H. Niemann and W. A. Kues
Nottle, M. B., Nagashima, H., Verma, P. J., Du, Z. T., Grupen, C. G.,
et al. (1999). Production and analysis of transgenic pigs containing
a metallothionein porcine growth hormon gene construct. In ‘Transgenic
Animals in Agriculture’. (Eds J. D. Murray, G. B. Anderson,
A. M. Oberbauer and M. M. McGloughlin.) pp. 145–156. (CABI
Publishing: New York.)
Panarace, M., Agüero, J. I., Garrote, M., Jauregui, G., Segovia, A.,
et al. (2006). How healthy are clones and their progeny: 5
years of field experience. Theriogenology 67, 142–151. doi:10.1016/
J.THERIOGENOLOGY.2006.09.036
Perry, A. C. F., Wakayama, T., Kishikawa, H., Kasai, T., Okabe, M.,
Toyoda, Y., and Yanagimachi, R. (1999). Mammalian transgenesis
by intracytoplasmic sperm injection. Science 284, 1180–1183.
doi:10.1126/SCIENCE.284.5417.1180
Petersen, B., Kues, W. A., Lucas-Hahn, A., Queisser, A. L., Lemme, E.,
Hoelker, M., Carnwath, J. W., and Niemann, H. (2006). Generation
of pigs transgenic for hCD59/DAF and human thrombomodulin by
somatic nuclear transfer. Reprod. Fertil. Dev. 18, 142. doi:10.1071/
RDV18N2AB67
Petersen, B., Lucas-Hahn, A., Lemme, E., Hornen, N., Hassel, P., and
Niemann, H. (2007). Preovulatory embryo transfer increases cloning
efficiencies in pigs. Reprod. Fertil. Dev. 19, 155–156. [Abstract]
Phelps, C. J., Koike, C., Vaught, T. D., Boone, J., Wells, K. D., et al. (2003).
Production of alpha 1,3-galactosyltransferase deficient pigs. Science
299, 411–414. doi:10.1126/SCIENCE.1078942
Plasterk, R. H. (2002). RNA silencing: the genomes immune system. Science
296, 1263–1265. doi:10.1126/SCIENCE.1072148
Platenburg, G. J., Kootwijk, E. P., Kooiman, P. M., Woloshuk, S. L.,
Nuijens, J. H., Krimpenfort, P. J., Pieper, F. R., de Boer, H. A., and Strijker,
R. (1994). Expression of human lactoferrin in milk of transgenic
mice. Transgenic Res. 3, 99–108. doi:10.1007/BF01974087
Platt, J. L., and Lin, S. S. (1998). The future promises of xenotransplantation.
Ann. N. Y. Acad. Sci. 862, 5–18. doi:10.1111/J.1749-
6632.1998.TB09112.X
Pursel, V. G., Wall, R. J., Mitchell, A. D., Elsasser, T. H., Solomon, M. B.,
Coleman, M. E., Mayo, F., and Schwartz, R. J. (1999). Expression of
insulin-like growth factor-1 in skeletal muscle of transgenic pigs. In
‘Transgenic Animals in Agriculture’. (Eds J. D. Murray, G. B. Anderson,
A. M. Oberbauer and M. M. McGloughlin.) pp. 131–144. (CABI
Publishing: New York.)
Reh, W. A., Maga, E. A., Collette, N. M., Moyer, A., Conrad-Brink, J. S.,
Taylor, S. J., DePeters, E. J., Oppenheim, S., Rowe, J. D.,
BonDurant, R. H., Anderson, G. B., and Murray, J. D. (2004). Hot
topic: using a stearoyl-CoA desaturase transgene to alter milk fatty acid
composition. J. Dairy Sci. 87, 3510–3514.
Robl, J. M., Wang, Z., Kasinathan, P., and Kuroiwa, Y. (2007). Transgenic
animal production and animal biotechnology. Theriogenology 67, 127–
133. doi:10.1016/J.THERIOGENOLOGY.2006.09.034
Rudolph, N. S. (1999). Biopharmaceutical production in transgenic
livestock. Trends Biotechnol. 17, 367–374. doi:10.1016/S0167-
7799(99)01341-4
Saeki, K., Matsumoto, K., Kinoshita, M., Suzuki, I.,Tasaka,Y., et al., (2004).
Functional expression of a Delta12 fatty acid desaturase gene from
spinach in transgenic pigs. Proc. Natl. Acad. Sci. USA 101, 6361–6366.
doi:10.1073/PNAS.0308111101
Schnieke, A. E., Kind, A. J., Ritchie, W. A., Mycock, K., Scott, A. R.,
Ritchie, M., Wilmut, I., Colman, A., and Campbell, K. H. (1997).
Human factor IX transgenic sheep produced by transfer of nuclei
from transfected fetal fibroblasts. Science 278, 2130–2133. doi:
10.1126/SCIENCE.278.5346.2130
Squires, E. J. (1999). Status of sperm-mediated delivery methods for gene
transfer. In ‘Transgenic Animals in Agriculture’. (Eds J. D. Murray,
http://www.publish.csiro.au/journals/rfd
G. B. Anderson, A. M. Oberbauer and M. M. McGloughlin.) pp. 87–96.
(CABI Publishing: New York.)
Switzer, W. M., Michler, R. E., Shangmugam, V., Matthews, A.,
Hussain, A. I., et al. (2001). Lack of cross-species transmission of
porcine endogenous retrovirus infection to nonhuman primate recipients
of porcine cells, tissues and organs. Transplantation 71, 959–965.
doi:10.1097/00007890-200104150-00022
Taft, R. A., Davisson, M., and Wiles, M. V. (2006). Know thy mouse. Trends
Genet. 22, 649–653. doi:10.1016/J.TIG.2006.09.010
Tenenhaus Dann, C., Alvarado, A. L., Hammer, R. E., and Garbers, D. L.
(2006). Heritable and stable gene knockdown in rats. Proc. Natl. Acad.
Sci. USA 103, 11246–11251. doi:10.1073/PNAS.0604657103
Tucker, A., Belcher, C., Moloo, B., Bell, J., Mazzulli, T., Humar, Y.,
Hughes, A., McArdle, P., and Talbot, A. (2002). The production of
transgenic pigs for potential use in clinical xenotransplantation: baseline
clinical pathology and organ size studies. Xenotransplantation 9,
203–208. doi:10.1034/J.1399-3089.2002.01052.X
USA Food and Drug Administration (2003). FDA statement regarding
glofish. http://www.fda.gov/bbs/topics/NEWS/2003/NEW00994.html
[verified May 2007].
Van den Hout, J. M., Reuser, A. J., de Klerk, J. B., Arts, W. F., Smeitink, J. A.,
and Van der Ploeg, A. T. (2001). Enzyme therapy for Pompe disease with
recombinant human α-glucosidase from rabbit milk. J. Inherit. Metab.
Dis. 24, 266–274. doi:10.1023/A:1010383421286
Van Reenen, C. G., Meuwissen, T. H. E., Hopster, H., Oldenbroek, K.,
Kruip, T. H., and Blokhuis, H. J. (2001). Transgenesis may affect farm
animal welfare: a case for systemic risk assessment. J. Anim. Sci. 79,
1763–1769.
Walker, S. C., Shin, T., Zaunbrecher, G. M., Romario, J. E., Johnson, G. A.,
Bazer, F. W., and Piedrahita, J. A. (2002). A highly efficient method
for porcine cloning by nuclear transfer using in vitro matured oocytes.
Cloning Stem Cells 4, 105–112.
Wall, R. J., Powell, A., Paape, M. J., Kerr, D. E., Bannermann,
D. D., Pursel, V. G., Wells, K. D., Talbot, N., and Hawk,
H. (2005). Genetically enhanced cows resist intramammary Staphylococcus
aureus infection. Nat. Biotechnol. 23, 445–451. doi:10.1038/
NBT1078
Willadsen, S. M. (1986). Nuclear transplantation in sheep embryos. Nature
320, 63–65. doi:10.1038/320063A0
Wilmut, I., Schnieke, A. E., McWhir, J., Kind, A. J., and Campbell, K. H.
(1997). Viable offspring derived from fetal and adult mammalian cells.
Nature 385, 810–813. doi:10.1038/385810A0
Whitelaw, C. B., Radcliffe, P. A., Ritchie, W. A., Carlisle, A., Ellard, F. M.,
Pena, R. N., Rowe, J., Clark, A. J., King, T. J., and Mitrophanous, K. A.
(2004). Efficient generation of transgenic pigs using equine infectious
anaemia virus (EIAV) derived vector. FEBS Lett. 571, 233–236.
doi:10.1016/J.FEBSLET.2004.06.076
Wheeler, M. B., Bleck, G. T., and Donovan, S. M. (2001). Transgenic alteration
of sow milk to improve piglet growth and health. Reproduction
58(Suppl.), 313–324.
Yadav, P. S., Kues, W. A., Hermann, D., Carnwath, J. W., and Niemann, H.
(2005). Bovine ICM derived cells expressed the Oct4 ortholog. Mol.
Reprod. Dev. 72, 182–190.
Yamada, K., Yazawa, K., Shimizu, A., Iwanaga, T., Hisashi, Y., et al. (2005).
Marked prolongation of porcine renal xenograft survival in baboons
through the use of α1,3-galactosyltransferase gene-knockout donors and
the cotransplantation of vascularized thymic tissue. Nat. Med. 11, 32–34.
doi:10.1038/NM1172
Manuscript received 26 February 2007, accepted 16 April 2007

This article was published in an Elsevier journal. The attached copy
is furnished to the author for non-commercial research and
education use, including for instruction at the author’s institution,
sharing with colleagues and providing to institution administration.
Other uses, including reproduction and distribution, or selling or
licensing copies, or posting to personal, institutional or third party
websites are prohibited.
In most cases authors are permitted to post their version of the
article (e.g. in Word or Tex form) to their personal website or
institutional repository. Authors requiring further information
regarding Elsevier’s archiving and manuscript policies are
encouraged to visit:
http://www.elsevier.com/copyright

Abstract
Author's personal copy
Application of DNA array technology to mammalian embryos
H. Niemann *, J.W. Carnwath, W. Kues
Department of Biotechnology, Institute for Animal Breeding, Mariensee, D-31535 Neustadt, Germany
Early embryogenesis depends on a tightly choreographed succession of gene expression patterns which define normal
development. Fertilization and the first zygotic cleavage involve major changes to paternal and maternal chromatin and translation
of maternal RNAs which have been sequestered in the oocyte during oogenesis. At a critical species-specific point known as the
major onset of embryonic expression, there is a dramatic increase in expression from the new diploid genome. The advent of array
technology has, for the first time, made possible to determine the transcriptional profile of all 20,000 mammalian genes during
embryogenesis, although the small amount of mRNA in a single embryo necessitates either pooling large numbers of embryos or a
global amplification procedure to give sufficient labeled RNA for analysis. Following array hybridization, various bioinformatic
tools must be employed to determine the expression level for each gene, often based on multiple oligonucleotide probes and
complex background estimation protocols. The grouped analysis of clusters of genes which represent specific biological pathways
provides the key to understanding embryonic development, embryonic stem cell proliferation and the reprogramming of gene
expression after somatic cloning. Arrays are being developed to address specific biological questions related to embryonic
development including DNA methylation and microRNA expression. Array technology in its various facets is an important
diagnostic tool for the early detection of developmental aberrations; for improving the safety of assisted reproduction technologies
for man; and for improving the efficiency of producing cloned and/or transgenic farm animals. This review discusses current
approaches and limitations of DNA microarray technology with emphasis on bovine embryos.
# 2007 Elsevier Inc. All rights reserved.
Keywords: Preimplantation embryo; Transcriptome; RNA amplification; DNA microarray; Bioinformatics; Plasticity of gene expression;
Maternal and embryonic gene expression
1. Introduction
Sequencing and annotation of the human genome
resulted in a downward estimation of the total number
of protein-coding genes to approximately 20,000 [1].
This is much lower than previous estimates which
ranged to as many as 150,000 genes and is similar
to estimates for other vertebrates’ species including
mouse, chicken and pufferfish [2–6], or bovine and dog
* Corresponding author. Tel.: +49 5034 871 148;
fax: +49 5034 871 101.
E-mail address: niemann@tzv.fal.de (H. Niemann).
Theriogenology 68S (2007) S165–S177
0093-691X/$ – see front matter # 2007 Elsevier Inc. All rights reserved.
doi:10.1016/j.theriogenology.2007.05.041
www.theriojournal.com
(http://www.hgse.bcm.tmc.edu/projects/bovine [7,8]).
It is clear that complex organisms exploit a variety of
regulatory mechanisms to extend the functionality of
their genomes [9], including differential promoter
activation, alternative RNA splicing, RNA modification,
RNA editing, localization, translation and stability of
RNA, expression of non-coding RNA, antisense RNA
and microRNAs [10–16]. It is important to note that most
of these mechanisms work together at the RNA level to
produce the functional transcriptome of an organism.
Tissue-specific transcriptomic profiles indicate important
features of the regulatory process. During the past
decade, efficient high-throughput methods have been
developed for whole genome sequencing, transcriptome

S166
and proteome analysis [17–19]. These technologies are
crucial to improve the efficiency and safety of assisted
reproduction techniques, to facilitate the development of
novel therapies based on regenerative medicine and to
insure the quality of biotechnological products at the
molecular level.
The application of array technology to the analysis of
preimplantation mammalian embryos poses-specific
challenges associated with the picogram levels of
mRNA in a single embryo, the plasticity of the
embryonic transcriptome and the difficulties in obtaining
in vivo developing embryos in some species. Gene
expression patterns in mammalian embryos are more
complex than those in most somatic cells due to the
dramatic restructuring of the paternal chromatin, the
major onset of embryonic transcription, events related
to the cellular differentiation at the early morula stage,
blastocyst formation, expansion and hatching and
finally implantation. Embryo development is first
dependent on maternally stored transcripts which are
gradually depleted until the embryo produces its own
transcripts after a switch to the embryonic expression
program. The gene expression patterns and RNA
stability in oocytes and early embryos prior to the
Author's personal copy
H. Niemann et al. / Theriogenology 68S (2007) S165–S177
activation of embryonic expression are dramatically
different from what is seen after major onset of
embryonic transcription. The onset of embryonic gene
transcription occurs at a species-specific time point; in
mice, the major activation starts in late 1-cell embryos,
in pigs it occurs at 4-cell stage, in men at the 4- to 8-cell
stage and in bovine embryos it is delayed until the 8- to
16-cell stage [20] (Fig. 1). Due to the late onset of this
maternal-to-embryonic transition in bovine embryos,
they provide an excellent model in which to study early
reprogramming events in detail. Major epigenetic
reorganization also occurs during preimplantation
development. This includes DNA demethylation and
methylation as well as targeted modifications of histone
methylation and acetylation all of which play a role in
controlling chromatin remodeling and X chromosome
inactivation [21].
Another challenge for applying DNA arrays to
preimplantation embryos is the high degree of expression
plasticity seen in early stage embryos. Preimplantation
stages of several species can be cultured in vitro.
However, this is frequently associated with changes in
chromatin configuration and gene expression [22–24].
In vitro production of bovine embryos is usually
Fig. 1. Early reprogramming steps of maternal and embryonic transcriptomes are extended in bovine embryos (bottom) compared to mouse (upper)
and human embryos (middle panel).

necessary to provide the large numbers of embryos
needed for an array analysis in this species but it is clear
that the changes in embryonic transcription induced by
the culture method itself can affect the transcriptional
profile. With the advent of rather complete and
validated genomic maps for farm animals, DNA arrays
are increasingly being used to unravel the transcriptional
profile during preimplantation development.
Here, we discuss the current status and limitations of
DNA microarray analysis as it is applied to preimplantation
embryos with an emphasis of the bovine
embryonic transcriptome.
2. Array analysis of preimplantation embryos
2.1. Principles of array technology
The most fundamental requisite for detailed expression
array analysis is availability of sufficient genomic
sequences to produce an array. Because they require less
hybridization solution than larger array formats, microarrays
are routinely used for large scale transcriptome
analyses. They have been widely and successfully
employed for simultaneously monitoring the expression
of complete genomes, thus identifying genes that are
differentially expressed in distinct cell types, developmental
stages, disease states or in cells exposed to various
reagents [17]. High-density oligonucleotide arrays can be
used to monitor the activity of an entire genome of a
specific organism, thus defining the cellular transcriptome
in the form of a snapshot of the transcription profile
and revealing details of the dynamic changes.
Microarrays consist of hundreds to millions of
microscopically small spots attached to a matrix of
glass or plastic, each containing a short but gene specific
nucleic acid sequence, typically a synthetic oligonucleotide
or cDNA. The microarray design can be miniaturized
to few millimeters, allowing sample volumes to be
reduced to a few microliters. The biological principle of
the DNA array method is hybridization based on
complementary base pair binding of nucleic acid
molecules to their sequence matched spotted probes. A
sequence of 20 bases is sufficient to identify a gene with
certainty. To visualize differences in transcriptional
activity, a test sample of the complex nucleic acid mixture
extracted from cells or tissues is chemically tagged with a
fluorochrome or chemical conjugate and then hybridized
to the array. This results in a signal at each gene specific
spot whose intensity is due to retention of some amount of
its complementary labeled nucleic acid. The hybridization
signals are quantitatively recorded and the amount of
complementary nucleic acid at each point is calculated
Author's personal copy
H. Niemann et al. / Theriogenology 68S (2007) S165–S177 S167
with respect to local background. In some cases, this
involves averaging the results from several independent
spots all representing different locations within the target
gene. The number of genes from which expression can be
simultaneously detected, is potentially unlimited and
whole genome arrays are commercially available. In
principle, genome coverage on an array is only limited by
the density and number of spots on the array.
Array analysis depends first and foremost on the
determination of probability that a transcript is present
or absent. This is based on statistical analysis of the
strength of the signal above background often using
several probes for the gene and often using several
repeated array hybridizations. There are a variety of
different statistical methods which can be used for this
step and the choice of which to use depends on the goals
of the experiment. One must decide between having
more false positives or false negatives. The strength of
the statistical analysis is increased by the number of
repeated hybridizations but can also be increased by
grouping genes into clusters or pathways which can be
used to smooth out individual variation.
Analysis of the vast amount of data requires
sophisticated bioinformatic tools [25]. The objective
of a microarray experiment is usually to improve the
understanding of biological mechanisms. This requires
bioinformatic methods which group the detection
profiles of individual genes based on current knowledge
of signaling pathways or gene function. Several
databases, such as Gene Ontology (GO; http://www.geneontology.org)
and KEGG, the Kyoto Encyclopaedia
of Genes and Genomes, (http://www.genome.jp/kegg)
are available for this and can readily be accessed over
the internet. Further bioinformatic tools and a variety of
statistical methods have been developed to refine
reliability. It is usually necessary to repeat each array
analysis 2–3 times to achieve satisfactorily accurate
measurements. The most important criteria for evaluating
any microarray analysis are reproducibility of the
data, specificity of target gene detection, local background
and gene specific background. Certain standards
have been agreed upon and strict adherence to criteria
described as Minimal Information about a Microarray
Experiment (MIAME) is absolutely essential to
guarantee consistent and reproducible datasets for the
scientific community [26].
2.2. Technical considerations
A specific problem encountered in the array analysis
of embryonic gene expression is known as the loading
artifact. The necessity of loading a standardized amount

S168
of labeled RNA onto each array for hybridization causes
a distortion of the quantitative results because of the
large change in the amount and composition of mRNA
which occurs throughout preimplantation development
but particularly at the major onset of embryonic gene
expression. The blastocyst contains approximately
twice as much mRNA as the oocyte mainly due to
the greater number of individual mRNAs expressed in
the blastocyst. When the total amount of labeled RNA
applied to the oocyte array is the same as that applied to
the blastocyst array, the amount of probe for each
individual transcript in the blastocyst array is halved.
Blastocyst transcripts which are close to the detection
limit are lost and what appears to be a 50% reduction in
transcription between the oocyte and the blastocyst for
an individual gene may be only due to the loading
artifact. If it would be possible to establish a group of
genes whose expression levels were absolutely constant
throughout preimplantation development, one could
correct for the loading artifact. Similarly, if it would be
possible to accurately measure the total amount of
mRNA at each developmental stage, this information
could be used to correct for the loading artifact.
However, RT-PCR analysis has not yet revealed any
gene whose expression is held at a constant level over
preimplantation development, making accurate measurements
of the mRNA in embryos under various
culture conditions problematic. In interpretation of
array results, one must realize that a number of genes,
transcribed at low level in the blastocyst, are not
detected because of the loading artifact and there is a
systematic underestimation of the number of new genes
expressed during development.
One of the most commonly used methods for mRNA
purification from embryos is based on poly-dT coated
magnetic beads. These hybridize with the poly-A tail of
mRNA and pull the mRNA out of the solution. It is
important to realize that the length of the poly-A tail has
an influence on the extraction efficiency. Poly-A tail
length changes during embryonic development, especially
between the oocyte stage where mRNA is
protected and stored for later use and subsequent stages
where mRNAs are transcribed for immediate use. The
XIST gene provides an interesting biological example.
This gives transcripts of several different lengths, which
are distinguished by variations at the 3 0 end. Some of
these have a signal for polyadenylation and some do not
[27]. Thus, extraction with poly-dT coated magnetic
beads will distortion the picture of transcription from
this gene. Poly-dT extraction results in a second artifact
due to the fact that 5 0 fragments of mRNA molecules
which have no poly-A sequence will be lost while 3 0
Author's personal copy
H. Niemann et al. / Theriogenology 68S (2007) S165–S177
fragments will be retained. The probability of fragmentation
is a function of the length of the transcript.
One routine way to detect this artifact, which is a
reflection of RNA quality, is to compare spots matching
3 0 sequences of selected genes with the signals from 5 0
spots for the same genes. An array where this distortion
is noted should not be included in the analysis.
A commonly used RNA amplification method for
Affymetrix array hybridization is the ‘‘Whole Transcript
(WT) Sense Target Labeling Assay’’ (www.affymetrix.com).
The system most suitable for
preimplantation embryo analysis is the ‘‘Two-Cycle
Target Labeling and Control Reagent package’’ which
includes a protocol for target preparation from 10 to
100 ng of total RNA (see www.affymetrix.com).
One of the most difficult specimens to obtain for
embryonic expression analysis is a naturally developing
embryo. Even embryos flushed directly from the
oviduct may have altered gene expression patterns
due to the nutritional status of the donor, the use of
superovulation, exposure to flushing medium such as
PBS, exposure to non-physiological levels of oxygen
and temperature variations. There is no question that in
vitro culture affects gene expression [22–24]. For
example, RT-PCR analysis shows that the expression of
heat shock protein increases continuously during
embryonic development in vitro. The time of exposure
to non-physiological conditions between flushing and
freezing will influence relative expression data as it is
known that different transcripts have different halflives.
As a general rule, long transcripts are rare and
have shorter half-lives. Experiments with embryos must
be designed to control for such artifacts by minimizing
the time between isolation and cryopreservation and
must be interpreted with full knowledge of their
limitations.
The information which can be obtained by array
analysis can be either the timing of (detectable) gene
expression, the relative amount of individual gene
expression between matched samples, the number of
different genes detected in different samples using the
same array and complex generalizations with respect to
clustered genes and pathways. When artifacts have been
minimized, the paired sample approach is a powerful
method for analyzing expression. The number of arrays
used in a specific analysis may be limited by practical or
financial constraints but current analytical programs are
quite capable of integrating the results from hundreds of
arrays. The sensitivity of analysis can generally be
enhanced by increasing the number of arrays used in an
experiment but even when the number of arrays is
restricted, it is possible to increase the sensitivity of

analysis and the information content of the study by
performing multivariate statistical analysis of, for
example, clusters of genes related to the same
pathway. This has the advantage of averaging out
the fluctuations of weak signals. Array production is
consistent, so that the comparison of results from two
or more individual arrays is both possible and
recommended. In some systems, additional sensitivity
can be obtained by applying two differentially labeled
samples to a single array. One of the most robust
measurements is determination of the subset of
strongest expressed genes at any stage since this
avoids problems of sensitivity, RNA stability and
statistical fluctuation. The main limitation for this
form of analysis is saturation of individual spots on the
array which will affect the relative rankings of highly
expressed genes. Interpretations of biological effects
seeninarrayanalysismustbeconfirmedbyRT-PCR
verification.
2.3. Global amplification strategies
Early embryogenesis requires the well orchestrated
expression of genes to ensure normal development, and
is associated with significant physical reorganization of
the epi-genome and of the transcriptome. It is estimated
that 5000–10,000 genes are simultaneously expressed
at carefully controlled levels. Transcripts for key
transcription factors may be present in only a small
number of copies, while transcripts encoding major
structural proteins, such as MSY2/fbx2 can represent
2% of the mRNA pool [28].
Estimations of the RNA content of mammalian
oocytes range from 0.2 to 2.4 ng and blastocysts are
estimated to have roughly twice as much, 0.4–5 ng
[29,30]; approximately 10–20% of the total RNA
consists of polyadenylated mRNA. Protocols for array
hybridization typically require as much as 5–10 mg of
purified nucleic acids (www.affymetrix.com). Thus
samples with tiny amounts of RNA, such as laser
dissected biopsies or early embryos, require unbiased
global amplification prior to array analysis. The amount
of mRNA, which can be isolated from a single embryo,
needs to be amplified for 10,000 times to obtain
sufficient material for one hybridization reaction. It is
critical that this amplification does not distortion the
relative proportions of mRNA found in the original
mRNA pool.
During the past few years several methods have been
published that are compatible with efficient amplification
of RNA isolated from single cells, embryos or small pools
of embryos without distortion of the RNA pool ([30–33],
Author's personal copy
H. Niemann et al. / Theriogenology 68S (2007) S165–S177 S169
http://www.affymetrix.com/, http://www.epicentre.com,
http://www.genisphere.com). Crucial steps in these
global amplification protocols are the conversion of
mRNA into cDNA by reverse transcriptase and second
strand cDNA synthesis, followed by amplification and
labeling by in vitro transcription (IVT) using T7 RNA
polymerase. To introduce the recognition sequence for T7
RNA polymerase, synthetic oligo(dT) primers which
include a T7 recognition sequence are used for the reverse
transcription reaction. Some protocols combine the T7
RNA polymerase reaction with the polymerase chain
reaction (PCR) to achieve the necessary amplification
[30,31]. Affymetrix, one of the prominent companies in
array analysis, recommends two cycles of IVT by T7
RNA polymerase. For any protocol, a rigorous validation
of the amplification is essential to obtain meaningful
hybridization data (Fig. 2). Less amplification is
generally better as there will always be differences in
efficiency due to variations in the length and nucleotide
composition of the mRNA species. Semi-quantitative
RT-PCR or Real Time PCR assays comparing amplified
and non-amplified material with a broad panel of
transcripts are important for validation of the amplification
protocol.
2.4. The value of cross-species hybridization
The rapid improvements of cDNA-chip technologies
and the availability of multi-species sequence databases,
e.g. GO and KEGG, have made it possible to
compare gene expression profiles both within a single
organism and across a wide variety of organisms on a
large-scale. Cross-species gene-expression comparison
is a powerful tool for the discovery of evolutionarily
conserved mechanisms and pathways of expression
control. The advantage of cDNA microarrays is that
broad areas of homology are compared and hybridization
probes are sufficiently large that small inter-species
differences in nucleotide sequence do not significantly
affect the analytical results. This comparative genomic
approach allows one to evaluate a common set of genes
within a specific developmental, metabolic, or diseaserelated
gene pathway in various experimental systems.
Using microarrays in studies of mammalian species
other than man and rodents, e.g. non-human primates,
cattle, sheep and pigs, should advance our understanding
of human health and disease. This is already
evident in the field of drug target validation. The lack of
adequate sequence data [7,34] and commercial microarrays
has limited the analysis of economically and
scientifically important large domestic species such as
cattle, pigs and sheep.

S170
This is rapidly changing and cross-species hybridization
experiments based on human sequence based
arrays have been shown to be suitable for comparative
genome expression studies. For example, array analyses
have been performed using monkey, pig, mouse and
salmon RNA on human oligonucleotide arrays [35–39].
An extremely important aspect of cross-species
hybridization is data reproducibility. A poorly conceived
cross-species hybridization experiment leads to
high variability. Statistical variation can be overcome
by increasing the number of samples (biological and
technical replicates) and the arrays themselves can be
improved by careful attention to the use of conserved
(homologous) regions.
We have investigated the use of cross-species
hybridization for orthologous genes within a defined
developmental and metabolic pathway using human and
bovine fetal brain RNA as paired Cy-dye labeled targets
on single human cDNA microarrays [40]. The microarrays
included probes for 349 genes; each spotted 20
times to give robust statistical analysis. Validation of the
results was accomplished by the use of semi-quantitative
RT-PCR. Other approaches to validation include
Real Time PCR and Northern blot analysis. Employing
high stringency hybridization and washing, followed by
analysis of the array data with appropriate statistical
tests, revealed only slight interspecies differences in the
expression patterns and high reproducibility of the
signals for many genes. The correlation coefficient of
cross hybridization between orthologous genes was
Author's personal copy
H. Niemann et al. / Theriogenology 68S (2007) S165–S177
Fig. 2. Reproducibility of a cDNA array analysis with RNA isolated from single mouse embryos. The correlation coefficient of 0.98 indicates that
the array provides reproducible results (for details see Brambrink et al. [31]).
0.94. Verification of the array data by semi-quantitative
RT-PCR using common primer sequences permitted coamplification
of both human and bovine transcripts
[40]. Results of the study demonstrated the power of
comparative genomics and the feasibility of using
human microarrays for the identification of differentially
expressed genes in other species.
3. Current status of embryo transcriptomics
3.1. Embryos from farm animals
Farm animal breeders suffer major economic losses
through high early embryonic mortality, in cattle 35–50%
of the fertilized oocytes fail to develop [41]; this figure is
dramatically increased in modern short-interval breeding
regimens [22]. In many parts of the world, large numbers
of embryos are routinely produced using in vitro
fertilization of oocytes collected by non-surgical ultrasound-guided
follicular aspiration or harvested from
slaughterhouse ovaries. Cloning by somatic cell nuclear
transfer is also well established for this species reflecting,
at least in part, the enormous commercial interest in
improved bovine embryo technology. The abundant
availability of such material provides researchers with
excellent opportunities to study the causes of embryonic
loss in bovine and other species, including man
which show significant similarities in preimplantation
development. Specific similarities include the time
course of preimplantation development; switch from

maternal to embryonic genomic activity, metabolism and
certain pathologies associated with in vitro produced
embryos.
Studies using sensitive Reverse Transcription–Polymerase
Chain Reaction (RT-PCR) revealed approximately
200–250 genes that were differentially
expressed in in vitro derived embryos as compared to
embryos flushed from the uterus [24]. Using this
technology, we also identified expression anomalies in
blastocysts produced from prepubertal oocytes which
appear to correlate with their reduced developmental
potential [42]. Oocytes from prepubertal animals are of
interest because they are the source of embryos in
breeding programs which are based on shortened
generation intervals.
The sequencing of cDNAs, e.g. expressed sequence
tags (EST), from genes specifically expressed during
early development is important for in-depth studies on
the molecular mechanisms underlying mammalian
preimplantation development. This work is well
advanced in mice where >140,000 ESTs from all
developmental stages are available from public databases,
however, in other species, a more limited amount
of sequence information is available [43]. The main
limitation for embryo transcriptomics is that the
establishment of a conventional cDNA EST library
requires roughly 5000 oocytes, 13,500 2-cell stages,
2800 8-cell embryos or 600 blastocysts [44], which is
difficult for a uniparous species.
The advent of cDNA array technology has for the
first time made possible to compare the global
transcription pattern of 20,000 genes during mammalian
embryogenesis limited only by the availability
of cloned cDNA from these early stages. Application of
cDNA array technology has been reported for human,
mouse, bovine and porcine preimplantation embryos. A
study of the transcriptional profile of 2-cell mouse
embryos included 4000 genes from a cDNA-library
and revealed many previously unknown transcripts,
including mobile genetic elements that appear to be
associated with activation of the embryonic genome
[45]. The mRNA expression profile of porcine oocytes,
4- and 8-cell stages and blastocysts was studied with the
aid of a 15 K cDNA-array specific for porcine
reproductive organs. The transcription profile of in
vivo developing embryos was compared with that of in
vitro produced 4-cell, 8-cell and blastocyst stage
embryos. This revealed 1409 and 1696 differentially
expressed (in vivo/in vitro) genes at the 4- and 8-cell
stage, respectively [46].
Studies of bovine embryonic mRNA expression
based on subtractive hybridization and cDNA-arrays
Author's personal copy
H. Niemann et al. / Theriogenology 68S (2007) S165–S177 S171
have identified differentially expressed genes between
bovine oocytes derived from large or small follicles. A
total of 21 upregulated genes were found out of 1000
clones [47]. Using a similar subtraction hybridization
protocol, the sequencing of 185 clones revealed 146
non-redundant genes which were associated with
bovine oocyte maturation [48].
Cross-species hybridization of a human cDNA-
Array with bovine RNA, derived from rather large pools
of >200 oocytes yielded a first expression profile for
bovine oocytes before and after maturation. The relative
amount of mRNA remained constant during in vitromaturation.
Approximately 300 genes could positively
be identified [49]. Recently, we have investigated the
mRNA expression profiles of bovine oocytes and
blastocysts by using a cross-species hybridization
approach employing an array consisting of 15,529
human cDNAs (The ENSEMBL chip) as probe, thus
allowing identifying conserved genes during human and
bovine preimplantation development [50]. The analysis
revealed 419 genes that were expressed in both, oocytes
and blastocysts. The expression of 1324 genes was
detected exclusively in the blastocyst, in contrast to 164
in the oocyte, including a significant number of novel
genes. Typically genes indicative for transcriptional and
translational control such as ELAVL4, TACC3 were
over-expressed in the oocyte, whereas genes indicative
for numerous pathways were over-expressed in blastocysts.
Transcripts implicated in chromatin remodeling
were found in both oocytes (NASP SMARCA2, DNMT1)
and blastocysts (H2AFY, HDAC7A). Pathway analysis
revealed differential expression of genes comprising
107 distinct signaling and metabolic pathways. Expression
patterns in bovine and human blastocysts were to a
large extent identical [50]. A major advantage of our
cross-species hybridization approach is that developmentally
conserved novel and annotated marker genes
could be identified for human and bovine oocytes and
blastocysts.
Analysis with a self constructed bovine array
containing 2000 clones with ESTs from different
embryonic developmental stages (Blue Chip) provided
insight into the expression profile during bovine
embryonic development [51]. Using this Blue Chip,
it was possible to link a specific embryonic transcriptional
profile, determined from embryo biopsies with
the outcome of embryo transfers to recipients. Embryos
leading to pregnancies specifically over-expressed
genes needed for implantation and placenta formation,
carbohydrate metabolism, and growth factor signaling
[52]. Combining subtractive hybridization with this
bovine cDNA-array allowed the identification of

S172
previously unknown bovine oocyte specific genes. From
a total of 850 clones, 491 known genes were identified
in bovine oocytes, plus 188 previously non-characterized
sequences, 105 unknown sequences and 86 noninformative
sequences [53]. Among the 450 clones
derived from bovine blastocysts, 301 known genes, 10
unknown sequences, and 139 non-informative
sequences were positively identified [51]. Other
laboratories have also designed home made arrays
based on either oligonucleotide or cDNA probes
[54,55], which cover only a portion of bovine genome.
These data illustrate the enormous challenges to arrive
at a complete transcriptomic map for bovine preimplantation
development.
Affymetrix commercially distributes a bovine
genomic array covering probe sets of approximately
23,000 transcripts and 19,000 UniGene clusters,
which is based on the bovine genome sequence data.
Recently, the transcriptomes of bovine in vitro matured
oocytes and in vitro produced 8-cell stages were
analyzed by this Affymetrix bovine array and genes
critically involved in the major activation of the
embryonic genome were determined [56]. Approximately
370 genes with functions in chromatin
modification, apoptosis, signal transduction, metabolism
and immune response were differentially
expressed between oocytes and 8-cell stages, including
DNMT1, DNMT2 and MeCP2 that were specifically
upregulated in 8-cell stages.
Large scale transcriptomic analyses are useful for
unraveling the consequences of in vitro production
techniques such as in vitro fertilization and culture and
somatic cloning by comparison with in vivo derived
embryos. Interestingly, the transcriptomes of cloned
bovine embryos were found to be more similar to that of
in vivo blastocysts than to in vitro produced embryos
[57], suggesting that the cloned embryos successfully
underwent major reprogramming. It is well documented
that the in vitro conditions induce alterations in
embryonic transcript profiles [22,23]. Recently, we
have hybridized RNA from in vivo produced bovine
oocytes and all stages of bovine preimplantation
development until the blastocyst stage on the bovine
Affymetrix array. For the first time this analysis will
yield a complete picture of mRNA expression in the
processes of oocyte maturation, fertilization, embryonic
activation, and cell lineage differentiation in a large
mammalian species (unpublished data).
The power of cDNA array technology for unraveling
critical reproductive pathways has also been demonstrated
[58–60]. The developmental potential of bovine
oocytes was correlated with the level of follistatin
Author's personal copy
H. Niemann et al. / Theriogenology 68S (2007) S165–S177
transcripts [60]. Transcript levels of genes involved in
transcription and translation were linked with the origin
of embryos, i.e. either in vivo fertilization or in vitro
production [59]. Another study showed that transcript
abundances for follicle stimulating hormone receptor,
estrogen receptor 2, inhibin alpha, activin A receptor
type I, cyclin D2 and two pro-apoptotic factors
decreased in granulosa cells during the growth of the
dominant follicle [58].
3.2. Embryos from mice and men
Extensive transcriptomic analyses have been made in
mouse oocytes and preimplantation embryos
[31,33,61–64]. Surplus human oocytes or embryos
discarded from IVF procedures have been used in most
transcriptomic studies [65–69]. Recently, RNA was
isolated from pools of human metaphase II oocytes
obtained after hormonal ovarian stimulation [30]. The
globally amplified transcripts were then hybridized to a
human genome chip covering 47,000 transcripts. A
comparison of the hybridization signals with those
obtained for several somatic tissues revealed that 5331
transcripts were up-regulated and 7074 transcripts were
down-regulated in oocytes. Compared with data from
mouse oocytes a common set of 1587 transcripts was
found, which may indicate genes with conserved
function in mammalian oocytes. Common sets of
transcripts were also found in the transcriptomes of
human oocytes and human and murine embryonic stem
cells. Most prominent were transcripts encoding
proteins active in the transforming growth factor
(TGF)-b signaling pathway.
A comprehensive genome-wide study of gene
transcripts has been performed on 12 stages of murine
in vivo oocytes at the germinal vesicle, and metaphase II
stage and preimplantation embryos [33]. More than
4000 genes were differentially expressed during
preimplantation development. Two major groups of
gene activity could be defined, one comprising oocytes
and first cleavage stages, and the other consisting of 4cell
to blastocyst stages, thus correlating with the
transition of maternal to zygotic expression. Several
transcripts of molecules involved in Wnt, bone
morphogenetic protein (BMP) or Notch signaling
pathways were identified in the embryonic transcriptome,
indicating that these critical regulators of cell fate
and patterning are conserved and functional in these
stages of preimplantation development [61–63].
A gene atlas of the protein-coding transcriptomes of
mouse and man has been recently described for several
somatic tissues [70]. On average, 8000 transcripts

were determined for individual mouse tissues; 1–3% of
the analyzed transcripts were detected in all analyzed
tissues, i.e. 79 man and 61 mice, respectively. The
abundance of these ubiquitously expressed transcripts
(housekeeping genes) was found to be significantly
higher than that for all tissue specific genes.
4. Limitations and perspectives of DNA arrays
4.1. Limitations
A major limitation of array technologies is our
fragmentary understanding of genome organization and
function. Recent data suggest that various mechanisms,
including epigenetics, microRNAs, non-coding and
unconventional RNAs significantly contribute to the
dynamics of the transcriptome [10–16]. Even the most
recent arrays with densities of >1 million targets per
array do not cover this complexity. The transcriptome of
somatic cells seems to be regulated in a more stochastic
manner than previously thought [71]. Furthermore, the
enormous plasticity and highly dynamic nature of early
embryonic development may hamper attempts to obtain
a true representative picture of the transcriptome. It has
to be born in mind that current technologies only
provide snapshots of parts of the entire embryonic
transcriptome which may then be further exploited by
arrays specific for certain pathways and/or differentiation
status, etc. Targeted approaches to screen for novel
transcripts via expressed sequence tag libraries may
contribute to a more complete inventory of the
transcriptome [45,72]. However, even in light of these
limitations, the currently available technology allows
discovery of novel genetic information.
Appropriate statistical methods have been developed
for controlling the quality of microarrays, to ensure the
reproducibility of results and to identify differential
expression [73,74]. Bioinformatic methods have been
adapted and refined in the past few years and now take
into account inherent limitations of the array technology.
A recent comprehensive comparison across various
studies indicated high correlation even if different
platforms and bioinformatic tools had been employed
[75], thereby confirming the validity of the microarray
concept across different laboratories.
4.2. Perspectives
DNA array technology is based on the specific
detection of sequences present in certain genes. Tiling
and exon arrays will extend this technology by the
comprehensive identification of individual exons [76] or
Author's personal copy
H. Niemann et al. / Theriogenology 68S (2007) S165–S177 S173
other DNA elements. The human Exon 1.0 ST array
(Affymetrix) is spotted with targets of approximately 1
million known and predicted exons. Exon arrays offer a
fine-tuned picture of gene expression, in view of the fact
that the majority of mammalian genes is differentially
spliced. In extreme cases, such as the neurexin gene
family more than 1000 splice variants of three genes are
known [77,78]. Recently, a close correlation between
array data from exon and conventional gene arrays has
been determined in a cell culture model [79]. This
supports the concept of developing useful exon arrays.
In the context of embryo transcriptomics, exon arrays
will be important to reveal splice variants of genes
critical in early development.
Tiling arrays carry genomic DNA sequences; ideally
they cover the whole genome of an organism. They can
be used to study single nucleotide polymorphisms
(SNP) or copy number variations (CNV), that are
deletions, insertions and duplications from 1 kilobasepairs
to several megabasepairs. Recent studies with
tiling arrays investigated the CNV in the human genome
and provided compelling evidence for an unexpected
high frequency of CNVs [80]. Up to 3000 genes were
found to be associated with CNV. The occurrence of this
phenomenon in mice and ape suggests that a similar
situation may exist in farm animals, which remains to be
shown.
Epigenetic regulation by DNA methylation is a
widespread phenomenon in biology and bears substantial
information with regard to cell physiology,
dysfunction and differentiation. Primary targets of
methylation are cytosine guanine dinucleotides (CpG);
cytosine is modified to become 5 methyl cytosine. In the
mammalian genome CpG sites are unevenly distributed
and mostly clustered as CpG islands, which are often
associated with promoter elements [81]. Cytosine
methylation is a conserved epigenetic mechanism
involved in silencing of transposons, genomic imprinting
and regulation of gene expression. DNA methylation
is critically important for normal development of
mammals, as demonstrated by embryonic lethality of
knock-outs of murine methyltransferase genes DNMT1
or DNMT3a/b. Aberrant methylation patterns are
associated with developmental anomalies and specific
diseases, including cancer [82,83].
Methylation sensitive arrays can detect cytosine
methylation of genomic DNA and may thereby provide
information on the underlying mechanisms of a specific
transcriptional profile. A genome wide identification
and functional analysis of methylated DNA nucleotides
will provide cues on how and to which extent
methylation and gene expression are connected.

S174
Recently the first genome-wide DNA methylation map
has been obtained in the plant Arabidopsis [84].
Methylated and non-methylated genomic DNAs were
fractionated by immuno-precipitation with a monoclonal
antibody that specifically recognizes methylcytosine,
followed by amplification and hybridization to
whole genome arrays. Pericentromeric regions, repetitive
sequences, and regions coding for small interfering
RNA were found to be heavily methylated. Several
constitutively expressed genes showed methylation
within the transcribed regions, but only rarely in
promoter regions, indicating that methylation marks
have different functions in different gene compartments.
Employing a similar strategy, a DNA methylation
profile has been obtained for individual human
chromosomes [85], and the DNA methylation pattern of
the tumor suppressor gene p16INK4A has been
determined [86].
Several human health related technologies rely on
the utilization of non-human primates and farm
animals for vaccine development, organ transplantation,
production of recombinant proteins and viral
pathogenesis [87]. The application of animal products
as drugs or treatments of human patients requires the
absence of any unwanted contaminations. DNA
microarrays provide a mean for a high throughput
testing of these products, including products of
transgenic animals [88].
Ribonucleic acid interference (RNAi) allows
detailed study of biological mechanisms underlying
normal and aberrant embryonic development. RNAi is a
conserved post-transcriptional gene regulatory process
found in most biological systems. The common
mechanistic elements are small interfering RNA
(siRNAs) with 21–23 nucleotides, which specifically
bind complementary sequences of their target mRNAs
and shut down expression. The target mRNAs are
degraded and no protein is translated [89]. The
specificity of the RNAi approach is shown by reduced
levels of the target transcript and unchanged levels of
housekeeping mRNAs [90]. Microarray analysis offers
the possibility to obtain a complete profile after RNAi
application on the downstream effects as well off target
effects in a comprehensive way.
Array based analysis forms the basis for systematic
characterization of the biological function of genes in
preimplantation development by high-throughput RNAi
screening. Genome wide screening in Caenorhabditis
elegans and Drosophila, and to a lesser extent in
mammalian cells, has proven to be a valuable tool for
the dissection of biological pathways. Recent developments
include strategies to combine genome-scale
Author's personal copy
H. Niemann et al. / Theriogenology 68S (2007) S165–S177
RNAi libraries with high-throughput screening technologies
and integrated high-content bioinformatic
analysis [91]. Similarly, analysis of the vast database
of array data obtained from cancer studies will exploit
the similarities between tumor cells and embryonic cells
and will increase understanding of the pathways
involved in embryonic development. For example,
studies in zebrafish show that embryonic and tumorigenic
pathways converge via Nodal signaling [92]. The
bovine embryo with its advanced in vitro techniques and
established technology for recovery of in vivo embryos
will be useful tool in this context. Cross-species
transcriptome analyses will be instrumental to identifying
evolutionary conserved pathways which are crucial
for development. Alteration of specific pathways via
RNAi or transgenesis will reveal physiological relationships
and the genetic factors involved in aberrant
development.
5. Conclusions
Broad determination of the embryonic transcriptome
at each developmental stage through array technology is
critical for understanding the critical regulatory pathways
in early development. This is leading to the
discovery of new regulatory mechanisms and is
identifying new roles for genes known in other contexts.
At present, our understanding of the results of array
analysis is limited by our fragmentary understanding of
pathways involved in the regulation of chromatin
structure and the pathways involved in the regulation of
the transcription of individual genes. Recent developments,
including exon gene arrays, microRNA arrays
and methylation sensitive arrays address some of these
challenges. Furthermore, it should be taken into account
that ultimately the protein determines the function of a
specific gene, and future studies will unravel the
proteome of an embryo by appropriate protein chips. In
the context of mammalian embryonic development, it is
crucial to employ these new tools to obtain a complete
picture of the dynamic embryo transcriptome. Array
technology in its various facets is an important
diagnostic tool for early detection of developmental
aberrations and for improving the safety of new
reproductive technologies such as transgenesis and
somatic nuclear transfer [87].
Acknowledgement
The authors gratefully acknowledge the financial
support from DFG for the embryonic transcriptomic
studies cited in this review (Ni 256/27-1, FOR 478).

References
[1] Goodstadt L, Ponting CP. Phylogenetic reconstruction of orthology,
paralogy, and conserved synteny for dog and human. PLoS
Comput Biol 2006;2:e133.
[2] Aparicio S, Chapman J, Stupka E, Putnam N, Chia JM, Dehal P,
et al. Whole-genome shotgun assembly and analysis of the
genome of Fugu rubripes. Science 2002;297:1301–10.
[3] Gregory SG, Sekhon M, Schein J, Zhao S, Osoegawa K, Scott
CE, et al. A physical map of the mouse genome. Nature
2002;418:743–50.
[4] Okazaki Y, Furuno M, Kasukawa T, Adachi J, Bono H, Kondo S,
et al. Analysis of the mouse transcriptome based on functional
annotation of 60,770 full-length cDNAs. Nature 2002;420:
563–73.
[5] Abril JF, Agarwal P, Alexandersson M, Antonarakis SE,
Baertsch R, Berry E, et al. Initial sequencing and comparative
analysis of the mouse genome. Nature 2002;420:520–62.
[6] Wallis JW, Aerts J, Groenen MA, Crooijmans RP, Layman D,
Graves TA, et al. A physical map of the chicken genome. Nature
2004;432:761–4.
[7] Fadiel A, Anidi I, Eichenbaum KD. Farm animal genomics and
informatics: an update. Nucleic Acids Res 2005;33:6308–18.
[8] Lindblad-Toh K, Wade CM, Mikkelsen TS, Karlsson EK, Jaffe
DB, Kamal M, et al. Genome sequence, comparative analysis
and haplotype of the domestic dog. Nature 2005;438:803–19.
[9] Hayashizaki Y, Kanamori M. Dynamic transcriptome of mice.
Trends Biotechnol 2004;22:161–7.
[10] Biemont C, Vieira C. Junk DNA as evolutionary force. Nature
2006;443:521–4.
[11] Rassoulzadegan M, Grandjean V, Gounon P, Vincent S, Gillot I,
Cuzin F. RNA-mediated non-mendelian inheritance of an epigenetic
change in the mouse. Nature 2006;441:469–74.
[12] Segal E, Fondufe-Mittendorf Y, Chen L, Thastrom A, Field Y,
Moore IK, et al. A genomic code for nucleosome positioning.
Nature 2006;442:772–8.
[13] Venkatesh B, Kirkness EF, Loh YH, Halpern AL, Lee AP,
Johnson J, et al. Ancient noncoding elements conserved in
the human genome. Science 2006;314:765.
[14] Werner A. Natural antisense transcripts. RNA Biol 2005;2:
53–62.
[15] Heintzman ND, Ren B. The gateway to transcription: identifying,
characterizing and understanding promoters in the eukaryotic
genome. Cell Mol Life Sci 2007;64:386–400.
[16] Jirtle RL, Skinner MK. Environmental epigenomics and disease
susceptibility. Nat Rev Genet 2007;8:253–62.
[17] Schena M, Shalon D, Davis RW, Brown PO. Quantitative
monitoring of gene expression patterns with a complementary
DNA microarray. Science 1995;270:467–70.
[18] Bennett ST, Barnes C, Cox A, Davies L, Brown C. Toward the
1,000 dollars human genome. Pharmacogenomics 2005;6:
373–82.
[19] Ragoussis J, Elvidge GP, Kaur K, Colella S. Matrix-assisted laser
desorption/ionization, time-of-flight mass spectrometry in genomics
research. PLoS Genet 2006;2:e100.
[20] Telford NA, Watson AJ, Schultz GA. Transition from maternal to
embryonic control in early development: A comparison of
several species. Mol Reprod Dev 1990;26:90–100.
[21] Kiefer J. Epigenetics in development. Dev Dyn 2007;236:
1144–56.
[22] Niemann H, Wrenzycki C. Alterations of expression of developmentally
important genes in preimplantation bovine embryos
Author's personal copy
H. Niemann et al. / Theriogenology 68S (2007) S165–S177 S175
by in vitro culture conditions: Implications for subsequent
development. Theriogenology 2000;53:21–34.
[23] Wrenzycki C, Herrmann D, Lucas-Hahn A, Korsawe K, Lemme
E, Niemann H. Epigenetic reprogramming throughout preimplantation
development and consequences for assisted reproductive
technologies. Birth Defects Res C 2005;75:1–9.
[24] Wrenzycki C, Herrmann D, Lucas-Hahn A, Korsawe K, Lemme
E, Niemann H. Messenger RNA expression patterns in bovine
embryos derived from in vitro procedures and their implications
for development. Reprod Fertil Dev 2005;17:23–35.
[25] Ge H, Walhout AJM, Vidal M. Integrating ‘‘omic’’ information:
a bridge between genomics and systems biology. Trends Genet
2003;19:551–60.
[26] Owens J. Gene expression: Do microarrays match up? Nat Rev
Genet 2005;6:432–3.
[27] Ma M, Strauss WM. Analysis of the Xist RNA isoforms suggests
two distinctly different forms of regulation. Mamm Genome
2005;16:391–4.
[28] Yu J, Hecht NB, Schultz RM. RNA-binding properties and
translation repression in vitro by germ cell-specific MSY2
protein. Biol Reprod 2002;67:1093–8.
[29] Bilodeau-Goeseels S, Schultz GA. Changes in ribosomal ribonucleic
acid content within in vitro-produced bovine embryos.
Biol Reprod 1997;56:1323–9.
[30] Kocabas AM, Crosby J, Ross PJ, Out HH, Beyhan Z, Can H,
et al. The transcriptome of human oocytes. Proc Natl Acad Sci
USA 2006;103:14027–32.
[31] Brambrink T, Wabnitz P, Halter R, Klocke R, Carnwath JW,
Kues W, et al. Application of cDNA arrays to monitor mRNA
profiles in single preimplantation mouse embryos. Biotechniques
2002;33:376–85.
[32] Klein CA, Seidl S, Petat-Dutter K, Offner S, Geigl JB, Schmidt-
Kittler O, et al. Combined transcriptome and genome analysis of
single micrometastatic cells. Nat Biotechol 2002;20:387–92.
[33] Wang QT, Piotrowska K, Ciemerych MA, Milenkovic L, Scott
MP, Davis RW, et al. A genome wide study of gene activity
reveals developmental signalling pathways in the preimplantation
mouse embryo. Dev Cell 2004;6:133–44.
[34] Niemann H, Kues WA. Application of transgenesis on livestock
for agriculture and biomedicine. Anim Reprod Sci 2003;79:
291–317.
[35] Chismar JD, Mondala T, Fox HS, Roberts E, Langford D,
Masliah E, et al. Analysis of result variability from high-density
oligonucleotide arrays comparing same-species and cross-species
hybridisations. BioTechniques 2002;33:516–24.
[36] Moody DE, Zou Z, McIntyre L. Cross-species hybridisation of
pig RNA to human nylon microarrays. BMC Genomics
2002;3:27.
[37] Medhora M, Bousamra M, Zhu D, Somberg L, Jacobs ER.
Upregulation of collagens detected by gene array in a model
of flow-induced pulmonary vascular remodeling. Am J Physiol
Heart Circ Physiol 2002;282:H414–22.
[38] Huang GS, Yang SM, Hong MY, Yang PC, Liu YC. Differential
gene expression of livers from ApoE deficient mice. Life Sci
2000;68:19–28.
[39] Tsoi SC, Cale JM, Bird IM, Ewart V, Brown LL, Douglas S. Use
of human cDNA microarrays for identification of differentially
expressed genes in Atlantic Salmon liver during Aeromonas
salmonicida infection. Mar Biotechnol (NY) 2003;5:545–54.
[40] Adjaye J, Herwig R, Herrmann D, Wruck W, BenKahla A, Brink
TC, et al. Cross-species hybridisation of human and bovine
orthologous genes on high density cDNA microarrays. BMC-

S176
Genom 2004;5:83 (http://www.biomedcentral.com/1471-2164/
5/83).
[41] Sreenan JM, Diskin MG. The extent and timing of embryonic
mortality in cattle. In: Sreenan JM, Diskin MG, editors.
Embryonic mortality in farm animals. Dordrecht, NL: M. Nijhoff
Publ; 1986. p. 1–11.
[42] Oropeza A, Wrenzycki C, Herrmann D, Hadeler KG, Niemann
H. Improvement of the developmental capacity of oocytes from
prepuberal cattle by intraovarian Insulin-like growth factor-I
application. Biol Reprod 2004;70:1634–43.
[43] Ko MS. Embryogenomics of pre-implantation mammalian
development: current status. Reprod Fertil Dev 2004;16:79–85.
[44] Ko MS. Embryogenomics: developmental biology meets genomics.
Trends Biotechnol 2001;19:511–8.
[45] Evsikov AV, Graber JH, Brockman JM, Hampl A, Holbrook AE,
Singh P, et al. Cracking the egg: molecular dynamics and
evolutionary aspects of the transition from the fully grown
oocyte to embryo. Genes Dev 2006;20:2713–27.
[46] Whitworth KM, Agca C, Kim JG, Patel RV, Springer GK, Bivens
NJ, et al. Transcriptional profiling of pig embryogenesis by using
a 15-K member unigene set specific for pig reproductive tissues
and embryos. Biol Reprod 2005;72:1437–51.
[47] Donnison M, Pfeffer PL. Isolation of genes associated with
developmentally competent bovine oocytes and quantitation of
their levels during development. Biol Reprod 2004;71:1813–21.
[48] Pennetier S, Uzbekova S, Guyader-Joly C, Humblot P, Mermillod
P, Dalbies-Tran R. Genes preferentially expressed in bovine
oocytes revealed by subtractive and suppressive hybridization.
Biol Reprod 2005;73:713–20.
[49] Dalbies-Tran R, Mermillod P. Use of heterologous complementary
DNA array screening to analyze bovine oocyte transcriptome
and its evolution during in vitro maturation. Biol Reprod
2003;68:252–61.
[50] Adjaye J, Herwig R, Brink T, Herrmann D, Greber B, Groth D,
et al. Conserved molecular profiles of maternal and embryonic
gene expression during bovine and human preimplantation
development. Physiol Genom, submitted for publication.
[51] Sirard MA, Dufort I, Vallee M, Massicotte L, Gravel C, Reghenas
H, et al. Potential and limitations of bovine-specific arrays
for the analysis of mRNA levels in early development: preliminary
analysis using a bovine embryonic array. Reprod Fertil
Dev 2005;17:47–57.
[52] El-Sayed A, Hoelker M, Rings F, Salilew D, Jennen D, Tholen E,
et al. Large-scale transcriptional analysis of bovine embryo
biopsies in relation to pregnancy success after transfer to recipients.
Physiol Genom 2006;28:84–96.
[53] Vallee M, Robert C, Methot S, Palin MF, Sirard MA. Crossspecies
hybridizations on a multi-species cDNA microarray to
identify evolutionary conserved genes expressed in oocytes.
BMC Genomics 2006;7:113. doi: 10.1186/1471-2164-7-113.
[54] Long JE, Cai X, He LQ. Gene profiling of cattle blastocysts
derived from nuclear transfer, in vitro fertilization and in vivo
development based on a cDNA library. Anim Reprod Sci
2007;100:243–56.
[55] Yao J, Ren X, Ireland JJ, Coussens PM, Smith TP, Smith GW.
Generation of a bovine oocyte cDNA library and microarray:
resources for identification of genes important for follicular development
and early embryogenesis. Physiol Genom 2004;19:84–92.
[56] Misirlioglu M, Page GP, Sagirkaya H, Parrish JJ, First NL,
Memili E. Dynamics of global transcriptome in bovine matured
oocytes and preimplantation embryos. Proc Natl Acad Sci USA
2006;103:18905–10.
Author's personal copy
H. Niemann et al. / Theriogenology 68S (2007) S165–S177
[57] Smith SL, Everts RE, Tian XC, Du F, Sung LY, Rodriguez-Zas
SL, et al. Global gene expression profiles reveal significant
nuclear reprogramming by the blastocyst stage after cloning.
Proc Natl Acad Sci USA 2005;102:17582–7.
[58] Mihm M, Baker PJ, Ireland JL, Smith GW, Coussens PM, Evans
AC, et al. Molecular evidence that growth of dominant follicles
involves a reduction in follicle-stimulating hormone dependence
and an increase in luteinizing hormone dependence in cattle.
Biol Reprod 2006;74:1051–9.
[59] Corcoran D, Fair T, Park S, Rizos D, Patel OV, Smith GW, et al.
Suppressed expression of genes involved in transcription and
translation in in vitro compared with in vivo cultured bovine
embryos. Reproduction 2006;131:651–60.
[60] Patel OV, Bettegowda A, Ireland JJ, Coussens PM, Lonergan P,
Smith GW. Functional genomics studies of oocyte competence:
evidence that reduced transcript abundance for follistatin is
associated with poor developmental competence of bovine
oocytes. Reproduction 2007;133:95–106.
[61] Zeng F, Baldwin DA, Schultz RM. Transcript profiling during
preimplantation mouse development. Dev Biol 2004;272:
483–96.
[62] Zeng F, Schultz RM. RNA transcript profiling during zygotic
gene activation in the preimplantation mouse embryo. Dev Biol
2005;283:40–57.
[63] Hamatani T, Daikoku T, Wang H, Matsumoto H, Carter MG, Ko
MS, et al. Global gene expression analysis identifies molecular
pathways distinguishing blastocyst dormancy and activation.
Proc Natl Acad Sci USA 2004;101:10326–31.
[64] Hamatani T, Ko MS, Yamada M, Kuji N, Mizusawa Y, Shoji M,
et al. Global gene expression profiling of preimplantation
embryos. Hum Cell 2006;19:98–117.
[65] Adjaye J, Daniels R, Monk M. The construction of cDNA
libraries from human single preimplantation embryos and their
use in the study of gene expression during development. J Assist
Reprod Genet 1998;15:344–8.
[66] Chen HW, Chen JJ, Yu SL, Li HN, Yang PC, Su CM, et al.
Transcriptome analysis in blastocyst hatching by cDNA microarray.
Hum Reprod 2005;20:2492–501.
[67] Bermudez MG, Wells D, Malter H, Munne S, Cohen J, Steuerwald
NM. Expression profiles of individual human oocytes using
microarray technology. Reprod Biomed Online 2004;8:325–37.
[68] Dobson AT, Raja R, Abeyta MJ, Taylor T, Shen S, Haqq C, et al.
The unique transcriptome through day 3 of human preimplantation
development. Hum Mol Genet 2004;13:1461–70.
[69] Assou S, Anahory T, Pantesco V, Le Carrour T, Pellestor F, Klein
B, et al. The human cumulus-oocyte gene-expression profile.
Hum Reprod 2006;21:1705–19.
[70] Su AI, Wiltshire T, Batalov S, Lapp H, Ching KA, Block D, et al.
A gene atlas of the mouse and human protein-encoding transcriptomes.
Proc Natl Acad Sci USA 2004;101:6062–7.
[71] Raj A, Peskin CS, Tranchina D, Vargas DY, Tyagi S. Stochastic
mRNA synthesis in mammalian cells. PLoS Biol 2006;4:e309.
[72] Sharov AA, Piao Y, Matoba R, Dudekula DB, Qian Y, VanBuren
V, et al. Transcriptome analysis of mouse stem cells and early
embryos. PLoS Biol 2003;1:E74.
[73] Peri S, Ibarrola N, Blagoev B, Mann M, Pandey A. Common
pitfalls in bioinformatics-based analyses: look before you leap.
Trends Genet 2001;17:541–5.
[74] Nadon R, Shoemaker J. Statistical issues with microarrays:
processing and analysis. Trends Genet 2002;18:265–71.
[75] Shi L, Reid LH, Jones WD, Shippy R, Warrington JA, Baker SC,
et al. The MicroArray Quality Control (MAQC) project shows

inter- and intraplatform reproducibility of gene expression measurements.
Nat Biotechnol 2006;24:1151–61.
[76] Yeakley J, Fan JB, Doucet D, Luo L, Wickham E, Ye Z, et al.
Profiling alternative spliceing on fiber-optic arrays. Nat Biotechnol
2002;20:353–8.
[77] Ullrich B, Ushkaryov YA, Sudhof TC. Cartography of neurexins:
more than 1000 isoforms generated by alternative splicing and
expressed indistinct subsets of neurons.Neuron1995;14:497–507.
[78] Missler M, Sudhof TC. Neurexins: three genes and 1001 products.
Trends Genet 1998;14:20–6.
[79] Okoniewski MJ, Hey Y, Pepper SD, Miller CJ. High correspondence
between Affymetrix exon and standard expression arrays.
Biotechniques 2007;42:181–5.
[80] Kehrer-Sawatzki H. What a difference copy number variation
makes. Bioessays 2007;29:311–3.
[81] Antequera F, Bird A. Number of CpG islands and genes in
human and mouse. Proc Natl Acad Sci USA 1993;90:11995–9.
[82] Silva JM, Dominguez G, Villanueva MJ, Gonzalez R, Garcia JM,
Corbachio C, et al. Aberrant DNA methylation of the p16INK4a
geneinplasmaDNAofbreastcancer.BrJCancer1999;80:1262–4.
[83] Zhou HZ, Yu BM, Wang ZW, Sun JY, Cang H, Gao F, et al.
Detection of aberrant p16 methylation in the serum of colorectal
cancer patients. Clin Cancer Res 1999;8:188–91.
[84] Zhang X, Yazaki J, Sundaresan A. Genome-wide high resolution
mapping and functional analysis of DNA methylation in Arabidopsis.
Cell 2006;126:1–13.
Author's personal copy
H. Niemann et al. / Theriogenology 68S (2007) S165–S177 S177
[85] Eckhardt F, Lewin J, Cortese R, Rakyan VK, Attwood J, Burger
M, et al. DNA methylation profiling of human chromosomes 6,
20 and 22. Nat Genet 2006;38:1378–85.
[86] Mund C, Beier V, Bewerunge P, Dahms M, Lyko F, Hoheisel JD.
Array-based analysis of genomic DNA methylation patterns of
the tumour suppressor gene p16INK4A promoter in colon
carcinoma cell lines. Nucl Acids Res 2005;33:e73. doi:
10.1093/nar/gni072.
[87] Kues WA, Niemann H. The contribution of farm animals to
human health. Trends Biotechnol 2004;22:286–94.
[88] Kues WA, Schwinzer R, Wirth D, Verhoeyen E, Lemme E,
Herrmann D, et al. Epigenetic silencing and tissue independent
expression of a novel tetracycline inducible system in doubletransgenic
pigs. FASEB J Express 2006;20:E1–0. doi: 10.1096/
fj.05-5415fje.
[89] Plasterk RH. RNA silencing in genome’s immune system.
Science 2005;296:1263–5.
[90] Iqbal K, Kues WA, Niemann H. Parent-of-origin dependent gene
specific knock down in mouse embryos. Biochem Biophys Res
Comm, in press.
[91] Fuchs F, Boutros M. Cellular phenotyping by RNAi. Funct
Genom Proteomics 2006;5:52–6.
[92] Topczewska JM, Postovit LM, Margaryan NY, Sam A, Hess AR,
Wheaton WW, et al. Embryonic and tumorigenic pathways
converge via Nodal signalling: role in melanoma aggressiveness.
Nat Med 2006;12:925–32.

Review
Reproductive biotechnology in farm animals goes genomics
Wilfried A. Kues, Detlef Rath and Heiner Niemann*
Address: Department of Biotechnology, Institute of Farm Animal Genetics (FLI), Mariensee, Höltystrasse 10, D-31535 Neustadt,
Germany.
*Correspondence: Heiner Niemann. Fax: +49 (0)5034-871-101. Email: heiner.niemann@fli.bund.de
Received: 4 February 2008
Accepted: 23 May 2008
doi: 10.1079/PAVSNNR20083036
The electronic version of this article is the definitive one. It is located here: http://www.cababstractsplus.org/cabreviews
g CAB International 2008 (Online ISSN 1749-8848)
Abstract
CAB Reviews: Perspectives in Agriculture, Veterinary Science, Nutrition and Natural Resources 2008 3, No. 036
The breeding of domestic animals has a longstanding and successful history, starting with
domestication several thousand years ago. Modern animal breeding strategies, predominantly
based on population genetics, artificial insemination (AI) and embryo transfer (ET) technologies led
to significant increases in the performances in domestic animals and are the basis for the regular
supply with high-quality animal-derived food at acceptable prices. A recent addition to this arsenal
of technologies is the separation of spermatozoa into X- and Y-chromosomes bearing populations
by means of flow cytometry, which is going to be transferred into commercial cattle breeding.
Moreover, reproductive biotechnologies are currently being complemented by new measures of
molecular genetics. The genomes of several domestic animals have been sequenced and annotated.
Important uses of genomic data include improving selective breeding strategies, studying expression
patterns (transcriptomics or proteomics) and the production of transgenic animals
tailored for specific production purposes. The technology for the production of transgenic
animals, either by additive gene transfer or by selective deletion (knockout), has been advanced to
the level of practical application. A crucial step in this context was the development of somatic cell
nuclear transfer (SCNT) cloning, which has replaced the previously used rather inefficient method
of microinjection for producing transgenic animals. In this review, we discuss recent advances in
important areas of animal biotechnology related to agricultural applications, including sperm
sexing, somatic cloning, genome and transcriptome research, transgenesis and recombinant DNA
vaccines with emphasis on large domestic species.
Keywords: Domestication, Reproductive techniques, Genome sequencing, Sperm sexing, Recombinant
DNA, Somatic cloning, Embryo transcriptomics, Transgenic livestock, Agriculture
Introduction: Evolution of Animal Breeding
and Biotechnology
The breeding of domestic animals has a longstanding and
successful history, starting with domestication several
thousand years ago, by which Man kept animals in his
proximity and used products thereof [1]. Using the
technical options that were available in each time period,
humans have propagated those populations that were
deemed useful for their respective needs and purposes.
Selection mostly occurred according to the phenotype
and/or because of specific traits. Scientifically based animal
breeding has only existed for 50 years, mainly based on
http://www.cababstractsplus.org/cabreviews
population genetics and statistics. A vast number of phenotypically
different breeds with desirable traits resulted
from this process in a short time period (in evolutionary
terms). A good example is cattle, for which nowadays
>800 cattle breeds can be found worldwide [2]. These
breeds are not just variations of the same archetype, but
differ in qualitative and quantitative characteristics,
including specific disease resistance, climate adaptation,
lactation performance, fertility, meat quality and nutrient
requirements [3].
Modern animal-breeding strategies are based on a
number of biotechnological procedures, of which artificial
insemination (AI) is the most prominent example. Today,

2 Perspectives in Agriculture, Veterinary Science, Nutrition and Natural Resources
AI is employed in more than 90% of all sexually mature
female dairy cattle in countries with advanced breeding
programs [4]. Application of AI is also steadily increasing
in pigs, where now on a global scale approximately 50%
of sexually matured sows are fertilized by AI. AI allows
effective propagation of the genetic potential of valuable
sires within a population. On an average, 200–500 insemination
doses can be produced from one bull ejaculate,
which can be successfully stored frozen; the corresponding
figure for the boar is 10–35 [4]. A more recent
development is the separation of spermatozoa into X- and
Y-chromosomes bearing populations to allow the use of
semen carrying predetermined sex chromosomes [5].
In the second half of the 1980s, embryo transfer (ET)
technology has been introduced into animal breeding. ET
allowed for the first time a better exploitation of the
genetic potential of female animals. On an average, 5–10
viable embryos are being collected from a superovulated
donor cow and approximately 600 000 in vivo collected
embryos are transferred worldwide, of which 50% are
used after freezing and thawing; in addition, a significant
number of the transferred embryos ( 300 000) are
derived from in vitro production (in vitro maturation,
fertilization and culture of embryos), i.e. mainly from
abattoir ovaries [6]. In contrast to AI, ET is predominantly
used in the top 1% of a breeding population.
These breeding strategies, predominantly based on
population genetics, AI and ET technologies led to significant
increases in the performances in domestic animals
and are the basis for the regular supply with high-quality
animal-derived food at acceptable prices. However, three
major disadvantages have to be taken into account:
(1) the genetic progress is slow, at only 1–3% per year;
(2) it is not possible to separate the desired traits from
undesired ones; and
(3) a targeted transfer of genetic information between
different species is not possible.
This situation is about to change. Reproductive biotechnologies
are currently being complemented by new
measures of molecular genetics. The genomes of several
domestic animals have been sequenced and annotated,
including cattle, chicken, horse, bee and dog, and the pig
genome is expected to be drafted shortly (www.
ensembl.org). The technology for the production of
transgenic farm animals, either by additive gene transfer
or by selective deletion (knockout), has been advanced to
the level of practical application ([7–11]; reviewed in
[12]). A crucial step in this context was the development
of somatic cell nuclear transfer (SCNT) cloning [13],
which has replaced the previously used rather inefficient
method of microinjection for producing transgenic animals
[14]. Transgenic animals have been advanced to
practical application in biomedicine, in particular for the
production of pharmaceutical proteins in milk (gene
pharming: GTC Biotherapeutics, Pharming, Biosidus etc.)
and xenotransplantation, i.e. the production of porcine
organs and tissue in human organ transplantation to cope
with the shortage of human organs in terminally ill
patients. Agricultural applications are now rapidly emerging.
Here, we discuss recent advances in important areas of
animal biotechnology related to agricultural applications,
including sperm sexing, somatic cloning, genome and
transcriptome research, transgenesis and recombinant
DNA vaccines with emphasis on large domestic species.
Sperm Sexing
http://www.cababstractsplus.org/cabreviews
The reliable control of the sex ratio permits faster genetic
progress, higher productivity, improves animal welfare by
reducing the incidence of dystocia in cattle, avoiding castration
of male pigs, and producing less environmental
impact through elimination of animals with the unwanted
sex. In mammals, the sex-determining region (SRY) has
been mapped to the short arm of the Y-chromosome
[15]. SRY induces the formation of the primary testicular
tissue in the genital ridge, with the further development to
male reproductive organs being primarily under hormonal
control. Sperm from mammalian livestock species show a
difference in the relative amount of DNA between X- and
Y-chromosomes bearing sperm in the range of 3.5–4.2%
[16]. This difference in DNA contents between X- and
Y-bearing sperm can be exploited to effectively separate
populations of X- and Y-sperm in mammals via high-speed
flow cytometry [17]. The sample preparation requires
sperm staining with the fluorochrome Hoechst 33342
[18], which is a vital stain that is able to penetrate the
membrane of live sperm. After saturated binding of the
dye to A–T rich regions of genomic DNA, fluorescence
detection of small differences in relative DNA contents is
possible [18]. Damaged sperm can be excluded by sorting
through prior selective staining with FD#40, a red food
dye [19]. The current high-speed sperm sorters operate
at sample pressures up to 4.22 kg/cm 2 and a droplet frequency
of about 66 kHz, allowing identification of 30 000
events/s.
Correctly oriented spermatozoa are eliminated from
the system through the vibrating nozzle tip embedded in
small fluid droplets. The UV-light excites the fluorescent
dye, emitted light is collected by the 0 and 90 detectors
and the electric signals are processed by a computer.
Charged droplets disintegrate from the continuous
stream and pass an electro-static field (3000 V), which
allows separate collection of both the streams into tubes
pre-filled with a medium. Sorted spermatozoa are subsequently
washed from the sheath fluid by centrifugation
and the remaining sperm pellet is extended in a
suitable medium for further preservation [17, 20, 21]. The
current models of modified high-speed flow sorters
produce sexed sperm at the maximum rate of 20 million
sorted spermatozoa per hour under optimal conditions

with purities above 90%. Purity of sorted samples can
be validated either by flow cytometrical reanalysis
[22, 23], fluorescence in situ hybridization (FISH) [24, 25],
or PCR [26].
The technology was first applied commercially in the
UK in 2000, and approximately two million calves have
been produced from insemination with sexed sperm since
then (Rath and Johnson, in press). Although the sexing
technology has become more efficient over the past
decade, the number of sperm needed for regular inseminations
( 20 million sperm in cattle) cannot be flowsorted
for large-scale commercial programmes. Thus,
protocols for effective low-dose insemination have been
developed. At least two million sperm are needed for
commercial application of sex-separated bovine sperm
[27]. However, this may be too low to obtain satisfactory
pregnancy rates in light of the individual sperm differences
of bulls to fertilize at such low concentrations [28]. This is
even more pronounced in sorted-frozen spermatozoa
that have a reduced life span, as indicated in thermotolerance
tests [29]. In the pig, at least 50 million sperm
are needed for deep intra-uterine AI to achieve
acceptable pregnancy rates, thus preventing broader
applications [30]. Reports on the fertility of sex-sorted
semen are contradictory with that of some authors who
find no decline of fertility and others reporting a reduced
fertility after insemination with frozen sex-sorted spermatozoa
[5, 31–35].
The lower fertility can be caused by physical and/or
chemical stress during sorting, and/or can be caused by
the low number of inseminated sperm. High laser intensity
may cause more damage than lower laser intensity
as shown for rabbit [36] and bull spermatozoa [37].
Employing the most advanced laser technology and
replacing the water-cooled argon gas laser with a pulsed
solid-state laser significantly reduces stress on sperm. The
exposure of sperm to light pulses is much shorter than for
the continuous argon laser beam. Preliminary observations
with sorted ram spermatozoa using this new technology
indicate increased fertility rates (WMC Maxwell,
unpublished).
Importantly, no changes were found in the frequency
of endogenous DNA nicks after staining and UV light
exposure, indicating that the dye is not genotoxic [38, 39].
The hydrodynamic pressure could also exert detrimental
stress on the sorted sperm. Lowering the pressure from
2.59 to 2.07 mm Hg increased developmental rates of
bovine in vitro fertilization (IVF) embryos produced from
sex-sorted semen [40, 41].
Recently, we demonstrated for the first time that
bovine IVF-blastocysts derived from sex-sorted spermatozoa
showed an aberrant mRNA expression pattern
of developmentally important genes such as glucose
transporter 3 (Glut3) and glucose-6-phosphate dehydrogenase
(G6PDX), compared with their counterparts
derived from unsorted semen [42]. This indicates a longer
lasting effect of sorting into preimplantation development.
http://www.cababstractsplus.org/cabreviews
Wilfried A. Kues, Detlef Rath and Heiner Niemann 3
Table 1 Birth of offspring (+) using sex sorted sperm with
different fertilization techniques
AI/DUI ICSI IVF
Cattle + +
Pig + + +
Horse +
Sheep + + +
Goat +
Dolphins +
Rabbit + +
Buffalo +
Elk +
Primates + + +
Cat +
AI/DUI, artificial insemination/deep intrauterine insemination;
ICSI, intracytoplasmic sperm injection; IVF, in vitro fertilization.
Moreover, cleavage and blastocyst rates after IVF with
sex-sorted spermatozoa were significantly lower than that
in embryos produced with unsorted spermatozoa of the
same ejaculate [43]. Earlier reports had indicated that the
number of cell cycles is reduced [35] and timing of
embryo development may be disturbed after insemination
with sorted semen [33, 44, 45].
One approach to improve field results with sorted
sperm would be to select sorted sperm populations that
are specifically suited for successful insemination. With
the aid of a 6-h thermotolerance test, sorted sperm
populations were detected that showed improved fertility
characteristics and could thus be better suited for insemination
[29, 46]. The use of a novel sperm-preservation
methodology (Sexcess 1 ), based on a new extender supplemented
with antioxidants, significantly increased lifespan
and motility of bull spermatozoa. Pregnancy rates of
heifers inseminated with sex-separated semen treated
with Sexcess 1 reached similar levels as for animals inseminated
with non-sex-separated semen (73.6% sorted
versus 76.7% controls; n=232) [47]. In the pig, it was
shown that the media that had been supplemented with
PSP (porcine seminal plasma) I/II heterodimers [48], which
increases motility and mitochondrial activity [49], raised
the proportion of viable sorted boar spermatozoa. More
research is underway to improve bovine field results with
sex-sorted semen by a better preselection and protection
of spermatozoa during sorting and cryopreservation [50],
pig [51–53], horse [54, 55].
IVF, intracytoplasmic sperm injection (ICSI) and intratubal
insemination are promising approaches to adjust the
sorting technology in pigs and horses, where the high
number of viable spermatozoa needed for regular fertilization
cannot be produced, even for deep intrauterine
insemination of sorted spermatozoa (Table 1) [21, 48,
56–59].
In conclusion, flow-cytometry-based separation of
sperm into X- and Y-chromosomes bearing populations

4 Perspectives in Agriculture, Veterinary Science, Nutrition and Natural Resources
Figure 1 Schematic drawing illustrating the use of somatic cloning for the production of transgenic animals. After the
transfer of the transgenic donor cell into perivitelline space of the enucleated oocyte, both the components are fused usually
by short, high-voltage pulses through the point of contact between the two cells. This is followed by activation of the
reconstructed embryos, which is achieved either by short electrical pulses, or by brief exposure to chemical substances,
such as ionomycin or dimethylaminopurin (DMAP), regulating the calcium influx into the complexes and/or the cell cycle.
After a temporary in vitro culture period, the resulting blastocysts are transferred to synchronized recipient animals.
already meets the requirements for field application of
bovine semen when heifers are used and semen from
preselected bulls is processed using the most advanced
protocols. For yet-unknown reasons, cows have still
lower conception rates after insemination with sex-sorted
semen as compared with AI in heifers. Nevertheless,
the current sexing technology is commercially available
for cattle breeding and could evolve as a major tool
towards the implementation of more efficient breeding
and production schemes. More research is needed to
allow commercial application of sex-sorted semen for
other livestock species.
Somatic Cloning of Farm Animals
The technical aspects of nuclear transfer in mammals have
already been established in the 1980s using blastomeres
from early-stage embryos as donor cells [60, 61]. The
assumption was that the closer the nuclear donor is
developmentally to the early embryonic stage, the more
successful nuclear transfer is likely to be. This was mainly
based on earlier findings in frogs, in which cloning with
embryonic cells was possible with the production of
normal offspring, whereas cloning with adult cells was
only compatible with the development into tadpoles [62].
This assumption dominated biology until the birth of
‘Dolly’ in 1996 – the first cloned sheep generated from an
adult mammary gland cell [13]. Common somatic cloning
http://www.cababstractsplus.org/cabreviews
protocols involve the following major technical steps
(Figure 1):
(1) Enucleation of the recipient oocyte: Oocytes at the
metaphase II (MII) stage rather than any other
developmental stage are the most appropriate recipients
for the production of viable cloned mammalian
embryos. These oocytes possess high levels of
maturation promoting factor (MPF), which is thought
to be critical for development of the reconstructed
embryo [63]. In many domesticated species, oocytes
can be obtained from abattoir ovaries, thus providing
a potentially unlimited source of material for cloning
experiments. Oocytes are enucleated by sucking or
squeezing out a small portion of the oocyte cytoplasm,
specifically the portion closely apposed to the
first polar body, where the MII chromosomes are
usually located.
(2) Preparation and subzonal transfer of the donor cell: The
entire intact donor cell, i.e. nucleus plus cytoplasm, is
isolated from a cell culture dish by trypsin treatment
and is inserted under the zona pellucida in intimate
contact with the cytoplasmic membrane of the oocyte
with the aid of an appropriate micropipette. Various
somatic cells, including mammary epithelial cells,
cumulus cells, oviductal cells, leucocytes, hepatocytes,
granulosa cells, epithelial cells, myocytes, neurons,
lymphocytes and germ cells, have successfully been
used as donors for the production of cloned animals

[63–66]. Fetal cells, specifically fibroblasts, have frequently
been used in somatic cloning experiments,
because they are thought to have less genetic damage
and a higher proliferative capacity than adult somatic
cells. One option to improve cloning efficiency could
be using less-differentiated cells (foetal or stem cells)
to minimize the complicated and error-prone reprogramming
process. Somatic stem cells have been used
successfully to give porcine blastocyst development
and the birth of live piglets [67, 68].
In most experiments, donor cells are induced to
exit the cell cycle by serum deprivation, which arrests
cells at the G0/G1 cell cycle stage [69]. Serum
deprivation of foetal fibroblasts for more than 72 h
has been found to be associated with increased
apoptosis rates [70, 71]. Specific cyclin-dependent
kinases, such as roscovitin, have been reported to
increase the efficiency of the cloning process,
although final evidence in the form of a healthy offspring
is lacking [63]. Nevertheless, unsynchronized
somatic donor cells have been successfully used to
clone offspring in mice and cattle [72, 73].
(3) Fusion of the two components: Enucleated oocyte and
donor cell are fused, usually by short, high-voltage
pulses through a point of contact between the two
cells.
(4) Activation of the reconstructed complex: Activation is
achieved either by short electrical pulses, or by brief
exposure to chemical substances such as ionomycin
or dimethylaminopurin (DMAP), regulating the calcium
influx into the complexes and/or the cell cycle.
(5) Temporary culture of the reconstructed embryos: Cloned
embryos can be cultured in vitro to the blastocyst
stage (5–7 days) to assess the initial developmental
competence prior to transfer into a foster mother.
Culture systems for ruminant embryos are quite
advanced and allow the routine production of 30–40%
blastocysts from in vitro-fertilized oocytes isolated
from abattoir ovaries [74, 75].
(6) Transfer to a foster mother or storage in liquid nitrogen:
Bovine embryos at the morula and blastocyst
stage can be transferred non-surgically to the uterine
horns of synchronized recipients using established
embryo-transfer procedures. In pigs, the activated
nuclear transfer complexes are immediately transferred
into the oviducts of the recipient because
the in vitro culture systems for embryos are not yet
as effective as in cattle. This requires a surgical
intervention under general anaesthesia.
To date, somatic nuclear transfer has been successful in
13 mammalian species (sheep [13], cow [72], mouse [76],
goat [77], pig [78–80], rabbit [81], cat [82], horse [83],
mule [84], rat [85], dog [86], ferret [87], wolf [88]) and
also in the generation of cloned offspring from endangered
species and breeds [89–92]. Attempts to preserve
livestock genetic resources by somatic cell banking have
http://www.cababstractsplus.org/cabreviews
Wilfried A. Kues, Detlef Rath and Heiner Niemann 5
been reported [93, 94]. However, the typical success rate
(live births) of mammalian somatic nuclear transfer is low:
usually only 1–2%. Cattle seem to be an exception
to this rule as levels of 15–20% can be reached [95].
Recently, we have obtained significant improvement of
porcine cloning success by a better selection and an
optimized treatment of the recipients, specifically by
providing a 24 h asynchrony between the pre-ovulatory
oviducts of the recipients and the reconstructed embryos.
Presumably, this gave the embryos additional time to
achieve the necessary level of nuclear reprogramming.
This resulted in pregnancy rates of 80% and only slightly
reduced litter size [96].
Pre- and post-natal development can be compromised
and a variable proportion of the offspring in ruminants
and mice show aberrant developmental patterns and
increased perinatal mortality. These abnormalities include
a wide range of symptoms, such as extended gestation
length, oversized offspring, aberrant placenta, cardiovascular
problems, respiratory defects, immunological deficiencies,
problems with tendons, adult obesity, kidney and
hepatic malfunctions, behavioural changes and a higher
susceptibility to neonatal diseases and are summarized as
‘Large Offspring Syndrome’ (LOS) [97–101]. The incidence
is stochastic and has not been correlated with
aberrant expression of single genes or specific pathophysiology.
A new term ‘Abnormal Offspring Syndrome’
(AOS) with sub classification according to the outcome
of such pregnancies has recently been proposed to
reflect better the broad spectrum of this pathological
phenomenon [102]. The general assumption is that the
underlying cause for these pathologies is insufficient or
faulty reprogramming of the transferred somatic cell
nucleus.
However, a critical survey of the published literature on
cloning of animals revealed that albeit the higher pre- and
neonatal death rates of clones, most postnatal clones are
healthy and develop normally [103, 104]. This is consistent
with the finding that mammalian development is
rather tolerant of minor epigenetic aberrations in the
genome and subtle abnormalities in gene expression do
not interfere with the survival of cloned animals [105].
It has become clear that once cloned offspring have survived
the neonatal period and are approximately 6 months
of age (cattle, sheep), they are not different from agematched
controls with regard to numerous biochemical
blood and urine parameters [106, 107], immune status
[106], body score [106], somatotrophic axis [108], reproductive
parameters [109], and yields and composition
of milk [110]. No differences were found in meat and milk
composition of bovine clones when compared with agematched
counterparts; all parameters were within the
normal range [111–113]. Similar findings were reported
for cloned pigs [114]. There is a unanimous consent
across various regulatory agencies around the world
that food derived from cloned animals is safe and there
is no scientific basis for questioning this [115], according

6 Perspectives in Agriculture, Veterinary Science, Nutrition and Natural Resources
Table 2 Important genomic features of selected livestock species and dog
Species
Genome
size (10 9 bp) Chr. PC genes Pseudogenes
Cow 3.25 29+X/Y 21 800 1296 2496
Dog 2.39 38+X/Y 19 300 1742 2448
Chicken 1.05 32+W/Z 16 700 96 655
to the expert committee from the Japanese Ministry of
Agriculture, Forestry and Fisheries (MAFF) [116], the
FDA (Food and Drug Administration) [117] and EFSA
(European Food Safety Agency) [118]. However, given the
limited experience with somatic cloning (which has only
been in general use since 1997) and the relatively long
generation intervals in domestic animals, specific effects of
cloning on longevity and senescence have not yet been
fully assessed. Preliminary data indicate no pathology in
serial cloning of mice and cattle [119, 120].
It has to be kept in mind that the clones frequently
differ in a number of characteristics, because the two
cytoplasms involved contain different maternal proteins,
RNAs and mitochondrial DNAs. In addition, several
epigenetic and environmental factors contribute to differences
amongst groups of clones. Despite current limitations,
somatic cloning has already emerged as an
essential novel tool in basic biological research and holds
great application perspectives, including the transgenic
animal production.
Genome Sequencing in Livestock Species
Livestock genomics has followed the path that the human
genome sequencing project has set, exploiting both
strategy and technology. At the start of the Human
Genome (HUGO) project, it was calculated that
sequencing of one DNA base pair (bp) would cost around
$1, thus sequence identification of the haploid human
genome with approximately 3 10 9 bp was calculated to
cost US $3 billion. Over the past decade, impressive
improvements in sequencing techniques and automatization
have substantially reduced these costs. Today,
sequencing of one mammalian genome would cost about
US $100 000 and this price might be reduced even further
through a better technology [121]. The sequencing and
annotation of the human genome revealed a dramatically
lower number of protein-coding genes than originally
thought ( 20 000 versus 150 000 genes) [122], which
corresponds well with estimates for other vertebrate
species [123, 124]. The bovine genome is currently at
the 4.0 read and 90% of the genes have been allocated
to chromosomes [125] (Table 2). The chicken genomic
map first became available in 2004 and is accessible
from the International Chicken Genome Sequencing
RNA
genes
Chr., autosomal chromosome number and sex chromosomes; PC genes, number of identified protein coding genes; Pseudogenes, number
of annotated pseudogenes; RNA genes, number of annotated RNA genes (RNA genes are not translated and act as structural or functional
transcripts). Data retrieved from Ensembl.
http://www.cababstractsplus.org/cabreviews
Consortium [126]. The dog genome followed in 2005
[127]. A draft sequence of the horse genome has
been released recently (www.broad.mit.edu.mammals.
horse). Open access to comprehensive genome information
is provided by Ensembl (www.ensembl.org), University
of California Santa Cruz (http://genome.ucsc.edu)
or the National Center for Biotechnology Information
(www.ncbi.org).
The Ensembl project provides genome information for
47 species, including complete and pre-release low coverage
of genomes of several livestock, other mammalian,
vertebrate and non-vertebrate species. These genome
data are valuable resources for the study of comparative
genomics. Ensembl includes also polymorphism data, such
as SNPs (single nucleotide polymorphisms) for 10 species.
This database will be complemented by new biological
data resources such as protein–DNA interaction (ChiP–
chip) maps originating from the combination of genomewide
chromatin immunoprecipitation (ChiP) with DNA
microarray (chip) technology. The Ensembl browser
allows visualization of genome data in an individualized
manner. Figure 2 provides an example and shows a
100 kilobase (kb) region of bovine chromosome 2
including the locus of the myostatin (GDF8) gene. Loss of
function mutations of this gene results in muscle overgrowth
as observed in several beef cattle breeds [128–
130]. In Texel sheep, a gene mutation of the GDF8 gene
produces a false microRNA target site, resulting in
immediate transcript degradation and muscular hypertrophy
[131]. In humans, a splice-site mutation of the
GDF8 gene was found to cause pathological muscular
hypertrophy [132]. This illustrates the great potential of
comparative genomics using the Ensembl database. Direct
access to genomic data and cell clones allows us to
compare genomic regions of interest within populations
or to design genetic modifications with a so far unprecedented
speed and accuracy.
For complex trait dissection, it is equally important to
characterize the genetic variation within a population.
Microsatellite markers and SNPs are the most commonly
used polymorphisms for this purpose and have already
revealed a surprisingly high degree of genetic variability in
cattle [125]. SNP chips are rapidly being developed for
farm animals. Affymetrix already offers a bovine 10 K SNP
panel and Illuma has developed SNP chips for poultry, pigs
and cattle with 7–25 K SNPs.

Figure 2 A 100 kb region of bovine chromosome 2 extracted from Ensembl. The region contains the gene locus of the
myostatin gene (GDF8) encoding a major growth factor regulating muscle growth. Sequence information can be downloaded,
and additional information such as GC ratio, CpG islands, SNP data and repeat elements can be assessed
Genomic data can be used for improving selective
breeding. Traditional methods of selection are based
on selecting for quantitative traits using breeding value
estimates calculated from measured traits, genetic covariances
among traits and the pedigree relationships in
populations. In contrast, selection using genomic information
supplements phenotypic data with knowledge of
the individual genotypes in a population for known relevant
gene variants (=alleles). This process is significantly
quicker and at the same time can easily be applied to traits
with low heritability and slow genetic change. The prerequisite
for genomic selection is knowledge of the trait
data, the QTL (Quantitative Trait Locus) or the gene.
Current SNP maps are not yet dense enough to allow
full exploitation of the potential in effective breeding
programmes. Another important use of genomic data
is to study expression patterns (transcriptomics or proteomics)
and the production of transgenic animals tailored
for specific production niches or areas.
Gene Expression Profiling of
Preimplantation Embryos
http://www.cababstractsplus.org/cabreviews
Wilfried A. Kues, Detlef Rath and Heiner Niemann 7
Complex organisms exploit a variety of regulatory
mechanisms to extend the functionality of their genomes
[133], including differential promoter activation, alternative
RNA splicing, RNA modification, RNA editing,
localization, translation and stability of RNA, expression
of non-coding RNA, antisense RNA and microRNAs

8 Perspectives in Agriculture, Veterinary Science, Nutrition and Natural Resources
Figure 3 Transcriptome complexity and coverage of DNA expression arrays. Besides protein-coding transcripts, an
unexpected large number of non-translated transcripts are expressed from the mammalian genome. Non-coding RNAs
(ncRNA) include functional long ncRNAs such as XIST, AIR, CTN and PINK, and structural transcripts such as telomerase
RNA (TERC), transfer RNA (tRNA) and ribosomal RNAs (rRNA). Small RNAs mainly act as regulatory units and include
snoRNAs, microRNAs, siRNAs and piRNAs. The number of ncRNAs and small RNAs encoded within the genome is
unknown. Recent transcriptomic studies suggest the presence of over 20 000 long ncRNAs and at least as many small
regulatory RNAs
[134–138]. These mechanisms mostly act at the RNA
level and all together form the functional transcriptome
of an organism (Figure 3). Tissue-specific transcriptomic
profiles indicate important features of the regulatory
process.
During the past decade, efficient high-throughput
methods have been developed for whole genome sequencing,
transcriptome and proteome analyses [121,
139, 140]. The rapid improvements of DNA microarraytechnologies
and the availability of multi-species sequence
databases, such as the Gene Ontology database (www.
geneontology.org) and the Kyoto Encyclopaedia of Genes
and Genomes (KEGG) (www.genome.jp/kegg), have made
it possible to compare gene expression profiles both
within a single organism and across a wide variety of
organisms on a large scale. These technologies are crucial
to improve the efficiency and safety of oocyte-/embryorelated
biotechniques, to facilitate the development of
novel therapies based on regenerative medicine and to
ensure the quality of biotechnologically derived products
at the molecular level.
In vitro culture of preimplantation embryos is frequently
associated with significant alterations in chromatin configuration
and gene expression [141–143]. In vitro production
of bovine embryos is usually necessary to provide
the large numbers of embryos needed for an array analysis
http://www.cababstractsplus.org/cabreviews
in this species, but it is clear that the changes in embryonic
transcription induced by the culture method itself
seriously affect the transcriptional profile. The application
of array technology to the analysis of preimplantation
embryos poses specific challenges associated with the
picogram levels of mRNA in a single embryo, the plasticity
of the embryonic transcriptome and the difficulties in
obtaining in vivo developing embryos. Gene expression
patterns in mammalian embryos are more complex than
those in most somatic cells because of the dramatic
restructuring of paternal chromatin, the major onset of
embryonic transcription, events related to the cellular
differentiation at morula stage, blastocyst hatching and
implantation. Embryo development is first dependent on
maternally stored transcripts, which are gradually depleted
until the embryo produces its own transcripts after
embryonic genome activation [144]. The gene expression
patterns and RNA stability in oocytes and early embryos
prior to the activation of embryonic expression are
dramatically different from what is seen after the major
onset of embryonic transcription [145, 146]. The onset of
embryonic gene transcription occurs at a species-specific
time point; in mice, the major activation starts in late 1cell
embryos; in humans and pigs, it occurs in 4-cell stages
and in bovine embryos, is delayed until the 8–16-cell stage
[147]. Given the late onset of this maternal-to-embryonic

transition in bovine embryos, they provide an excellent
model in which to study early reprogramming events in
detail. Major epigenetic reorganization also occurs during
preimplantation development. This includes DNA demethylation
and methylation as well as targeted modifications
of histone methylation and acetylation, all of which
play a role in controlling chromatin remodelling and
X-chromosome inactivation [148].
Transcriptome profiling by DNA array technology has
been reported for human, mouse, bovine and porcine
preimplantation embryos [145, 146, 147–158, reviewed in
159]. A study of the transcriptional profile of 2-cell mouse
embryos included 4 000 genes from a cDNA-library and
revealed many previously unknown transcripts, including
mobile genetic elements that appear to be associated
with activation of the embryonic genome [160]. The
mRNA expression profile of porcine oocytes, 4- and
8-cell stages and blastocysts was studied with the aid of a
15 K cDNA array specific for porcine reproductive
organs. The transcription profile of in vivo developing
embryos was compared with that of in vitro produced
4-cell, 8-cell and blastocyst-stage embryos. This revealed
1409 and 1696 differentially expressed (in vivo/in vitro)
genes at the 4- and 8-cell stages, respectively [155]. Studies
of the bovine embryonic mRNA expression based on
subtractive hybridization and cDNA arrays have identified
differentially expressed genes between bovine oocytes
derived from large or small follicles. A total of 21 upregulated
genes were found out of 1000 clones [161].
Cross-species hybridization of a human cDNA array
with bovine RNA, derived from rather large pools of
>200 oocytes yielded a first expression profile for bovine
oocytes before and after maturation. Approximately,
300 genes could positively be identified [152, 156, 162].
Recently, we have investigated the mRNA expression
profiles of bovine oocytes and blastocysts by using a
cross-species hybridization approach employing an array
consisting of 15 529 human cDNAs (Ensembl chip) as
probe, thus allowing the identification of conserved genes
during human and bovine preimplantation developments
[157]. The analysis revealed 419 genes that were expressed
in both oocytes and blastocysts. The expression
of 1342 genes was detected exclusively in the blastocyst,
in contrast to 164 in the oocyte, including a significant
number of novel genes. Typically, genes indicative for
transcriptional and translational control, such as ELAVL4
and TACC3 were overexpressed in the oocyte, whereas
genes indicative of numerous pathways were overexpressed
in blastocysts. Transcripts implicated in chromatin
remodelling were found in both oocytes (NASP
SMARCA2, DNMT1) and blastocysts (H2AFY, HDAC7A).
Expression patterns in bovine and human blastocysts
were identical to a large extent [157]. A major advantage
of this cross-species hybridization approach is that
developmentally conserved novel and annotated marker
genes could be identified for human and bovine oocytes
and blastocysts.
http://www.cababstractsplus.org/cabreviews
Wilfried A. Kues, Detlef Rath and Heiner Niemann 9
Affymetrix commercially distributes a bovine genomic
array which is based on the bovine genome sequence data
and covers probe sets of approximately 23 000 transcripts
and 19 000 UniGene clusters. The transcriptomes of
bovine in vitro matured oocytes and in vitro-produced
8-cell stages were analysed by this Affymetrix bovine
array and genes critically involved in major activation of
the embryonic genome were determined [163, 164].
Approximately, 370 genes with functions in chromatin
modification, apoptosis, signal transduction, metabolism
and immune response were differentially expressed
between oocytes and 8-cell stages, including DNMT1,
DNMT2 and MeCP2, which were specifically up-regulated
in 8-cell stages. Recently, we have hybridized RNA from
in vivo-produced bovine oocytes and all stages of bovine
preimplantation development till the blastocyst stage on
the bovine Affymetrix array. For the first time, this analysis
will yield a complete picture of mRNA expression in
the processes of oocyte maturation, fertilization,
embryonic activation and cell lineage differentiation in a
large mammalian species (manuscript in preparation).
Transgenic Animals in Agriculture
Proof-of-principle that introduced recombinant DNA can
result in phenotypic changes in mammals was shown in
1982 by the production of transgenic mice expressing a
rat growth hormone [165]. The first transgenic livestock
species were produced by microinjection of DNA into
a pronucleus of fertilized eggs [14]. Despite numerous
efforts, the production of transgenic farm animals is still
hampered by low efficiencies and high cost. Transgenic
farm animal production has been extensively reviewed by
us in the past few years [12, 95, 166]. The first recombinant
pharmaceutical protein (human antithrombin III,
ATryn 1 ) isolated from the milk of transgenic goats was
approved in June 2006 by the European Medicine Agency
(EMEA), clearly showing the great potential of this
transgenic approach. Whereas the biomedical applications
are quite advanced, agricultural application areas are lagging
behind. Table 3 gives an overview on the various
attempts to produce animals transgenic for agricultural
traits. Prominent examples are: environmentally friendly
pigs, in which phosphorus excretion is reduced by transgenic
expression of the phytase gene [7], transgenic pigs
with an altered pattern of polyunsaturated fatty acids in
skeletal muscle, thus providing healthier pork [10, 169],
cattle with resistance against Staphylococcus aureus mastitis
by transgenic expression of lysostaphin restricted to the
mammary gland [180], or cattle with a knockout of the
prion gene thus rendering cattle non-susceptible to
bovine spongiform encephalopathy (BSE) [11], alterations
of the physicochemical properties of milk by overexpression
of beta- and kappa-casein clearly underpinning
the potential for improvements in the functional properties
of bovine milk [178].

10 Perspectives in Agriculture, Veterinary Science, Nutrition and Natural Resources
Table 3 Overview on successful transgenic livestock for agricultural production
Transgenic trait Key molecule Construct
Gene transfer
method Species Reference
Increased growth rate, less
body fat
Growth hormone (GH) hMT-pGH Microinjection Pig [167]
Increased growth rate, less Insulin-like growth mMT-hIGF-1 Microinjection Pig [168]
body fat
factor-1 (IGF-1)
Increased level of polyunsaturated
fatty acids in pork
Desaturase (from
spinach)
maP2-FAD2 Microinjection Pig [169]
Increased level of poly-
Desaturase (from CAGGS-hfat-1 Somatic Pig [10]
unsaturated fatty acids in pork Caenorhabditis
elegans)
cloning
Phosphate metabolism Phytase PSP-APPA Microinjection Pig [7]
Milk composition (lactose a-lactalbumin Genomic bovine Microinjection Pig [170]
increase)
a-lactalbumin
Influenza resistance Mx protein mMx1-Mx Microinjection Pig [171]
Enhanced disease resistance IgA a,K-a,K Microinjection Pig,
sheep
[172, 175]
Wool growth Insulin-like growth
factor-1 (IGF-1)
Ker-IGF-1 Microinjection Sheep [173, 174]
Visna virus resistance Visna virus envelope Visna LTR-env Microinjection Sheep [175]
Ovine prion locus Prion protein (PRNP) Targeting vector Somatic Sheep [176]
(homologous
recombination)
cloning
1
Milk fat composition Stearoyl desaturase b-lactoglobulin-SCD Microinjection Goat [177]
Milk composition (increase of b-casein Genomic CSN2 Somatic Cattle [178]
whey proteins)
k-casein CSN-CSN-3
cloning
Milk composition (increase of
lactoferrin)
Human lactoferrin a-s2cas-mLF Microinjection Cattle [179]
Staphylococcus aureus
Lysostaphin Ovine b-lactoglobulin Somatic Cattle [180]
mastitis resistance
lysostaphin
cloning
1 Animals dead shortly after birth (from [12]).
With further refinements of the genetic maps many
more agricultural applications will be developed. Further
qualitative improvements may be derived from technologies
that allow precise modifications of the genome,
including targeted chromosomal integration by sitespecific
DNA recombinases such as Cre or flippase (FLP),
or methods that allow temporally and/or spatially controlled
transgene expression [181].
However, it remains to be shown whether transgenic
farm animals will ever be used to improve agricultural
applications, considering the public anxiety against gene
modification and the extraordinary high costs to establish
transgenic lines. Also our current understanding of
genome organization is fragmentary and needs to be
augmented. Improved techniques for transgenesis are
required for a more efficient production of transgenic
animals and to achieve targeted expression. Successful
experiments to improve transgenesis by lentiviral vectors
[182, 183], to achieve conditional expression [184] and to
exploit large genomic sequences [185] are important
steps in this direction. A powerful tool is RNA interference,
which allows the suppression of specific mRNAs
[186, 187]. The potential of this endogenous regulatory
mechanism is highlighted by a naturally occurring mutation
in Texel sheep, which results in an illegitimate target site
http://www.cababstractsplus.org/cabreviews
for endogenous microRNA in the myostatin (GDF8)
transcript, resulting in rapid degradation of the mRNA and
muscular hypertrophy [131]. Specific degradation of
myostatin transcripts can be mimicked by short interfering
RNAs (siRNAs), illustrating the potential of RNAi for
breeding purposes. For a transient gene knockdown,
synthetic siRNAs are transfected in cells or early embryos
[188, 189]. For stable gene repression, the siRNA
sequences must be incorporated into a gene construct.
RNAi knockdown of porcine endogenous retroviruses
(PERV) has been shown in porcine primary cells and
cloned piglets [190, 191], as well as knockdown of the
prion protein gene (PRNP) in cattle embryos [192].
Germline transmission of lentiviral siRNA has been shown
in rats over three generations [193]. In contrast to
knockout technologies, which require time-consuming
breeding strategies to obtain homozygous knockout lines,
RNAi can rapidly be integrated into existing breeding
lines.
The first transgenic animals to be commercially
marketed are ornamental fishes expressing recombinant
fluorescent proteins, which are sold for their fanciness.
Transgenic medaka (Oryzias latipes, rice fish) with a
fluorescent green colour [194] were approved for sale in
Taiwan. Transgenic zebrafishes (Danio rerio) with several

fluorescent colours [195] are sold under the brand name
Glofish 1 in the USA [196]. The fluorescent fishes might
act as ‘door-opener’ for gene modifications in other
species.
Recombinant DNA as New Vaccines
Recombinant DNA techniques and the emerging genomic
sequence information will be useful for novel applications,
such as the development of a new class of vaccines.
For DNA vaccination the transient presence of the coding
sequence of a pathogen is sufficient to stimulate an
immune response of the treated organism. The ongoing
biodiversity genome-sequencing project (e.g. www.
ncbi.org) facilitates access to sequence data of pathogenic
organisms, and combined with current DNA synthesis
methods DNA vaccines can be produced within a short
period of time. The first DNA vaccine was approved
by the US Department of Agriculture (USDA) in 2005
(www.aphis.usda.gov/lpa/news/2005/07/wnvdna_vs.html);
the vaccine is designed to protect horses against West
Nile Virus. The development of DNA vaccines is based on
the finding that injection of plasmid DNA into skeletal
muscle is compatible with the production of ectopic
proteins [197]. The main advantages of DNA vaccines are:
DNA plasmids can be easily and at low costs prepared
in compliance with GMP standards, DNA plasmids
are extremely stable in lyophilized form, design of the
plasmids is flexible, unlike attenuated pathogens DNA
plasmids bear no risk of pathogen formation, and DNAvaccinated
animals can be discriminated from their infected
counterparts [198, 199].
The principle of a DNA vaccine is that a gene sequence
encoding for one or more protein epitopes of the
pathogen is subcloned behind a strong eukaryotic promoter
in a plasmid vector. The plasmid is amplified in a
bacterial mass culture and then highly purified by ion
exchange columns. The plasmid is then injected into
muscle tissue, taken up by some muscle fibres and
translocated into myonuclei. The eukaryotic promoter
drives expression of pathogenic DNA sequences, resulting
in the presentation of pathogen epitopes on the
cell surface followed by triggering both a humoral and a
cellular immune response of the vaccinated organism.
Plasmid DNA was found to be degraded within a few
weeks after intramuscular injection in pigs [200]. Since
only partial sequences of the pathogen’s genome are used,
no functional pathogen can be produced and vaccinated
animals be discriminated from infected animals, which
show antibody formation against all epitopes.
Outlook
Development in animal genomics have broadly followed
the path that the human genome field has led, both in
http://www.cababstractsplus.org/cabreviews
Wilfried A. Kues, Detlef Rath and Heiner Niemann 11
Figure 4 A perspective for molecular breeding based on
genomic data and ES cells
terms of completeness of data and in developing tools
and applications as demonstrated by the recent availability
of advanced drafts of the maps of the bovine, chicken,
dog and horse genomes. The possibility of extending
knowledge through deliberately engineering change in the
genome is unique to animals and is currently being
developed through the integration of advanced molecular
tools and breeding technologies. However, the full realization
of this exciting potential is handicapped by gaps in
our understanding of embryo genomics and epigenetic
mechanisms which are critical in the production of healthy
offspring.
The convergence of the recent advances in reproductive
technologies with the tools of molecular biology
opens a new dimension for animal breeding. Major prerequisites
are the continuous refinement of reproductive
biotechnologies and a rapid completion and refinement of
livestock genomic maps. A critical role in this context is
played by embryonic stem cells (ES cells). The availability
of cells with true pluripotent properties in conjunction
with exploitation of genomic data will allow molecular
breeding programmes that are significantly faster and
more effective than current programmes (Figure 4).
Despite numerous efforts, no ES cells with germ line
contribution have been established from mammals
other than mouse. ES-like cells, i.e. cells that share several
parameters with true ES cells, have been reported in
several species [201]. The recent finding that the transgenic
expression of four transcription factors (Oct4, Sox2,
Klf4 and c-Myc) convert murine fibroblasts into pluripotent
ES cells [202] will stimulate similar approaches in
livestock (Figure 4). Genetically modified animals will
play a growing role in the biomedical field. Agricultural
application might be further down the track given
the complexity of some of the economically important
traits.
The efficient use of domestic animals is urgently needed
in light of the worldwide shortage of arable land and the
ever increasing human population. Genomics offers great
opportunities to improve livestock production in the
developed world and advance the ‘livestock revolution’ in

12 Perspectives in Agriculture, Veterinary Science, Nutrition and Natural Resources
the developing world [203]. In addition to the already
exploited biomedical potential, biotechnology in farm
animals with a strong link to genomic technologies can
make a significant contribution towards a more efficient,
highly diversified and targeted, and thus sustainable animal
production. The challenge for scientists and practitioners
is to exploit the great potential of animal biotechnology
for the benefits of the mankind.
References
1. Larson G, Albarella U, Dobney K, Rowley-Conwy P, Schibler
J, Tresset A, et al. Ancient DNA, pig domestication, and the
spread of the Neolithic into Europe. Proceedings of the
National Academy of Sciences of the United States of
America 2007;104:15276–81.
2. Beja-Pereira A, Caramelli D, Lalueza-Fox C, Vernesi C,
Ferrand N, Casoli A, et al. The origin of European cattle:
evidence from modern and ancient DNA. Proceedings of the
National Academy of Sciences of the United States of
America 2006;103:8113–8.
3. Fries R, Ruvinsky A (editors). The Genetics of Cattle. CAB
International, Wallingford, UK; 1999.
4. Weitze KF. Update of the world wide application of swine AI.
In: Johnson LA, Guthrie HD, editors. Boar Semen
Preservation IV. Allen Press Inc, Lawrence, KS, USA;
2000, p. 141–5.
5. Seidel Jr GE. Sexing mammalian spermatozoa and embryos
– state of the art. Journal of Reproduction and Fertility
1999;54 Suppl.:477–87.
6. Thibier M. New records in the numbers of both in vivo-derived
and in vitro-produced bovine embryos around the world in
2006. IETS-Newsletter 2007;25:15–20.
7. Golovan SP, Meidinger RG, Ajakaiye A, Cottrill M,
Wiederkehr MZ, Barney DJ, et al. Pigs expressing salivary
phytase produce low-phosphorus manure. Nature
Biotechnology 2001;19:741–5.
8. Dai Y, Vaught TD, Boone J, Chen SH, Phelps CJ,
Ball S, et al. Targeted disruption of the
alpha1,3-galactosyltransferase gene in cloned pigs.
Nature Biotechnology 2002;20(3):251–5.
9. Lai L, Kolber-Simonds D, Park KW, Cheong HT, Greenstein
JL, Im GS, et al. Production of alpha-1,3galactosyltransferase
knockout pigs by nuclear transfer
cloning. Science 2002;295(5557):1089–92.
10. Lai L, Kang JX, Li R, Wang J, Witt WT, Yong HY, et al.
Generation of cloned transgenic pigs rich in omega-3 fatty
acids. Nature Biotechnology 2006;24:435–6.
11. Richt J, Kasinathan P, Hamir AN, Castilla J, Sathiyaseelan T,
Vargas F, et al. Production of cattle lacking prion protein.
Nature Biotechnology 2007;25:132–8.
12. Niemann H, Kues WA. Transgenic farm animals: an update.
Reproduction Fertility and Development 2007;19:762–70.
13. Wilmut I, Schnieke AE, McWhir J, Kind AJ, Campbell KH.
Viable offspring derived from fetal and adult mammalian cells.
Nature 1997;385:810–3.
http://www.cababstractsplus.org/cabreviews
14. Hammer RE, Pursel VG, Rexroad Jr CE, Wall RJ, Bolt DJ,
Ebert KM, et al. Production of transgenic rabbits, sheep and
pigs by microinjection. Nature 1985;315:680–3.
15. Koopman P, Gubbay J, Vivian N, Goodfellow P, Lovell-Badge
R. Male development of chromosomally female mice
transgenic for Sry. Nature 1991;351:117–21.
16. Johnson LA. Gender preselection in domestic animals using
flow cytometrically sorted sperm. Journal of Animal Science
1992;70 Suppl. 2 :8–18.
17. Johnson LA, Flook JP, Hawk HW. Sex preselection in rabbits:
live births from X and Y sperm separated by DNA and cell
sorting. Biology of Reproduction 1989;41:199–203.
18. Johnson LA, Flook JP, Look MV. Flow cytometry of X and
Y chromosome-bearing sperm for DNA using an improved
preparation method and staining with Hoechst 33342.
Gamete Research 1987;17:203–12.
19. Johnson LA, Welch GR. Sex preselection: high-speed flow
cytometric sorting of X- and Y-sperm for maximum efficiency.
Theriogenology 1999;52:1134–323.
20. Johnson LA. Sex preselection in swine: altered sex ratios in
offspring following surgical insemination of flow sorted X- and
Y-bearing sperm. Reproduction in Domestic Animals
1991;26:309–14.
21. Rath D, Long CR, Dobrinsky JR, Welch GR, Schreier LL,
Johnson LA. In vitro production of sexed embryos for gender
preselection: high-speed sorting of X-chromosome-bearing
sperm to produce pigs after embryo transfer. Journal of
Animal Science 1999;77:3346–52.
22. Johnson LA, Flook JP, Look MV, Pinkel D. Flow sorting of
X and Y chromosome-bearing spermatozoa into two
populations. Gamete Research 1987;16:1–9.
23. Welch GR, Johnson LA. Sex preselection: laboratory
validation of the sperm sex ratio of flow sorted X- and
Y-sperm by sort reanalysis for DNA. Theriogenology
1999;52:1343–52.
24. Kawarasaki T, Welch GR, Long CR, Yoshida M, Johnson LA.
Verification of flow cytometorically sorted X- and Y-bearing
porcine spermatozoa and reanalysis of spermatozoa for DNA
content using the fluorescence in situ hybridization (FISH)
technique. Theriogenology 1998;50:625–35.
25. Rens W, Yang F, Welch G, Revell S, O’Brien PCM, Solanky
N, et al. An X-Y paint set and sperm FISH protocol that can
be used for validation of cattle sperm separation procedures.
Reproduction 2001;121:541–6.
26. Welch GR, Waldbieser GC, Wall RJ, Johnson LA. Flow
cytometric sperm sorting and PCR to confirm separation of
X- and Y-chromosome bearing bovine sperm. Animal
Biotechechnology 1995;6:131–9.
27. Seidel Jr GE, Allen CH, Johnson LA, Holland MD, Brink Z,
Welch GR, et al. Uterine horn insemination of heifers with
very low numbers of non-frozen and sexed spermatozoa.
Theriogenology 1997;48:1255–64.
28. Den Daas JH, De Jong G, Lansbergen LM, Van Wagtendonk-
De Leeuw AM. The relationship between the number of
spermatozoa inseminated and the reproductive efficiency of
individual dairy bulls. Journal of Dairy Science
1998;81(6):1714–23.
29. Klinc P, Rath D. Reduction of oxidative stress in bovine
spermatozoa during flow cytometric sorting. Reproduction in
Domestic Animals 2007;42:63–7.

30. Rath D, Ruiz S, Sieg B. Birth of female piglets following
intrauterine insemination of a sow using flow cytometrically
sexed boar semen [abstract]. Veterinary Record
2003;152:400–1.
31. McNutt TL, Johnson LA. Flow cytometric sorting of sperm:
influence on fertilization and embryo/fetal development in the
rabbit. Molecular Reproduction and Development
1996;43:261–7.
32. Cran DG, Cochrane DJ, Johnson LA, Wei H, Lu KH, Polge C.
Separation of X- and Y-chromosome bearing bovine sperm
by flow cytometry for use in IVF [abstract]. Theriogenology
1994;41:183.
33. Lu KH, Cran DG, Seidel GE. In vitro fertilization with flowcytometrically-sorted
bovine sperm. Theriogenology
1999;52:1393–405.
34. Merton JS, Haring RM, Stap J, Hoebe RA, Aten JA. Effect of
flow cytometrically sorted frozen/thawed semen on success
rate of in vitro bovine embryo production [abstract].
Theriogenology 1997;47:295.
35. Beyhan Z, Johnson LA, First NL. Sexual dimorphism in
IVM-IVF bovine embryos produced from X and Y
chromosome-bearing spermatozoa sorted by high speed flow
cytometry. Theriogenology 1999;52:35–48.
36. Johnson LA, Cran DG, Welch GR, Polge C. Gender
preselection in mammals. In: Miller RH, Pursel VG, Norman
HD, editors. Beltsville Symposium XX: Biotechnology’s Role
in the Genetic Improvement of Farm Animals. American
Society of Animal Science, Savoy, IL; 1996. p. 151–4.
37. Schenk JL, Seidel Jr GE. Pregnancy rates in cattle with
cryopreserved sexed spermatozoa: effects of laser intensity,
staining conditions and catalase. Society of Reproduction and
Fertility 2007;Suppl. 64:165–77.
38. Catt SL, Sakkas D, Bizzaro D, Bianchi PG, Maxwell WMC,
Evans G. Hoechst staining and exposure to UV laser during
flow cytometric sorting does not affect the frequency of
detected endogenous DNA nicks in abnormal and normal
human sperm. Molecular Human Reproduction 1997;
3:821–5.
39. Parrilla I, Vazquez JM, Cuello C, Gil MA, Roca J,
Di Berardino D, et al. Hoechst 33342 stain and u.v. laser
exposure do not induce genotoxic effects in flow-sorted boar
spermatozoa. Reproduction 2004;128:615–21.
40. Campos-Chillon LF, de la Torre JF. Effect on concentration of
sexed bovine sperm sorted at 40 and 50 psi on
developmental capacity of in vitro produced embryos
[abstract]. Theriogenology 2003;59:506.
41. Suh TK, Schenk JL, Seidel Jr GE. High pressure flow
cytometric sorting damages sperm Theriogenology
2005;64:1035–48.
42. Morton KM, Herrmann D, Sieg B, Struckmann C, Maxwell
WM, Rath D. Altered mRNA expression patterns in bovine
blastocysts after fertilisation in vitro using flow-cytometrically
sex-sorted sperm. Molecular Reproduction and Development
2007;74:931–40.
43. Bermejo-Alvarez P, Rizos D, Rath D, Lonergan P, Gutierrez-
Adan A. Epigenetic differences between male and female
bovine blastocysts produced in vitro. Physiological Genomics
2008;32:264–72.
44. Cran DG, Johnson LA, Miller NGA, Cochrane D, Polge CE.
Production of bovine calves following separation of X- and
http://www.cababstractsplus.org/cabreviews
Wilfried A. Kues, Detlef Rath and Heiner Niemann 13
Y-bearing sperm and in vitro fertilization. Veterinary Record
1993;132:40–1.
45. Morton KM, Catt SL, Maxwell WM, Evans G. An efficient
method of ovarian stimulation and in vitro embryo production
from prepubertal lambs. Reproduction Fertility and
Development 2005;17:701–6.
46. Klinc P, Frese D, Osmers H, Rath D. Insemination with sex
sorted fresh bovine spermatozoa processed in the presence
of antioxidative substances. Reproduction in Domestic
Animals 2007;42:58–62.
47. Klinc P. Improved fertility of flowcytometrically sex selected
bull spermatozoa [dissertation]. Veterinary University,
Hannover, Germany; 2005.
48. Garcia EM, Vazquez JM, Parrilla I, Calvete JJ, Sanz L,
Caballero I, et al. Improving the fertilizing ability of sex sorted
boar spermatozoa. Theriogenology 2007;68:771–8.
49. Centurion F, Vazquez JM, Calvete JJ, Roca J, Sanz L,
Parrilla I, et al. Influence of porcine spermadhesins on the
susceptibility of boar spermatozoa to high dilution. Biology
of Reproduction 2003;69:640–6.
50. Maxwell WM, Parrilla I, Caballero I, Garcia E, Roca J,
Martinez EA, et al. Retained functional integrity of bull
spermatozoa after double freezing and thawing using
PureSperm density gradient centrifugation. Reproduction in
Domestic Animals 2007;42:489–94.
51. Grossfeld R, Klinc P, Sieg B, Rath D. Production of piglets
with sexed semen employing a non-surgical insemination
technique. Theriogenology 2005;63:2269–77.
52. Bathgate R, Grossfeld R, Susetio D, Ruckholdt M, Heasman
K, Rath D, et al. Early pregnancy loss in sows after low dose,
deep uterine artificial insemination with sex-sorted, frozenthawed
sperm. Animal Reproduction Science 2008;
104(3–4):440–4.
53. Cuello C, Berthelot F, Martinat-Botte´ F, Venturi E, Guillouet
P, Va´zquez JM, et al. Piglets born after non-surgical deep
intrauterine transfer of vitrified blastocysts in gilts. Animal
Reproduction Science 2005;85:275–86.
54. Clulow JR, Buss H, Sieme H, Rodger JA, Cawdell-Smith AJ,
Evans G, et al. Field fertility of sex-sorted and non-sorted
frozen-thawed stallion spermatozoa. Animal Reproduction
Science 2008 [Epub ahead of print doi:10.1016/
j.anireprosci.2007.08.015].
55. Heer P. Adjustment of cryoperservation of stallion
spermatozoa to the Beltsville Sperm Sexing Technology
[dissertation]. Veterinary University, Hannover, Germany;
2007.
56. Rath D, Johnson LA, Welch GR. In vitro culture of porcine
embryos: development to blastocysts after in vitro fertilization
(IVF) with flow cytometrically sorted and unsorted semen
[abstract]. Theriogenology 1993;39:293.
57. Rath D, Johnson LA, Dobrinsky JR, Welch GR, Niemann H.
Production of piglets preselected for sex following in vitro
fertilization with X and Y chromosome-bearing spermatozoa
sorted by flow cytometry. Theriogenology 1997;47:795–800.
58. Abeydeera LR, Johnson LA, Welch GR, Wang WH, Boquest
AC, Cantley TC. Birth of piglets preselected for gender
following in vitro fertilization of in vitro matured pig oocytes by
X and Y chromosome bearing spermatozoa sorted by high
speed flow cytometry. Theriogenology 1998;50:981–8.

14 Perspectives in Agriculture, Veterinary Science, Nutrition and Natural Resources
59. Probst S, Rath D. Production of piglets using intracytoplasmic
sperm injection (ICSI) with flow cytometrically sorted boar
semen and artificially activated oocytes. Theriogenology
2003;59:961–73.
60. Willadsen SM. Nuclear transplantation in sheep embryos.
Nature 1986;320:63–5.
61. Westhusin ME, Pryor JH, Bondioli KR. Nuclear transfer in the
bovine embryo: a comparison of 5-day, 6-day, frozen-thawed,
and nuclear transfer donor embryos. Molecular Reproduction
and Development 1991;28:119–23.
62. Briggs R, King TJ. Transplantation of living nuclei from
blastula cells into enucleated frogs eggs. Proceedings of the
National Academy of Sciences of the United States of
America 1952;38:455–463.
63. Miyoshi K, Rzucidlo SJ, Pratt SL, Stice SL. Improvements in
cloning efficiencies may be possible by increasing uniformity
in recipient oocytes and donor cells (review; published
erratum appears in Biology of Reproduction 2004;70:260).
Biology of Reproduction 2003;68:1079–86.
64. Brem G, Ku¨hholzer B. The recent history of somatic cloning in
mammals (review). Cloning and Stem Cells 2002;4:57–63.
65. Hochedlinger K, Jaenisch R. On the cloning of animals from
terminally differentiated cells. Nature Genetics 2007;
39:136–7.
66. Eggan K, Baldwin K, Tackett M, Osborne J, Gogos J,
Chess A, et al. Mice cloned from olfactory sensory neurons.
Nature 2004;428:44–9.
67. Zhu H, Craig JA, Dyce PW, Sunnen N, Li J. Embryos derived
from porcine skin-derived stem cells exhibit enhanced
preimplantation development. Biology of Reproduction
2004;71:1890–7.
68. Hornen N, Kues WA, Carnwath JW, Lucas-Hahn A, Petersen
B, Hassel P, et al. Production of viable pigs from fetal somatic
stem cells. Cloning and Stem Cells 2007;9:364–73.
69. Campbell KH, McWhir J, Ritchie WA, Wilmut I. Sheep cloned
by nuclear transfer from a cultured cell line. Nature
1996;380:64–6.
70. Kues WA, Anger M, Carnwath JW, Paul D, Motlik J,
Niemann H. Cell cycle synchronization of porcine fibroblasts:
effects of serum deprivation and reversible cell cycle
inhibitors. Biology of Reproduction 2000;62:412–9.
71. Kues WA, Carnwath JW, Paul D, Niemann H. Cell cycle
synchronization of porcine fetal fibroblasts by serum
deprivation initiates a nonconventional form of apoptosis.
Cloning and Stem Cells 2002;3:231–43.
72. Cibelli JB, Stice SL, Golueke PJ, Kane JJ, Jerry J,
Blackwell C, et al. Cloned transgenic calves produced from
nonquiescent fetal fibroblasts. Science
1998;280(5367):1256–8.
73. Wakayama T, Rodriguez I, Perry AC, Yanagimachi R,
Mombaerts P. Mice cloned from embryonic stem cells.
Proceedings of the National Academy of Sciences of the
United States of America 1999;96:14984–9.
74. Rizos D, Ward F, Duffy P, Boland MP, Lonergan P.
Consequences of bovine oocyte maturation, fertilization or
early embryo development in vitro vs. in vivo: implications for
blastocysts yields. Molecular Reproduction and Development
2002;61:234–48.
75. Niemann H, Wrenzycki C, Lucas-Hahn A, Brambrink T,
Kues WA, Carnwath JW. Gene expression patterns in bovine
http://www.cababstractsplus.org/cabreviews
in vitro-produced and nuclear transfer-derived embryos and
their implications for early development. Cloning and Stem
Cells 2002;4:29–38.
76. Wakayama T, Perry AC, Zuccotti M, Johnson KR,
Yanagimachi R. Full-term development of mice from
enucleated oocytes injected with cumulus cell nuclei. Nature
1998;394(6691):369–74.
77. Baguisi A, Behboodi E, Melican DT, Pollock JS, Destrempes
MM, Cammuso C, et al. Production of goats by somatic cell
nuclear transfer. Nature Biotechnology 1999;17(5):456–61.
78. Betthauser J, Forsberg E, Augenstein M, Childs L, Eilertsen
K, Enos J, et al. Production of cloned pigs from in vitro
systems. Nature Biotechnology 2000;18(10):1055–9.
79. Onishi A, Iwamoto M, Akita T, Mikawa S, Takeda K, Awata T,
et al. Pig cloning by microinjection of fetal fibroblast nuclei.
Science 2000;289(5482):1188–90.
80. Polejaeva IA, Chen SH, Vaught TD, Page RL, Mullins J, Ball
S, et al. Cloned pigs produced by nuclear transfer from adult
somatic cells. Nature 2000;407(6800):86–90.
81. Chesne´ P, Adenot PG, Viglietta C, Baratte M, Boulanger L,
Renard JP. Cloned rabbits produced by nuclear transfer from
adult somatic cells. Nature Biotechnology 2002;20(4):366–9.
82. Shin T, Kraemer D, Pryor J, Liu L, Rugila J, Howe L,
et al. A cat cloned by nuclear transplantation. Nature
2002;415:859.
83. Galli C, Lagutina I, Crotti G, Colleoni S, Turini P, Ponderato
N, et al. Pregnancy: a cloned horse born to its dam twin.
Nature 2003;424:635.
84. Woods GL, White KL, Vanderwall DK, Li GP, Aston KI, Bunch
TD, et al. A mule cloned from fetal cells by nuclear transfer.
Science 2003;301:1063.
85. Zhou Q, Renard JP, Le Friec G, Brochard V, Beaujean N,
Cherifi Y, et al. Generation of fertile cloned rats by regulating
oocyte activation. Science 2003;302:1179.
86. Lee BC, Kim MK, Jang G. Dogs cloned from adult somatic
cells. Nature 2005;436:641.
87. Li Z, Sun X, Chen J, Liu X, Wisely SM, Zhou Q, et al. Cloned
ferrets produced by somatic cell nuclear transfer.
Developmental Biology 2006;293:439–48.
88. Kim MK, Jang G, Oh HJ, Yuda F, Kim HJ, Hwang WS, et al.
Endangered wolves cloned from adult somatic cells. Cloning
Stem Cells 2007;9(1):130–7.
89. Wells D, Misica P, Tervit H, Reed W. Adult somatic cell
nuclear transfer is used to preserve the last surviving cow of
the Enderby island cattle breed. Reproduction Fertility and
Development 1999;10:369–78.
90. White K, Bunch T, Mitalipov S, Reed W. Establishment of
pregnancy after the transfer of nuclear transfer embryos
produced from the fusion of argali (Ovis ammon) nuclei into
domestic sheep (Ovis aries) enucleated oocytes. Cloning
1999;1:47–54.
91. Lanza R, Cibelli J, Diaz F, Moraes C, Farin C, Hammer C,
et al. Cloning of an endangered species (Bos taurus) using
interspecies nuclear transfer. Cloning 2000;2:79–90.
92. Loi P, Ptak G, Barboni B, Fulka JJ, Cappai M, Clinton M.
Genetic rescue of an endangered mammal by cross-species
nuclear transfer using post mortem somatic cell. Nature
Biotechnology 2001;19:962–4.

93. Ryder O. Cloning advances and challenges for conservation.
Trends in Biotechnology 2002;20:231–2.
94. Groeneveld E, Tinh NH, Kues W, Vien NT. A protocol for
the cryoconservation of breeds by low-cost emergency cell
banks – a pilot study. Animal 2008;2:1–8.
95. Kues WA, Niemann H. The contribution of farm animals to
human health. Trends in Biotechnology 2004;22:286–94.
96. Petersen B, Lucas-Hahn A, Lemme E, Hornen N, Hassel P,
Niemann H. Preovulatory embryo transfer increases success
of porcine somatic cloning [abstract]. Reproduction Fertility
and Development 2007;19:155–6.
97. Renard JP, Chastant S, Chesne P, Richard C, Marchal J,
Cordonnier N, et al. Lymphoid hypoplasia and somatic
cloning. Lancet 1999;353:1489–91.
98. Tamashiro KL, Wakayama T, Blanchard RJ, Blanchard DC,
Yanagimachi R. Postnatal growth and behavioral
development of mice cloned from adult cumulus cells. Biology
of Reproduction 2000;63:328–34.
99. Ogonuki N, Inoue K, Yamamoto Y, Noguchi Y, Tanemura K,
Suzuki O, et al. Early death of mice cloned from somatic cells.
Nature Genetics 2002;30:253–4.
100. Perry AC, Wakayama T. Untimely ends and new beginnings
in mouse cloning. Nature Genetics 2002;30:243–4.
101. Rhind SM, King TJ, Harkness LM, Bellamy C, Wallace W,
DeSousa P, et al. Cloned lambs-lessons from pathology.
Nature Biotechnology 2003;21:744–5.
102. Farin P, Piedrahita JA, Farin CE. Errors in development of
fetuses and placentas from in vitro-produced bovine
embryos. Theriogenology 2006;65:178–91.
103. Cibelli JB, Campbell KH, Seidel GE, West MD, Lanza RP.
The health profile of cloned animals. Nature Biotechnology
2002;20:13–41.
104. Panarace M, Agu¨ero JI, Garrote M, Jauregui G, Segovia A,
Cane´ L, et al. How healthy are clones and their progeny: 5
years of field experience. Theriogenology 2007;67:142–51.
105. Humpherys D, Eggan K, Akutsu H, Hochedlinger K, Rideout
III WM, Biniszkiewicz D, et al. Epigenetic instability in ES
cells and cloned mice. Science 2001;293:95–7.
106. Lanza RP, Cibelli JB, Faber D, Sweeney RW, Henderson B,
Nevala W, et al. Cloned cattle can be healthy and normal.
Science 2001;294:1893–4.
107. Chavatte-Palmer P, Heyman Y, Richard C, Monget P,
LeBourhis D, Kann G, et al. Clinical, hormonal, and
hematologic characteristics of bovine calves derived from
nuclei from somatic cells. Biology of Reproduction
2002;66:1596–603.
108. Govoni KE, Tian XC, Kazmer GW, Taneja M, Enright BP,
Rivard AL, et al. Age-related changes of the somatotropic
axis in cloned Holstein calves. Biology of Reproduction
2002;66:1293–8.
109. Enright BP, Taneja M, Schreiber D, Riesen J, Tian XC,
Fortune JE, et al. Reproductive characteristics of cloned
heifers derived from adult somatic cells. Biology of
Reproduction 2002;66:291–6.
110. Pace MM, Augenstein ML, Betthauser JM, Childs LA,
Eilertsen KJ, Enos JM, et al. Ontogeny of cloned cattle to
lactation. Biology of Reproduction 2002;67:334–9.
111. Tian XC, Kubota C, Sakashita K, Izaike Y, Okano R, Tabara
N, et al. Meat and milk compositions of bovine clones.
http://www.cababstractsplus.org/cabreviews
Wilfried A. Kues, Detlef Rath and Heiner Niemann 15
Proceedings of the National Academy of Sciences of the
United States of America 2005;102:6261–6.
112. Yang X, Tian C, Kubota C, Page R, Xu J, Cibelli J, et al. Risk
assessment of meat and milk from cloned animals. Nature
Biotechnology 2007;25:77–83.
113. Miller HI. Food from cloned animals is part of our brave old
world. Trends in Biotechnology 2007;25:201–3.
114. Archer GS, Dindot S, Friend TH, Walker S, Zaunbrecher G,
Lawhorn B, et al. Hierarchical phenotypic and epigenetic
variation in cloned swine. Biology of Reproduction
2003;69:430–6.
115. Committee on Defining Science-Based Concerns Associated
with Products of Animal Biotechnology, Committee on
Agricultural Biotechnology, Health, and the Environment,
National Research Council. Animal Biotechnology: Science
based concerns. Washington, DC, USA: National Academy
Press; 2002.
116. Kumugai S. Safety of animal foods that utilize cloning
technology. Report to the Japanese Ministry for Agriculture,
Forestry and Fishery (MAFF) 2002.
117. Rudenko L, Matheson JC, Sundlof SF. Animal Cloning and
the FDA: the risk assessment paradigm under public scrutiny.
Nature Biotechnology 2007;25:39–43.
118. European Food Safety Agency 2007. Available from: URL:
http://www.efsa.europa.eu/EFSA/efsa_locale-
1178620753812_1178676923092.htm
119. Wakayama T, Shinkai Y, Tamashiro KL, Niida H,
Blanchard DC, Blanchard RJ. Cloning of mice to six
generations. Nature 2000;407:318–9.
120. Kubota C, Tian XC, Yang X. Serial bull cloning by somatic cell
nuclear transfer. Nature Biotechnology 2004;22:693–4.
121. Bennett ST, Barnes C, Cox A, Davies L, Brown C. Toward
the 1,000 dollars human genome. Pharmacogenomics
2005;6:373–82.
122. Goodstadt L, Ponting CP. Phylogenetic reconstruction of
orthology, paralogy, and conserved synteny for dog and
human. PLoS Computational Biology 2006;2:e133.
123. Aparicio S, Chapman J, Stupka E, Putnam N, Chia JM, Dehal
P, et al. Whole-genome shotgun assembly and analysis of
the genome of Fugu rubripes. Science 2002;297:1301–10.
124. Gregory SG, Sekhon M, Schein J, Zhao S, Osoegawa K,
Scott CE, et al. A physical map of the mouse genome. Nature
2002;418:743–50.
125. Adelson DL. Insights and applications from sequencing the
bovine genome. Reproduction Fertility and Development
2008;20:54–60.
126. Fadiel A, Anidi I, Eichenbaum KD. Farm animal genomics
and informatics: an update. Nucleic Acids Research
2005;33:6308–18.
127. Lindblad-Toh K, Wade CM, Mikkelsen TS, Karlsson EK, Jaffe
DB, Kamal M, et al. Genome sequence, comparative analysis
and haplotype of the domestic dog. Nature 2005;438:803–19.
128. Grobet L, Martin LJ, Poncelet D, Pirottin D, Brouwers B,
Riquet J, et al. A deletion in the bovine myostatin gene
causes the double-muscled phenotype in cattle. Nature
Genetics 1997;17:71–4.
129. Kambadur R, Sharma M, Smith TP, Bass JJ. Mutations in
myostatin (GDF8) in double-muscled Belgian Blue and
Piedmontese cattle. Genome Research 1997;7:910–6.

16 Perspectives in Agriculture, Veterinary Science, Nutrition and Natural Resources
130. McPherron AC, Lee SJ. Double muscling in cattle due to
mutations in the myostatin gene. Proceedings of the National
Academy of Sciences of the United States of America
1997;94:12457–61.
131. Clop A, Marcq F, Takeda H, Pirottin D, Tordoir X, Bibe´ B.
A mutation creating a potential illegitimate microRNA target
site in the myostatin gene affects muscularity in sheep.
Nature Genetics 2006;38:813–8.
132. Schuelke M, Wagner KR, Stolz LE, Hu¨bner C, Riebel T,
Ko¨men W, et al. Myostatin mutation associated with gross
muscle hypertrophy in a child. New England Journal of
Medicine 2004;350:2682–8.
133. Hayashizaki Y, Kanamori M. Dynamic transcriptome of mice
[review]. Trends in Biotechnology 2004;22:161–7.
134. Bie´mont C, Vieira C. Genetics: junk DNA as an evolutionary
force. Nature 2006;443:521–4.
135. Rassoulzadegan M, Grandjean V, Gounon P, Vincent S,
Gillot I, Cuzin F. RNA-mediated non-mendelian inheritance
of an epigenetic change in the mouse. Nature 2006;
441:469–74.
136. Segal E, Fondufe-Mittendorf Y, Chen L, Thastrom A, Field Y,
Moore IK, et al. A genomic code for nucleosome positioning.
Nature 2006;442:772–8.
137. Werner A. Natural antisense transcripts [review]. RNA
Biology 2005;2:53–62.
138. Jirtle RL, Skinner MK. Environmental epigenomics and
disease susceptibility. Nature Reviews Genetics 2007;
8:253–62.
139. Schena M, Shalon D, Davis RW, Brown PO. Quantitative
monitoring of gene expression patterns with a
complementary DNA microarray. Science 1995;270:467–70.
140. Ragoussis J, Elvidge GP, Kaur K, Colella S. Matrix-assisted
laser desorption/ionisation, time-of-flight mass spectrometry
in genomics research. PLoS Genetics 2006;2:e100.
141. Niemann H, Wrenzycki C. Alterations of expression of
developmentally important genes in preimplantation bovine
embryos by in vitro culture conditions: implications for
subsequent development [review]. Theriogenology
2000;53:21–34.
142. Wrenzycki C, Herrmann D, Lucas-Hahn A, Gebert C,
Korsawe K, Lemme E, et al. Epigenetic reprogramming
throughout preimplantation development and consequences
for assisted reproductive technologies [review]. Birth Defects
Research Part C-Embryo Today 2005;75:1–9.
143. Wrenzycki C, Herrmann D, Lucas-Hahn A, Korsawe K,
Lemme E, Niemann H. Messenger RNA expression patterns
in bovine embryos derived from in vitro procedures and their
implications for development [review]. Reproduction Fertility
and Development 2005;17:23–35.
144. Schultz RM. Regulation of zygotic gene activation in the
mouse. Bioessays 1993;15(8):531–8.
145. Wang QT, Piotrowska K, Ciemerych MA, Milenkovic L, Scott
MP, Davis RW, et al. A genome-wide study of gene activity
reveals developmental signaling pathways in the
preimplantation mouse embryo. Developmental Cell
2004;6(1):133–44.
146. Zeng F, Baldwin DA, Schultz RM. Transcript profiling during
preimplantation mouse development. Developmental Biology
2004;272:483–96.
http://www.cababstractsplus.org/cabreviews
147. Telford NA, Watson AJ, Schultz GA. Transition from maternal
to embryonic control in early development: A comparison of
several species. Molecular Reproduction and Development
1990;26:90–100.
148. Kiefer JC. Epigenetics in development [review].
Developmental Dynamics 2007;236:1144–56.
149. Bermudez MG, Wells D, Malter H, Munne S, Chen J,
Steuerwald, NM. Expression profiles of individual human
oocytes using microarray technology. Reprod Biomed Online
2004;8:325–337.
150. Dobson AT, Raja R, Abeyta MJ, Taylor T, Shen S, Haqq C,
et al. The unique transcriptome through day 3 of human
preimplantation development. Human Molecular Genetics
2004;13(14):1461–70.
151. Hamatani T, Daikoku T, Wang H, Matsumoto H, Carter MG,
Ko MS, et al. Global gene expression analysis identifies
molecular pathways distinguishing blastocyst dormancy and
activation. Proceedings of the National Academy of Sciences
of the United States of America 2004;101(28):10326–31.
152. Dalbies-Tran R, Mermillod P. Use of heterologous
complementary DNA array screening to analyze bovine
oocyte transcriptome and its evolution during in vitro
maturation. Biology of Reproduction 2003;68:252–61.
153. Valle´e M, Gravel C, Palin MF, Reghenas H, Stothard P,
Wishart DS, et al. Identification of novel and known oocytespecific
genes using complementary DNA subtraction and
microarray analysis in three different species. Biology of
Reproduction 2005;73(1):63–71.
154. Mamo S, Ponsuksili S, Wimmers K, Gilles M, Schellander K.
Expression of retinoid X receptor transcripts and their
significance for developmental competence in
in vitro-produced pre-implantation-stage bovine embryos.
Reproduction in Domestic Animals 2005;40(2):177–83.
155. Whitworth KM, Agca C, Kim JG, Patel RV, Springer GK,
Bivens NJ, et al. Transcriptional profiling of pig
embryogenesis by using a 15-K member unigene set specific
for pig reproductive tissues and embryos. Biology of
Reproduction 2005;72:1437–51.
156. Valle´e M, Robert C, Me´thot S, Palin MF, Sirard MA. Crossspecies
hybridizations on a multi-species cDNA microarray to
identify evolutionarily conserved genes expressed in oocytes.
BMC Genomics 2006;7:113.
157. Adjaye J, Herwig R, Brink T, Herrmann D, Greber B, Groth D,
et al. Conserved molecular profiles of maternal and
embryonic gene expression during bovine and human
preimplantation development. Physiological Genomics
2007;35:315–27.
158. Patel OV, Bettegowda A, Ireland JJ, Coussens PM, Lonergan
P, Smith GW. Functional genomics studies of oocyte
competence: evidence that reduced transcript abundance for
follistatin is associated with poor developmental competence
of bovine oocytes. Reproduction 2007;133(1):95–106.
159. Niemann H, Carnwath JW, Kues WA. Application of DNA
array technology to mammalian embryos. Theriogenology
2007;68 Suppl. 1:165–77.
160. Evsikov AV, Graber JH, Brockman JM, Hampl A, Holbrook
AE, Singh P, et al. Cracking the egg: molecular dynamics and
evolutionary aspects of the transition from the fully grown
oocyte to embryo. Genes and Development 2006;
20:2713–27.

161. Donnison M, Pfeffer PL. Isolation of genes associated with
developmentally competent bovine oocytes and quantitation
of their levels during development. Biology of Reproduction
2004;71(6):1813–21.
162. Robert C, Barnes F, Hue I, Sirard MA. Subtractive
hybridization used to identify mRNA associated with the
maturation of bovine oocytes. Molecular Reproduction and
Development 2000;57:167–75.
163. Misirlioglu M, Page GP, Sagirkaya H, Parrish JJ, First NL,
Memili E. Dynamics of global transcriptome in bovine
matured oocytes and preimplantation embryos. Proceedings
of the National Academy of Sciences of the United States of
America 2006;103:18905–10.
164. Fair T, Carter F, Park S, Evans AO, Lonergan P. Global gene
expression analysis during bovine oocyte in vitro maturation.
Theriogenology 2007;68:91–7.
165. Palmiter RD, Brinster RL, Hammer RE, Trumbauer ME,
Rosenfeld MG, Birnberg NC. Dramatic growth of mice that
develop from eggs microinjected with metallothionein-growth
hormone fusion genes. Nature 1982;300:611–5.
166. Niemann H, Kues WA, Carnwath JW. Transgenic farm
animals: present and past [review]. Revue Scientifique et
Technique (Office International des Epizooties)
2005;24:285–98.
167. Nottle MB, Nagashima H, Verma PJ, Du ZT, Grupen CG,
Mellfatrick SM, et al. Production and analysis of transgenic
pigs containing a metallothionein porcine growth hormone
gene construct. In: Murray JD, Oberbauer AM, McGloughlin
MM, editors. Transgenic Animals in Agriculture. CABI
Publishing, New York, USA; 1999. p. 145–56.
168. Pursel VG, Wall RJ, Mitchell AD, Elsasser TH, Solomon MB,
Coleman ME, et al. Expression of insulin-like growth factor-1
in skeletal muscle of transgenic pigs. In: Murray JD,
Anderson GB, Oberbauer AM, McGloughlin MM, editors.
Transgenic Animals in Agriculture. CABI Publishing, New
York, NY, USA; 1999. p. 131–44.
169. Saeki K, Matsumoto K, Kinoshita M, Suzuki I, Tasaka Y,
Kano K, et al. Functional expression of a Delta12 fatty acid
desaturase gene from spinach in transgenic pigs.
Proceedings of the National Academy of Sciences of the
United States of America 2004;101:6361–6.
170. Wheeler MB, Bleck GT, Donovan SM. Transgenic alteration
of sow milk to improve piglet growth and health. Reproduction
2001;58 Suppl.:313–24.
171. Mu¨ller M, Brenig B, Winnacker EL, Brem G. Transgenic pigs
carrying cDNA copies encoding the murine Mx1 protein which
confers resistance to influenza virus infection. Gene
1992;121:263–70.
172. Lo D, Pursel V, Linton PJ, Sandgren E, Behringer R, Rexroad
C, et al. Expression of mouse IgA transgenic mice, pigs and
sheep. European Journal of Immunology 1991;21:1001–6.
173. Damak S, Jay NP, Barrell GK, Bullock DW. Targeting gene
expression to the wool follicle in transgenic sheep.
Biotechnology 1996b;14:181–4.
174. Damak S, Su H, Jay NP, Bullock DW. Improved wool
production in transgenic sheep expressing insulin-like growth
factor 1. Biotechnology 1996;14:185–8.
175. Clements JE, Wall RJ, Narayan O, Hauer D, Schoborg R,
Sheffer D, et al. Development of transgenic sheep that
express the visna virus envelope gene. Virology
1994;200:370–80.
http://www.cababstractsplus.org/cabreviews
Wilfried A. Kues, Detlef Rath and Heiner Niemann 17
176. Denning C, Burl S, Ainslie A, Bracken J, Dinnyes A, Fletcher
J, et al. Deletion of the alpha(1,3)galactosyl transferase
(GGTA1) gene and the prion protein (PrP) gene in sheep.
Nature Biotechnology 2001;19:559–62.
177. Reh WA, Maga EA, Collette NM, Moyer A, Conrad-Brink JS,
Taylor SJ, et al. Hot topic: using a stearoyl-CoA
desaturase transgene to alter milk fatty acid composition.
Journal of Dairy Science 2004;87:3510–4.
178. Brophy B, Smolenski G, Wheeler T, Wells D, L’Huillier P,
Laible G. Cloned transgenic cattle produce milk with higher
levels of b-casein and k-casein. Nature Biotechnology
2003;21:157–62.
179. Platenburg GJ, Kootwijk EAP, Kooiman PM, Woloshuk SL,
Nuijens JH, Krimpenfort JA, et al. Expression of human
lactoferrin in milk of transgenic mice. Transgenic Research
1994;3:99–108.
180. Wall RJ, Powell A, Paape MJ, Kerr DE, Bannermann DD,
Pursel VG, et al. Genetically enhanced cows resist
intramammary Staphylococcus aureus infection. Nature
Biotechnology 2005;23:445–51.
181. Niemann H, Kues WA. Application of transgenesis on
livestock for agriculture and biomedicine. Animal
Reproduction Science 2003;79:291–317.
182. Hofmann A, Kessler B, Ewerling S, Weppert M, Vogg B,
Ludwig H, et al. Efficient transgenesis in farm animals by
lentiviral vectors. EMBO Reports 2003;4:1054–60.
183. Whitelaw CB, Radcliffe PA, Ritchie WA, Carlisle A, Ellard FM,
Pena RN, et al. Efficient generation of transgenic pigs using
equine infectious anaemia virus (EIAV) derived vector. FEBS
Letters 2004;571:233–6.
184. Kues WA, Schwinzer R, Wirth D, Verhoeyen E, Lemme E,
Herrmann D, et al. Epigenetic silencing and tissue
independent expression of a novel tetracycline inducible
system in double-transgenic pigs. FASEB Journal Express
2006;20:E1–E10, doi: 10.1096/fj.05-5415fje.
185. Kuroiwa Y, Kasinathan P, Choi YJ, Naeem R, Tomizuka K,
Sullivan EJ, et al. Cloned transchromosomic calves
producing human immunoglobulin. Nature Biotechnology
2002;20:889–94.
186. Fire A, Xu S, Montgomery MK, Kostas SA, Driver SE, Mello
CC. Potent and specific genetic interference by doublestranded
RNA in Caenorhabditis elegans. Nature
1998;391(6669):806–11.
187. Dallas A, Vlassow A. RNAi: a novel antisense technology and
its therapeutic potential. Medical Science Monitor
2006;12:RA67–74.
188. Clark J, Whitelaw B. A future for transgenic livestock. Nature
Reviews Genetics 2003;4:825–33.
189. Iqbal K, Kues WA, Niemann H. Parent-of-origin dependent
gene-specific knock down in mouse embryos. Biochemical
and Biophysical Research Communications 2007;
358:727–32.
190. Dieckhoff B, Karlas A, Hofmann A, Kues WA, Petersen B,
Pfeifer A, Niemann H, et al. Inhibition of porcine endogenous
retroviruses (PERV) in primary porcine cells by RNA
interference using lentiviral vectors. Archives of Virology
2007;152:629–34.
191. Dieckhoff B, Petersen B, Kues WA, Kurth R, Niemann H,
Denner J. Knockdown of porcine endogenous retrovirus

18 Perspectives in Agriculture, Veterinary Science, Nutrition and Natural Resources
(PERV) expression by PERV-specific shRNA in transgenic
pigs. Xenotransplantation 2008;15:36–45.
192. Golding MC, Long CR, Carmell MA, Hannon GJ, Westhusin
ME. Suppression of prion protein in livestock by RNA
interference. Proceedings of the National Academy of
Sciences of the United States of America 2006;103:5285–90.
193. Tenenhaus-Dann C, Alvarado AL, Hammer RE, Garbers DL.
Heritable and stable gene knockdown in rats. Proceedings
of the National Academy of Sciences of the United States of
America 2006;103:11246–51.
194. Chou CY, Horng LS, Tsai HJ. Uniform GFP-expression in
transgenic medaka (Oryzias latipes) at the F0 generation.
Transgenic Research 2001;10:303–15.
195. Gong W, Wan H, Tay TL, Wang H, Chen M, Yan T.
Development of transgenic fish for ornamental and bioreactor
by strong expression of fluorescent proteins in the skeletal
muscle. Biochemical and Biophysical Research
Communications 2003;308:58–63.
196. Food and Drug Administration. USA (2003) FDA statement
regarding Glofish. Available from: URL: http://www.fda.gov/
bbs/topics/NEWS/2003/NEW00994.html.
http://www.cababstractsplus.org/cabreviews
197. Wolff JA, Malone RW, Williams P, Chong W, Acsadi G,
Jani A, et al. Direct gene transfer into mouse muscle in vivo.
Science 1990;247:1465–8.
198. Davis HL. CpG motifs for optimization of DNA vaccines.
Developmental Biology (Basel) 2001;104:165–9.
199. Lorenzen N, LaPatra SE. DNA vaccines for aquacultured
fish. Revue Scientifique et Technique (International Office of
Epizootics) 2005;24:201–13.
200. Gravier R, Dory D, Laurentie M, Bougeard S, Cariolet R,
Jestin A. In vivo tissue distribution and kinetics of a
pseudorabies virus plasmid DNA vaccine after intramuscular
injection in swine. Vaccine 2007;25:6930–8.
201. Gjorret JO, Maddox-Hyttel P. Attempts towards derivation
and establishment of bovine embryonic stem cell-like
cultures. Reproduction Fertility and Development
2005;17:113–24.
202. Takahashi K, Yamanaka S. Induction of pluripotent stem cells
from mouse embryonic and adult fibroblast cultures by
defined factors. Cell 2006;126:663–76.
203. Rothschild MF, Plastow GS. Impact of genomics on animal
agriculture and opportunities for human health. Trends in
Biotechnology 2008;26(1):21–5.

Xenotransplantation 2008: 15: 36–45
Printed in Singapore. All rights reserved
doi: 10.1111/j.1399-3089.2008.00442.x
Knockdown of porcine endogenous
retrovirus (PERV) expression by
PERV-specific shRNA in transgenic pigs
Dieckhoff B, Petersen B, Kues WA., Kurth R, Niemann H, Denner J.
Knockdown of porcine endogenous retrovirus (PERV) expression by
PERV-specific shRNA in transgenic pigs.
Xenotransplantation 2008; 15: 36–45. Ó 2008 Blackwell Munksgaard
Abstract: Background: Xenotransplantation using porcine cells, tissues
or organs may be associated with the transmission of porcine endogenous
retroviruses (PERVs). More than 50 viral copies have been identified
in the pig genome and three different subtypes of PERV were
released from pig cells, two of them were able to infect human cells in
vitro. RNA interference is a promising option to inhibit PERV transmission.
Methods: We recently selected an efficient si (small interfering) RNA
corresponding to a highly conserved region in the PERV DNA, which is
able to inhibit expression of all PERV subtypes in PERV-infected
human cells as well as in primary pig cells. Pig fibroblasts were transfected
using a lentiviral vector expressing a corresponding sh (short
hairpin) RNA and transgenic pigs were produced by somatic nuclear
transfer cloning. Integration of the vector was proven by PCR, expression
of shRNA and PERV was studied by in-solution hybridization
analysis and real-time RT PCR, respectively.
Results: All seven born piglets had integrated the transgene. Expression
of the shRNA was found in all tissues investigated and PERV expression
was significantly inhibited when compared with wild-type control
animals.
Conclusion: This strategy may lead to animals compatible with PERV
safe xenotransplantation.
Introduction
Xenotransplantation using porcine cells, tissues or
organs may offer a potential solution for the
shortage of allogeneic human organs [1]. Pigs are
the most favored donor species for several reasons:
(i) similar physiology and size of organs, (ii)
unlimited availability, (iii), short generation interval,
high number of progeny (up to 15 to 18
piglets); (iv) relatively low costs, (v) maintenance
under high hygienic conditions is possible, i.e.,
specified pathogen-free (spf) breeding and gnotobiotic
delivery is possible, (vi) tools for the genetic
modification to reduce the immunogenicity are
available and (vii) somatic cloning is possible and
thus production of transgenic animals can be
36
Copyright Ó 2008 Blackwell Munksgaard
Britta Dieckhoff, 1 Bjçrn Petersen, 2
Wilfried A. Kues, 2 Reinhard
Kurth, 1 Heiner Niemann 2 and
Joachim Denner 1
1 Robert Koch Institute, Berlin, 2 Department of
Biotechnology, Institute for Animal Science,
Mariensee, Neustadt, Germany
Key words: porcine endogenous retrovirus – RNA
interference – shRNA – siRNA – transgenic pig –
xenotransplantation
Address reprint requests to Joachim Denner, PhD,
Robert Koch Institute, Nordufer 20, 13353 Berlin,
Germany (E-mail: dennerj@rki.de)
Received 6 November 2007;
Accepted 12 November 2007
XENOTRANSPLANTATION
significantly enhanced [2]. However, prior to the
clinical use of porcine xenotransplants, three main
hurdles have to be overcome: The immunological
rejections, the physiological incompatibility and
the risk of transmission of porcine pathogens. The
premier immunological hurdle, the hyperacute
rejection, which is due to the stimulation of the
human complement system through the gal alpha
1,3 gal epitopes on the surface of porcine cells can
be overcome in a clinically acceptable manner by
either the production of Gal knock-out animals
[3,4] or animals over-expressing human complement
regulatory factors [5].
Specified pathogen-free breeding of pigs can prevent
transmission of most porcine microbes. However,
porcine endogenous retroviruses (PERVs) are

integrated in the porcine genome [6,7], and can be
released as infectious particles from normal pig
cells [8–10] and can infect human cells in vitro [11–
15]. The three replication-competent subtypes of
PERVs mainly differ in their receptor-binding site
of the envelope protein [6,16]. The subtypes PERV-
A and PERV-B are polytropic and able to infect
human cells in vitro, whereas the ecotropic PERV-
C infects only porcine cells.
Retroviruses are tumorigenic and may cause
immunodeficiencies in infected hosts. The risk of
PERV infection has to be carefully assessed
specifically in view of the fact that the human
immunodeficiency viruses HIV-1 and HIV-2, causing
AIDS in humans, are the result of multiple
trans-species transmissions of retroviruses from
non-human primates [17,18]. However, in several
clinical applications of porcine islet cells or ex vivo
perfusions of pig liver cells such as bridging during
acute liver failure, no virus transmission could be
detected [19–22]. Likewise, in a cohort of 160
patients treated with various porcine tissues, no
PERV transmission was observed [23,24]. Moreover,
PERV transmission was not found after pig
to non-human primate transplantation and PERV
infection experiments [25–27]. However, the risk of
PERV transmission associated with tumors or
immunodeficiencies is still prevalent [28]. Removal
of PERV sequences by knock-out technology
would be the safest strategy, but may prove
difficult due to the presence of numerous replication
competent and defective proviruses capable of
recombination and complementing each other.
Different strategies for the prevention of PERV
transmission have been developed including the
selection of low-producer animals based on sensitive
PERV assays [29–31], the generation of an
antiviral vaccine [32], and the inhibition of PERV
expression by RNA interference (RNAi) [33–35].
In these first experiments efficient short interfering
RNAs (siRNAs) were selected and inhibition of
virus expression was studied in PERV infected
human cells [33] and primary pig cells [36].
The mechanism of RNAi is highly conserved
among different biological systems, including
plants, flies, worms, and mammals [37]. After
processing by the ribonuclease III-like enzyme
Dicer, double stranded RNA is cleaved into small
double stranded fragments (21 to 25 nt) [38]. In
the cytoplasm, these siRNAs interact with the
RNA induced silencing complex, which recognizes
the target mRNA, that is homologous to the
sequence of the siRNA. Nucleases, which are part
of the complex, degrade the target RNA and
prevent protein translation [39,40]. Transfection
of mammalian cells with longer dsRNA (>30 nt)
induced an interferon response associated with an
unspecific degradation of mRNA and finally
apoptosis. The Dicer processing step can be
bypassed by transfecting cells with synthetic
siRNAs [41]. The amount of siRNAs within the
cells is diluted out during cell division, thus
limiting the time of gene silencing activity to
approximately four to eight cell doublings [42,43].
Expression of sh (short hairpin) RNAs, that
contain a short loop sequence linking the forward
and reverse strand, can overcome this limitation.
Defined shRNA without any cap- or polyAstructure
can be expressed by polymerase-IIIdependent
promoters such as the murine or
human U6 snRNA- or the human RNase P
(H1) RNA-promoters [44–47]. In addition, cells
with stable chromosomal integration and permanent
inhibition of target genes can be obtained if
adequate selection markers are used. In addition,
retroviral vectors may be used to integrate the
siRNA producing vector [36]. The efficacy of
RNAi has been investigated in vivo, until now
mainly in mice, rats, and cattles [48–52].
Here, we show for the first time lentiviral vectormediated
RNAi in pigs associated with a significant
inhibition of PERV expression.
Materials and methods
Knockdown of PERV in pigs
Cell culture and lentiviral transfection
Primary pig fibroblasts were transduced with the
lentiviral vector pLVTHM-pol2 (Fig. 1). The vector
expressed a shRNA corresponding to the viral
pol2 sequence able to inhibit PERV expression
efficiently [36]. Transduced cells were grown as
described [53], selected by FACS using the expression
of the reporter gene GFP and used in nuclear
transfer.
Generation of transgenic pig embryos by somatic nuclear transfer
Transgenic pigs were generated by somatic nuclear
transfer cloning using in vitro matured abattoir
oocytes [54]. Briefly, oocytes were enucleated by
removing the first polar body along with adjacent
cytoplasm containing the metaphase plate. The
donor cells were arrested at G0/G1 of the cell cycle
by contact inhibition and serum starvation
[DMEM + 0.5% fetal calf serum (FCS)] for
48 h. Prior to nuclear transfer, cells were treated
for 10 min with trypsin/EDTA and centrifuged
(200 g/3 min) twice in a 10 ml tube containing 5 ml
phosphate-buffered saline and 100 ll FCS. The
supernatant was removed and the cells were resuspended
in Ca 2+ -free TL-HEPES medium. A small
37

Dieckhoff et al.
Fig. 1. Localization of the primers specific for GFP and pol2 in the lentiviral vector pLVTHM-pol2 (LTR long terminal repeat, H1
polymerase III H1-RNA gene promotor, shRNA short hairpin RNA, SIN self-inactivating element, cPPT central polypurine tract,
GFP green fluorescent protein, WPRE post-transcriptional element of woodchuck hepatitis virus, EF-1alfa elongation factor-1a
promoter, tetO tetracycline operator, loxP locus of X-over of P1, recombination site of Cre recombinase for bacteriophage P1, the
size of the amplicons is indicated).
fibroblast from the positive cell clone was placed in
the perivitelline space in close contact with the
oocyte membrane to form a couplet. After cell
transfer, fusion was induced in Ca 2+ -free SOR2
medium [0.25 m Sorbitol, 0.5 mm Mg-acetate,
0.1% bovine serum albumin (BSA)]. A single
electrical pulse of 15 V for 100 ls (Eppendorf
MultiporatorÒ, Eppendorf, Germany) between
two electrodes was employed to fuse the membranes
of the oocyte and the donor cell. The
reconstructed embryos were activated in an electrical
field of 1.0 kV/cm for 45 ls in SOR2 activation
medium (0.25 m Sorbitol, 0.1 mm Ca-acetate,
0.5 mm Mg-acetate, 0.1% BSA) followed by incubation
with 2 mm 6-dimethylaminopurine (DMAP;
Sigma, Steinheim, Germany) in NCSU23 medium
for 3 h prior to transfer to recipients.
Synchronization of recipients and embryo transfer
Peripuberal German Landrace gilts served as
recipients. The gilts were synchronized by feeding
20 mg/pig Altrenogest (Regumate Ò ; Janssen-Cilag,
Neuss, Germany) for 13 days followed by an
injection of 1000 IU Pregnant Mare Serum Gonadotropine
(PMSG; Intergonan Ò , Intervet, Unterschleissheim,
Germany) on the last day of
Altrenogest feeding. Ovulations were induced by
intramuscular injections of 500 IU human Chorion
Gonadotropin (hCG; Ovogest Ò , Intervet) 80 h
after PMSG administration. Nineteen hours later,
115 reconstructed embryos were surgically transferred
into the oviducts of one recipient via mid
ventral laparatomy under general anesthesia
induced and maintained with thiopental sodium
(Trapanal Ò , Altana, Konstanz, Germany). Maintenance
of pregnancies was supported by administration
of 1000 IU PMSG and 500 IU hCG on
days 12 and 15 after surgery. Pregnancy was
confirmed by ultrasound on days 25 and 35.
38
DNA isolation
DNA was isolated from ear biopsies using a salt
chloroform extraction method. Sixty micrograms
tissue were incubated in 500 ll HOM buffer
(160 mm saccharose, 80 mm EDTA, 100 mm
Tris–HCl pH 8.0) (all reagents in this chapter
from Roth, Karlsruhe, Germany) and 20 ll ofa
proteinase K solution (20 mg/ml; Invitrogen, Karlsruhe,
Germany) at 60 °C over night. After
addition of 200 ll of a 4.5 m NaCl solution and
700 ll chloroform/isoamyl alcohol, DNA was
extracted by centrifugation (10 min, 10 000 g,
4 °C). The aqueous phase containing genomic
DNA was mixed with 700 ll isopropanol and
centrifuged as described above. After washing with
70% (v/v) ethanol the precipitated DNA was
resuspended in 70 ll H 2O and stored at )20 °C
until assayed.
Detection of transgene
Integration of the transgene was investigated by
two independent PCR assays, using primers
specific for (i) GFP (GFP for: 5¢-GATCACGAG-
ACTAGCCTCGAGGT, GFP rev: 5¢-CCAGGA-
TGTTGCCGTCCTC) and (ii) the shRNA
expression cassette (pol2 for: 5¢-AACGCT-
GACGTCATCAAC, pol2 rev: 5¢-GGACGCTG-
ACAAATTGAC) under the following temperature
conditions: 95 °C, 10 min; 35 cycles (95 °C, 30 s;
45 °C and 54 °C respectively, 30 s; 72 °C, 1 min);
72 °C, 5 min.
Isolation of siRNA and total RNA
The siRNA and siRNA-depleted total RNA isolation
from frozen tissues was carried out using the
mirVana miRNA isolation Kit (Ambion, Huntingdon,
UK) allowing the enrichment of RNAs

smaller than 200 nucleotides according to the
manufacturer’s instructions and stored at )80 °C
until assayed.
RNA probe construction
For the in liquid hybridization a short 32 P (GE
Healthcare, Freiburg, Germany)-labeled RNA
probe (29 nt) was generated by in vitro transcription
using the mirVana miRNA Probe Construction Kit
(Ambion). A DNA oligonucleotide with the reverse
complement sequence of the target RNA was used as
template for the in vitro transcription (pol2siRNA)
and an additional T7 promotor sequence
(5¢-CCTGTCTC-3¢) on it’s 3¢end was used (5¢-AGT-
CAATTTGTCAGCGTCCcctgtctc-3¢). The transcription
reaction and the gel purification of the
labeled probe were performed according to the
manufacturer’s instructions. Visualization was carried
out by phosphor-imaging (Imagine Plate Type
Bas-III and FLA-2000; Fujifilm, Du¨sseldorf,
Germany) with an exposition time of 30 to 60 s.
Detection of siRNA
Pol2-siRNA was detected with the mirVana miR-
NA Detection Kit (Ambion) according to the
manufacture’s instructions, detection was carried
out by phosphor-imaging with an exposure time of
3 to 7 min.
One-step RT real-time PCR
Quantitative real-time RT PCR was performed
using the SuperScript One-Step RT-qPCR System
with PlatinumÒ Taq DNA polymerase (Invitrogen)
and the MX4000 thermocycler (Stratagene,
La Jolla, CA, USA). A FAM-labeled probe (5¢-
FAM-AGAAGGGACCTTGGCAGACTTTCT-
BHQ1; Sigma) as well as primers specific for PERV
gag, amplifying the viral full length RNA of all
three subtypes (for: TCCAGGGCTCATAATTT-
GTC, rev: TGATGGCCATCCAACATCGA)
were applied. PERV expression was normalized
to the amount of total RNA as well as to the
expression of the house-keeping genes glycerinaldehyd-3-phosphate-dehydrogenase
(GAPDH),
cyclophilin and hypoxanthine-guanine phosphoribosyltransferase
(HPRT). A HEX-labeled probe
and primers specific for porcine GAPDH (5¢-HEX-
CCACCAACCCCAGCAAGAGCACGC-BHQ1,
for: 5¢-ACATGGCCTCCAAGGAGTAAGA, rev:
GATCGAGTTGGGGCTGTGACT) (Operon,
Cologne, Germany), a Cy5-labeled probe and
primers specific for porcine cyclophilin (5¢-Cy5-
TGCCAGGGTGGTGACTTCACACGCC-BHQ2,
for: 5¢-TGCTTTCACAGAATAATTCCAGGA-
TTTA, rev: 5¢-GACTTGCCACCAGTGCCAT-
TA, Operon), as well as a FAM-labeled
probe and primers specific for porcine HPRT
(FAM-ATCGCCCGTTGACTGGTCATTACA-
GTAGCT-BHQ1, for: 5¢-GTGATAGATCCATT-
CCTATGACTGTAGA, rev: 5¢-TGAGAGA
TCATCTCCACCAATTACTT were used [55].
For each reaction, 50 ng total RNA and the
following temperature conditions were used:
50 °C, 15 min; 95 °C, 2 min; 45 cycles (95 °C,
15 s; 54 °C, 30 s). PERV expression in each organ
was normalized to porcine GAPDH, porcine
cyclophilin and total RNA, respectively, and compared
with the expression in the corresponding
organ of the control animal. Samples from control
and experimental animals were always run together.
Data were analyzed using the DDCTmethod
[56].
Western blot analyzes
Western blot analyzes using sera specific for p15E
and p27Gag of PERV were performed as described
[36,57].
Results
Knockdown of PERV in pigs
shRNA-mediated inhibition of PERV expression in primary
fibroblasts
Porcine fetal fibroblasts (primary cell line: P1 F10)
were transduced using the lentiviral vector
pLVTHM-pol2 (Fig. 1) expressing the PERV-specific
shRNA pol2. In order to analyze the shRNAmediated
inhibition of PERV-mRNA expression,
total RNA was isolated from transduced and nontransduced
fibroblasts and one-step RT real-time
PCR was performed. PERV full-length mRNA
expression was inhibited by 94.8% in fetal fibroblasts
P1 F10 transduced with pLVTHM-pol2 as
described previously [36]. The inhibition of PERV
expression in transduced cells was stable and
remained at 95% over months.
Somatic cell nuclear transfer and the production of shRNA
transgenic pigs and control animals
The pLVTHM-pol2-transduced fibroblasts were
cultured in vitro prior to being used for the
production of transgenic pigs via somatic cell
nuclear transfer. After activation, 115 cloned
embryos were transferred surgically into the
oviducts of one synchronized recipient. Pregnancy
was confirmed by ultrasound scanning on days 25
and 35 after embryo transfer. After 116 days of
39

Dieckhoff et al.
gestation seven piglets were born; one of them
was stillborn. None of the piglets showed any
malformations. Mean birth weight was 1.3 kg
which is similar to that of non-transgenic piglets
in our pig facility. Ear biopsies were obtained
from six piglets and frozen in liquid nitrogen.
Four piglets died soon after birth due to agalactia
of the sow. Following repeated application of
2 ml oxytocin (Oxytocin 10 IE/ml; Pharma Partner,
Hamburg, Germany) lactation was reinitiated
and two piglets survived. They were killed by
barbiturate overdose at day 3, and samples of
heart, lungs, spleen, liver, kidney, pancreas as well
as muscle were taken and frozen in liquid nitrogen
for further analysis. Control animals were produced
by nuclear transfer using primary fibroblasts
from non-transduced porcine fibroblasts P1
F10. At day 89 of gestation, organs of five
animals were obtained by Caesarian section, the
fetuses had a mean weight of 1.1 kg.
Detection of vector integration
To detect the presence of the transgene, the
lentiviral vector pLVTHM-pol2, in the genome of
the piglets, PCRs were performed with primers
specific for gfp and specific for the shRNA expression
cassette (Fig. 1). All of the six tested piglets
were positive for gfp (piglet 1 was not tested) and
the shRNA expression cassette (all animals were
tested positive), respectively (Fig. 2).
Fig. 2. (A) Integration of the lentiviral vector pLVTHM-pol2
in six piglets demonstrated by PCR analysis using primers
specific for GFP, and (B) primers specific for the shRNA
expression cassette, positive control (+): vector pLVTHMpol2,
negative control ()): DNA of non-transduced porcine
fibroblasts. N.t. not tested.
40
Fig. 3. Expression of the PERV-specific pol2-shRNA in different
tissues of piglets no. 6 and 7. As positive control
pLVTHM-pol2-transduced PK-15 cells and as negative controls
pLVTHM-transduced and non-transduced PK-15 cells
were used. Internal negative controls: no target RNA (T)/
RNase (the single stranded probe was degraded by RNase
treatment), no target RNA/ no RNase (the full-length probe of
29 nt was not digested).
Expression of the pol2-shRNA in vivo
For analysis of the expression of the pol2-shRNA
in different organs, small RNA molecules were
isolated from the organs of piglets no. 6 and 7 and
used for Northern solution hybridization with a
32 P-labeled short RNA probe corresponding the
shRNA sequence. Expression of pol2-shRNA was
detected in all organs, including heart, lung, spleen,
liver, kidney, muscle, and pancreas (Fig. 3).
Inhibition of PERV expression in different tissues
Total RNA was isolated from different organs of
piglets no. 6 and 7 and analyzed using one-step RT
real-time PCR. As control, total RNA isolated
from the corresponding organs taken from five
control, non-transgenic pigs was used. Expression
of PERV in different organs of the shRNAtransgenic
and the non-transgenic control animals
was highest in the spleen and lower expression was
found in the liver. Due to the differences in PERV
expression related to individual organs, PERV
expression was compared in shRNA-transgenic
and non-transgenic animals on a per organ basis.
The expression levels of PERV in each organ of
the control pigs were averaged and set 100%.
PERV-expression in the corresponding organs
from the shRNA-pol2 transgenic piglets was
related to the expression in the control organ.
Data were normalized to the amount of total
RNA or the expression of the house-keeping
genes GAPDH, cyclophilin, and HPRT. In all
organs of the pol2-shRNA transgenic piglets no. 6
and 7 PERV expression was significantly inhibited
by up to 94% (Fig. 4). Irrespective of the type of

normalization (total RNA amount or housekeeping
genes GAPDH, cyclophilin, and HPRT)
similar expression patterns were observed. Noteworthy,
expression of PERV in organs of the
control animals was similar to the expression of
PERV in adult animals. Preliminary data showed
an expression of 2446 copies of PERV/ng in the
hearts from five control animals, 500 and 492 in
the hearts of the transgenic piglets 6 and 7,
respectively. 4564 copies/ng were found in the
control lungs vs. 1337 and 936 in the lungs of the
transgenic piglets 6 and 7. In the control liver
1614 copies/ng were detected vs. 166 and 328 in
the livers of the transgenic piglets, in the spleens
34068 vs. 1908 and 2419, in the kidneys 2532 vs.
975 and 390, showing the efficacy of the RNAi
in vivo.
Undedectibility of PERV protein expression and virus release
When PERV protein expression was studied using
Western blot analyses of homogenates from different
tissues using antisera specific for different
PERV proteins (p15E, p27Gag), no PERV protein
expression was observed, neither in the non-transgenic
controls nor in the transgenic animals (not
shown).
Discussion
Results of the present study demonstrate a strong
and long lasting inhibition of PERV mRNA
expression in primary porcine fibroblasts using a
Knockdown of PERV in pigs
Fig. 4. Inhibition of PERV expression in different tissues of the pol2-shRNA transgenic piglets (p) no. 6 and 7. PERV expression in
each organ of control non-transgenic animals (c) measured by one-step RT real-time PCR was set 100% and compared with PERV
expression in the corresponding organ of the transgenic animals. In case of control animals the standard deviation is based on the
measurement of PERV expression in organs from five different animals, measured in triplicate; in case of transgenic animals the
standard deviation is based on the measurement of one organ measured in triplicate in two assays. Expression was normalized to the
amount of total RNA, measured by one-step RT real-time PCR.
lentiviral vector system expressing a PERV-specific
shRNA and use in somatic cell nuclear transfer.
This is the first report demonstrating shRNAmediated
reduction of PERV expression in
shRNA-transgenic pigs in vivo. The strategy
applied here could lead to microbiological safer
porcine xenotransplants and is therefore of considerable
medical importance.
More than fifty copies of porcine endogenous
retroviruses are integrated in the porcine genome
[6,58,59], rendering conventional gene-knockout
approaches not feasible and making RNAi a
promising alternative. The RNAi approach has
already been used for the in vitro inhibition of HIV
[60–62] and other viral pathogens like hepatitis B
virus (HBV) [63,64], Coxsackie virus B3 [65], West
Nile virus [66], and transmissible gastroenteritis
virus [51]. Furthermore, RNAi-mediated reduced
HBV expression has been demonstrated in mice in
vivo [67,68] by murine hydronamic tail vene
injection. Long-term inhibition of HBV was
achieved by adeno-associated vector-mediated
RNAi [69]. RNAi was also induced by lentiviral
gene transfer in transgenic mice with a long-term
inhibition of the target gene [70]. In contrast, HIV-
1 escapes from RNAi-mediated inhibition not only
through nucleotide substitutions or deletions in the
siRNA target sequence, but also through mutations
that alter the secondary RNA structure [71].
Resistance and/or escape from the inhibitory
effects of RNAi are impossible in the case of
PERV, since its genome behaves like a cellular
gene.
41

Dieckhoff et al.
In future experiments, the number of integrated
shRNA vectors as well as the influence on the
expression of PERV during life time and the
persistence of the shRNA expression in the next
generation will be analyzed. The physiological role
of endogenous retroviruses is unknown. Our
results indicate that the siRNA expression did
not compromise the fetal development because the
siRNA transgenic piglets were born after a normal
gestation period, with a normal birth weight and
without malformations. Due to the sequence specificity
of the RNAi mechanism and the fact that
PERV is a retroviral sequence, off-target effects
resulting in gene silencing of vital cellular proteins
are highly unlikely. Some RNAi off-target effects
have recently been reported when interfering with
the expression of cellular target genes [72–75]. Due
to the early death of the pol2-shRNA-transgenic
piglets caused by agalactia of the sow, long-term
observations of the inhibitory effect could not yet
be made. In transgenic mice expression of the Neil1
gene, a DNA N-glycosylase, was inhibited by
shRNA over an extended period of time in all
organs [76].
The detection of the inhibitory effect of the pol2shRNA
on PERV expression in vivo requires a
suitable control, especially in the presence of a very
low expression of the PERV in the non-transgenic
founder pigs. In addition, PERV expression varies
in different pig strains [9,31] as well as in different
tissues and organs of one individuum [77,78]. Thus
detailed analysis of non-transgenic pigs of the same
strain provides only limited insight into the RNAi
effects. To provide an appropriate control, pigs
were produced by somatic cell nuclear transfer
using the non-transfected counterparts of the
identical primary cell isolate. This allowed us to
compare PERV expression between animals and
organs isolated from different donors and this
comparison revealed a significant reduction of
PERV expression in the siRNA transgenic pigs.
Expression data were normalized both to the
amount of total RNA and to the expression of
different house-keeping genes such as GAPDH,
cyclophilin, and HPRT. HPRT is considered to be
a suitable reference gene for the analyses of gene
expression in different porcine tissues and immune
cells [79,80]. Numerous studies on GAPDH expression
in humans and rodents showed changes
related to different experimental conditions. In
addition, the existence of pseudogenes for HPRT
[81] and GAPDH [82] complicates the use of these
genes as standards in RT-PCR reactions. However,
although the expression of all house-keeping genes
used here was different in different organs, normalization
of PERV expression according to the
42
expression of each of these house-keeping genes
showed a similar inhibitory effect of PERV expression
up to 95%.
Based on the low expression of viral RNA also a
low expression of PERV proteins was expected. In
Western blot assays using sera specific for p15E
and p27Gag of PERV, no protein expression was
observed, neither in the non-transgenic controls
nor in the transgenic animals. Using the same
assays PERV protein expression was also not
detected in primary PBMCs from different pig
strains such as German landrace, Duroc, Schwa¨bisch
Ha¨llisch, German large white as well as
crossbreeds. In PK-15 cells, producing detectable
amounts of infectious virus particles, expression of
p27Gag was detectable, but still very low and this
expression was reduced by RNAi nearly to 100%
[36]. Higher expression of p27Gag protein was
observed in human 293 cells infected with a high
titer strain of PERV, which was only partially
inhibited by RNAi [33]. A higher expression of
PERV proteins was also observed in pig melanomas
and in melanoma cell lines [57].
The absence of viral proteins in non-transgenic
and transgenic pigs suggested the absence of PERV
release. However, the low sensitivity of the Western
blot assay (detection limit: 50 ng for p15E and
100 ng for p27Gag [57] left questions open.
Improving the assays using monoclonal antibodies,
developing a sensitive immunohistochemistry analysis
or using a sensitive assay to detect RT activity
in the plasma, such as the PERT (productenhanced
reverse transcriptase) assay [83] may
help to compare protein expression and virus
release in transgenic and non-transgenic animals
more correctly.
To increase the safety of porcine xenotransplants,
multiple shRNAs corresponding to different
regions of the PERV genome shall be used. The
advantage of the RNAi strategy is, that the
expression of all PERVs will be inhibited and the
likelihood of recombinations or complementation
is further decreased. Selection of PERV lowproducer
pigs using methods described earlier
[9,31] together with the production of shRNAtransgenic
animals may reduce PERV expression in
cells and organs and thus increase the viral safety
of porcine xenografts.
Acknowledgments
The authors gratefully acknowledge funding by
DFG within the TransRegio research group 535.
The competent assistance of the staff of the
Department of Biotechnology in the production
of cloned pigs is gratefully acknowledged.

References
1. Cooper DK. Clinical xenotransplantion – how close are
we? Lancet 2003; 362: 557–559.
2. Kues WA, Niemann H. The contribution of farm animals
to human health. Trends Biotechnol 2004; 22: 286–294.
3. Dai Y, Vaught TD, Boone J et al. Targeted disruption of
the alpha1,3-galactosyltransferase gene in cloned pigs. Nat
Biotechnol 2002; 20: 251–255.
4. Lai L, Prather RS. Progress in producing knockout
models for xenotransplantation by nuclear transfer. Ann
Med 2002; 34: 501–506.
5. Niemann H. Current status and perspectives for the generation
of transgenic pigs for xenotransplantation. Ann
Transplant 2001; 6: 6–9.
6. Patience C, Switzer WM, Takeuchi Y et al. Multiple
groups of novel retroviral genomes in pigs and related
species. J Virol 2001; 75: 2771–2775.
7. Ericsson T, Oldmixon B, Blomberg J, Rosa M,
Patience C, Andersson G. Identification of novel porcine
endogenous betaretrovirus sequences in miniature
swine. J Virol 2001; 75: 2765–2770.
8. Martin U, Kiessig V, Blusch JH et al. Expression of pig
endogenous retrovirus by primary porcine endothelial cells
and infection of human cells. Lancet 1998; 352: 692–694.
9. Tacke S, Specke V, Stephan O, Seibold E, Bodusch K,
Denner J. Porcine endogenous retroviruses: diagnostic
assays and evidence for immunosuppressive properties.
Transplant Proc 2000; 32: 1166.
10. McIntyre MC, Kannan B, Solano-Aguilar GI, Wilson
CA, Bloom ET. Detection of porcine endogenous
retrovirus in cultures of freshly isolated porcine bone
marrow cells. Xenotransplantation 2003; 10: 337–342.
11. Patience C, Takeuchi Y, Weiss RA. Infection of human
cells by an endogenous retrovirus of pigs. Nat Med 1997;
3: 282–286.
12. Takeuchi Y, Patience C, Magre S et al. Host range and
interference studies of three classes of pig endogenous
retrovirus. J Virol 1998; 72: 9986–9991.
13. Martin U, Winkler ME, Id M et al. Productive infection
of primary human endothelial cells by pig endogenous
retrovirus (PERV). Xenotransplantation 2000; 7: 138–142.
14. Wilson CA, Wong S, VanBrocklin M, Federspiel MJ.
Extended analysis of the in vitro tropism of porcine
endogenous retrovirus. J Virol 2000; 74: 49–56.
15. Specke V, Rubant S, Denner J. Productive infection of
human primary cells and cell lines with porcine endogenous
retroviruses. Virology 2001; 285: 177–180.
16. Le Tissier P, Stoye JP, Takeuchi Y, Patience C, Weiss
RA. Two sets of human-tropic pig retrovirus. Nature
1997; 389: 681–682.
17. Gao F, Yue L, Robertson DL et al. Genetic diversity of
human immunodeficiency virus type 2: evidence for distinct
sequence subtypes with differences in virus biology.
J Virol 1994; 68: 7433–7447.
18. Gao F, Bailes E, Robertson DL et al. Origin of HIV-1
in the chimpanzee Pan troglodytes troglodytes. Nature
1999; 397: 436–441.
19. Heneine W, Tibell A, Switzer WM et al. No evidence
of infection with porcine endogenous retrovirus in
recipients of porcine islet-cell xenografts. Lancet 1998;
352: 695–699.
20. Garkavenko O, Croxson MC, Irgang M, Karlas A,
Denner J, Elliott RB. Monitoring for presence of
potentially xenotic viruses in recipients of pig islet xenotransplantation.
J Clin Microbiol 2004; 42: 5353–5356.
Knockdown of PERV in pigs
21. Irgang M, Sauer IM, Karlas A et al. Porcine endogenous
retroviruses: no infection in patients treated with a
bioreactor based on porcine liver cells. J Clin Virol 2003;
28: 141–154.
22. Xu H, Sharma A, Okabe J et al. Serologic analysis of
anti-porcine endogenous retroviruses immune responses in
humans after ex vivo transgenic pig liver perfusion.
ASAIO J 2003; 49: 407–416.
23. Paradis K, Langford G, Long Z et al. Search for crossspecies
transmission of porcine endogenous retrovirus in
patients treated with living pig tissue. The XEN 111 Study
Group. Science 1999; 285: 1236–1241.
24. Tacke SJ, Bodusch K, Berg A, Denner J. Sensitive and
specific immunological detection methods for porcine
endogenous retroviruses applicable to experimental and
clinical xenotransplantation. Xenotransplantation 2001;
8: 125–135.
25. Loss M, Arends H, Winkler M et al. Analysis of
potential porcine endogenous retrovirus (PERV) transmission
in a whole-organ xenotransplantation model
without interfering microchimerism. Transpl Int 2001; 14:
31–37.
26. Winkler ME, Winkler M, Burian R et al. Analysis of
pig-to-human porcine endogenous retrovirus transmission
in a triple-species kidney xenotransplantation model.
Transpl Int 2005; 17: 848–858. Epub 2005 Apr.
27. Specke V, Schuurman HJ, Plesker R et al. Virus safety
in xenotransplantation: first exploratory in vivo studies in
small laboratory animals and non-human primates.
Transpl Immunol 2002; 9: 281–288.
28. Denner J. Immunosuppression by retroviruses: implications
for xenotransplantation. Ann N Y Acad Sci 1998;
862: 75–86.
29. Tacke SJ, Kurth R, Denner J. Porcine endogenous
retroviruses inhibit human immune cell function: risk for
xenotransplantation? Virology 2000; 268: 87–93.
30. Oldmixon BA, Wood JC, Ericsson TA et al. Porcine
endogenous retrovirus transmission characteristics of an
inbred herd of miniature swine. J Virol 2002; 76: 3045–3048.
31. Tacke SJ, Specke V, Denner J. Differences in release and
determination of subtype of porcine endogenous retroviruses
produced by stimulated normal pig blood cells.
Intervirology 2003; 46: 17–24.
32. Fiebig U, Stephan O, Kurth R, Denner J. Neutralizing
antibodies against conserved domains of p15E of porcine
endogenous retroviruses: basis for a vaccine for xenotransplantation?
Virology 2003; 307: 406–413.
33. Karlas A, Kurth R, Denner J. Inhibition of porcine
endogenous retroviruses by RNA interference: increasing
the safety of xenotransplantation. Virology 2004; 325: 18–
23.
34. Miyagawa S, Nakatsu S, Nakagawa T et al. Prevention
of PERV infections in pig to human xenotransplantation
by the RNA interference silences gene. J Biochem (Tokyo)
2005; 137: 503–508.
35. Niemann H, Kues WA. Transgenic farm animals – an
update. Reprod Fertil Dev 2007; 19: 762–770.
36. Dieckhoff B, Karlas A, Hofmann A et al. Inhibition of
porcine endogenous retroviruses (PERVs) in primary
porcine cells by RNA interference using lentiviral vectors.
Arch Virol 2007; 152: 629–634. Epub 2006 Nov.
37. Caplen NJ, Parrish S, Imani F, Fire A, Morgan RA.
Specific inhibition of gene expression by small doublestranded
RNAs in invertebrate and vertebrate systems.
Proc Natl Acad Sci U S A 2001; 98: 9742–9747. Epub 2001
Jul.
43

Dieckhoff et al.
38. Hammond SM, Bernstein E, Beach D, Hannon GJ. An
RNA-directed nuclease mediates post-transcriptional gene
silencing in Drosophila cells. Nature 2000; 404: 293–296.
39. Billy E, Brondani V, Zhang H, Muller U, Filipowicz
W. Specific interference with gene expression induced by
long, double-stranded RNA in mouse embryonal teratocarcinoma
cell lines. Proc Natl Acad Sci U S A 2001; 98:
14428–14433. Epub 2001 Nov.
40. Yang D, Lu H, Erickson JW. Evidence that processed
small dsRNAs may mediate sequence-specific mRNA
degradation during RNAi in Drosophila embryos. Curr
Biol 2000; 10: 1191–1200.
41. Elbashir SM, Lendeckel W, Tuschl T. RNA interference
is mediated by 21- and 22-nucleotide RNAs. Genes
Dev 2001; 15: 188–200.
42. McManus MT, Petersen CP, Haines BB, Chen J,
Sharp PA. Gene silencing using micro-RNA designed
hairpins. RNA 2002; 8: 842–850.
43. Stein P, Svoboda P, Anger M, Schultz RM. RNAi:
mammalian oocytes do it without RNA-dependent RNA
polymerase. RNA 2003; 9: 187–192.
44. Brummelkamp TR, Bernards R, Agami R. A system for
stable expression of short interfering RNAs in mammalian
cells. Science 2002; 296: 550–553. Epub 2002 Mar 2021.
45. Paddison PJ, Caudy AA, Hannon GJ. Stable suppression
of gene expression by RNAi in mammalian ells. Proc
Natl Acad Sci U S A 2002; 99: 1443–1448. Epub 2002 Jan.
46. Paul CP, Good PD, Winer I, Engelke DR. Effective
expression of small interfering RNA in human cells. Nat
Biotechnol 2002; 20: 505–508.
47. Sui G, Soohoo C, Affar el B et al. A DNA vector-based
RNAi technology to suppress gene expression in mammalian
cells. Proc Natl Acad Sci U S A 2002; 99: 5515–
5520.
48. Grimm D, Streetz KL, Jopling CL et al. Fatality in mice
due to oversaturation of cellular microRNA/short hairpin
RNA pathways. Nature 2006; 441: 537–541.
49. Rao MK, Wilkinson MF. Tissue-specific and cell typespecific
RNA interference in vivo. Nat Protoc 2006; 1:
1494–1501.
50. Tsuchiya M, Yoshida T, Taniguchi S et al. In vivo
suppression of mafA mRNA with siRNA and analysis of
the resulting alteration of the gene expression profile in
mouse pancreas by the microarray method. Biochem
Biophys Res Commun 2007; 356: 129–135. Epub 2007
Feb.
51. Zhou JF, Hua XG, Cui L et al. Effective inhibition of
porcine transmissible gastroenteritis virus replication in ST
cells by shRNAs targeting RNA-dependent RNA polymerase
gene. Antiviral Res 2007; 74: 36–42. Epub 2007
Jan.
52. Golding MC, Long CR, Carmell MA, Hannon GJ,
Westhusin ME. Suppression of prion protein in livestock
by RNA interference. Proc Natl Acad Sci U S A 2006; 103:
5285–5290. Epub 2006 Mar.
53. Kues W, Anger M, Motlik J, Carnwath JW, Niemann
H, Paul D. Cell cycle synchronization of porcine primary
fibroblasts: effects of serum deprivation and reversible cell
cycle inhibitors. Biol Reprod 2000; 62: 412–419.
54. Holker M, Petersen B, Hassel P et al. Duration of in
vitro maturation of recipient oocytes affects blastocyst
development of cloned porcine embryos. Cloning Stem
Cells 2005; 7: 35–44.
55. Duvigneau JC, Hartl RT, Groiss S, Gemeiner M.
Quantitative simultaneous multiplex real-time PCR for the
detection of porcine cytokines. J Immunol Methods 2005;
306: 16–27. Epub 2005 Sep.
44
56. Livak KJ, Schmittgen TD. Analysis of relative gene
expression data using real-time quantitative PCR and the
2(-Delta Delta C(T)) Method. Methods 2001; 25: 402–408.
57. Dieckhoff B, Puhlmann J, Büscher K et al. Expression
of porcine endogenous retroviruses (PERVs) in melanomas
of MMS Troll pigs. Vet Microbiol 2007; 123: 53–68.
58. Bosch S, Arnauld C, Jestin A. Study of full-length
porcine endogenous retrovirus genomes with envelope
gene polymorphism in a specific-pathogen-free large white
swine herd. J Virol 2000; 74: 8575–8581.
59. Herring C, Quinn G, Bower R et al. Mapping fulllength
porcine endogenous retroviruses in a large white
pig. J Virol 2001; 75: 12252–12265.
60. Coburn GA, Cullen BR. Potent and specific inhibition
of human immunodeficiency virus type 1 replication by
RNA interference. J Virol 2002; 76: 9225–9231.
61. Banerjea A, Li MJ, Bauer G et al. Inhibition of HIV-1
by lentiviral vector-transduced siRNAs in T lymphocytes
differentiated in SCID-hu mice and CD34+ progenitor
cell-derived macrophages. Mol Ther 2003; 8: 62–71.
62. Christensen HS, Daher A, Soye KJ et al. Small interfering
RNAs against the TAR RNA binding protein,
TRBP, a Dicer cofactor, inhibit human immunodeficiency
virus type 1 long terminal repeat expression and viral
production. J Virol 2007; 81: 5121–5131. Epub 2007 Mar.
63. Radhakrishnan SK, Layden TJ, Gartel AL. RNA
interference as a new strategy against viral hepatitis.
Virology 2004; 323: 173–181.
64. Kayhan H, Karatayli E, Turkyilmaz AR, Sahin F,
Yurdaydin C, Bozdayi AM. Inhibition of hepatitis B
virus replication by shRNAs in stably HBV expressed
HEPG2 2.2.15 cell lines. Arch Virol 2007; 152: 871–879.
Epub 2007 Jan.
65. Fechner H, Pinkert S, Wang X et al. Coxsackievirus B3
and adenovirus infections of cardiac cells are efficiently
inhibited by vector-mediated RNA interference targeting
their common receptor. Gene Ther 2007; 22: 22.
66. Kachko AV, Ivanova AV, Protopopova EV, Netesov
V, Loktev VB. Inhibition of West Nile virus replication
by short interfering RNAs. Dokl Biochem Biophys 2006;
410: 260–262.
67. Ying RS, Zhu C, Fan XG et al. Hepatitis B virus is
inhibited by RNA interference in cell culture and in mice.
Antiviral Res 2007; 73: 24–30.
68. Weinberg MS, Ely A, Barichievy S et al. Specific inhibition
of HBV replication in vitro and in vivo with expressed
long hairpin RNA. Mol Ther 2007; 15: 534–541.
69. Chen CC, Ko TM, Ma HI et al. Long-term inhibition of
hepatitis B virus in transgenic mice by double-stranded
adeno-associated virus 8-delivered short hairpin RNA.
Gene Ther 2007; 14: 11–19. Epub 2006 Aug.
70. Rubinson DA, Dillon CP, Kwiatkowski AV et al. A
lentivirus-based system to functionally silence genes in
primary mammalian cells, stem cells and transgenic mice
by RNA interference. Nat Genet 2003; 33: 401–406. Epub
2003 Feb.
71. Westerhout EM, Ooms M, Vink M, Das AT, Berkhout
B. HIV-1 can escape from RNA interference by
evolving an alternative structure in its RNA genome.
Nucleic Acids Res 2005; 33: 796–804.
72. Jackson AL, Bartz SR, Schelter J et al. Expression
profiling reveals off-target gene regulation by RNAi. Nat
Biotechnol 2003; 21: 635–637. Epub 2003 May.
73. Jackson AL, Linsley PS. Noise amidst the silence: offtarget
effects of siRNAs? Trends Genet 2004; 20: 521–524.
74. Persengiev SP, Zhu X, Green MR. Nonspecific, concentration-dependent
stimulation and repression of

mammalian gene expression by small interfering RNAs
(siRNAs). RNA 2004; 10: 12–18.
75. Scacheri PC, Rozenblatt-Rosen O, Caplen NJ et al.
Short interfering RNAs can induce unexpected and
divergent changes in the levels of untargeted proteins in
mammalian cells. Proc Natl Acad Sci U S A 2004; 101:
1892–1897.
76. Carmell MA, Zhang L, Conklin DS, Hannon GJ,
Rosenquist TA. Germline transmission of RNAi in mice.
Nat Struct Biol 2003; 10: 91–92.
77. Akiyoshi DE, Denaro M, Zhu H, Greenstein JL,
Banerjee P, Fishman JA. Identification of a full-length
cDNA for an endogenous retrovirus of miniature swine.
J Virol 1998; 72: 4503–4507.
78. Clemenceau B, Lalain S, Martignat L, Sai P. Porcine
endogenous retroviral mRNAs in pancreas and a panel of
tissues from specific pathogen-free pigs. Diabetes Metab
1999; 25: 518–525.
79. Foss DL, Baarsch MJ, Murtaugh MP. Regulation of
hypoxanthine phosphoribosyltransferase, glyceraldehyde-
Knockdown of PERV in pigs
3-phosphate dehydrogenase and beta-actin mRNA
expression in porcine immune cells and tissues. Anim
Biotechnol 1998; 9: 67–78.
80. Ledger TN, Pinton P, Bourges D, Roumi P, Salmon
H, Oswald IP. Development of a macroarray to specifically
analyze immunological gene expression in swine. Clin
Diagn Lab Immunol 2004; 11: 691–698.
81. Sellner LN, Turbett GR. The presence of a pseudogene
may affect the use of HPRT as an endogenous mRNA
control in RT-PCR. Mol Cell Probes 1996; 10: 481–483.
82. Piechaczyk M, Blanchard JM, Riaad-El Sabouty S,
Dani C, Marty L, Jeanteur P. Unusual abundance of
vertebrate 3-phosphate dehydrogenase pseudogenes. Nature
1984; 312: 469–471.
83. Bisset LR, Böni J, Lutz H, Schüpbach J. Lack of evidence
for PERV expression after apoptosis-mediated
horizontal gene transfer between porcine and human cells.
Xenotransplantation 2007; 14: 13–24.
45