Microbiology Research - Academic Journals

More documents

Recommendations

Info

African Journal of Microbiology Research Vol. 6(24), pp.5198-5204, 28 June, 2012 Available online at http://www.academicjournals.org/AJMR DOI: 10.5897/AJMR11.1619 ISSN 1996-0808 ©2012 Academic Journals Full Length Research Paper Detection of QnrB alleles in Enterobacteriaceae and quinolone-resistance expression Dongguo Wang 1 * + , Jin Zhang 1*+ , Haibao Wang 1 , Yongxiao Qi 2 , Yong Liang 2 and Lianhua Yu 1 1 Department of Clinical Laboratory Medicine, Medical College of Taizhou University affiliated Taizhou Municipal Hospital, Taizhou, 381 Zhongshan Dong Rd. Jiaojiang District of Taizhou, 318000, P.R. China. 2 Department of Lab Medicine, Medical College of Taizhou University, Taizhou, P.R. China. Accepted 14 May, 2012 Plasmid-mediated resistance to quinolones in clinical isolates has been found. We have recently identified the types of the plasmid-mediated qnrB genes in Klebsiella pneumoniae, Escherichia coli and Citrobacter freundii. Through BLASTn analysis of qnrB alleles’ characteristics, we had obtained qnrB5 gene and qnrB31 gene (GenBank accession number HQ418999) in plasmids of isolates of K. pneumoniae, qnrB9 and qnrB16 genes in plasmids of isolates of E. coli, and qnrB2, qnrB15 and qnrB18 genes from C. freundii. And the susceptibility testing showed that the main causes of resistance to quinolone were mediated by plasmid. The analysis of the structure of qnrB alignment showed that LexA-protein-binding site was the determining gene of fluoroquinolone resistance, and if the gene exist, then strains were sensitive to fluoroquinolone and vice versa. Key words: Quinolone-resistance, QnrB, Klebsiella pneumonia, Escherichia coli, Citrobacter freundii. INTRODUCTION Plasmids carrying qnr gene have been found to transmit quinolone resistance (Martínez et al., 1998). These genes encode pentapeptide repeat protein that block the action of ciprofloxacin on bacterial DNA gyrase and topoisomerase IV (Tran and Jacoby, 2002; Tran et al., 2005), resulting in low-level quinolone resistance with an increase in Minimum inhibitory concentration (MIC) of ciprofloxacin for wild-type Escherichia coli J53 from 0.016 to 0.25 μg/ml. This reduced susceptibility is most likely important in that it facilitates the selection of mutants with higher-level resistance (Martínez et al., 1998). The first plasmid-mediated quinolone resistance gene (qnr) was discovered in a Klebsiella pneumoniaee isolating from Birmingham, Alabama, 1994 (Martínez et al., 1998). It occurred in a multi resistance plasmid, pMG252, an integron-like structure near Orf513 (Tran and Jacoby, 2002). Qnr plasmids have been found in *Corresponding author. E-mail: zhangjin_jhb@163.com, wdgtzs@163.com. Tel: +86-576-88858569. Fax: +86-576- 88858284. +Authors contributed equally to this work. clinical isolates of Citrobacter freundii, Enterobacter spp, E. coli, K. pneumoniaee, Providencia stuartii, and Salmonella spp, from the United States, Europe, and the Near and Far East (Cheung et al., 2005; Nordmann and Poirel, 2005). Another qnr gene, qnrS, has also recently been found in a plasmid from a strain of Shigella flexneri which was isolated in Japan (Kim et al., 2010). qnrD has also been found in four Salmonella enterica isolates which were isolated from China (Cavaco et al., 2008). Since then, qnr alleles have been discovered in clinical strains of gram-negative bacilli around the world. Qnr proteins confer quinolone resistance, and belong to the pentapeptide repeat protein (PRP) family (Guo et al., 2010). QnrB gene was found to be of most alleles in qnr families, up to now, there were 51 qnrB alleles that have been discovered in the world (see Lahey Clinic http://www.lahey.org/qnrstudies/). Recently, Thomas Guillard discovered qnrB25 (GenBank accession number HQ172108); Xia R, Guo X and Xu H discovered qnrB26; Shin JH discovered qnrB27, qnrB28, qnrB29, qnrB30, the GenBank accession number are HM439641, HM439643, HM439649, HM439650, respectively; and Wang D discovered qnrB31 (HQ418999) in K. pneumonae (http://www.lahey.org/qnrstudies/).
Table 1. Primers used for PCR and sequencing. Gene Primer Primer sequence (5’→3’) Reference Primer Annealing temperature (°C) Wang et al. 5199 Size of product (bp) qnrB Forward CCTGAGCGGCACTGAATTTAT DQ777878 57 681 qnrB Reverse GTTTGCTGCTCGCCAGTCGA qnrB (sequencing) Forward ATGACGCCATTACTGTATAAAAAA DQ777878 qnrB (sequencing) Reverse CTAGCCAATAATCGCGATGCCA qnrA Forward GCCGTATGGATATTATTGA AY070235 57 657 qnrA Reverse CTAATCCGGCAGCACTAT qnrS Forward ATGGAAACCTACAATCATAC AB178643 50 657 qnrS Reverse AAAAACACCTCGACTTAAGT qnrC Forward ACTGAGTTGGCTCATGTAGC EU917444 50 666 qnrC Reverse CCATTAAGTGACCCGTTG qnrD Forward ACTAACTCGCCGTTTAACAT EU917444 51 645 qnrD Reverse TACCACATTGGGGCATTAGG We have recently identified the types of the plasmid- mediated qnrB genes in K. pneumoniae, E. coli and C. freundii. This study was conducted in order to compare the characteristics and prevalence of the plasmidmediated qnrB alleles gene among K. pneumoniae, E. coli and C. freundii, which were isolated from different specimens from 2008 to 2010 in Taizhou Municipal Hospital of China. MATERIALS AND METHODS Strains We have tested 90 cases of the qnr genes that were resistant to quinolone for Enterobacteriaceae, in which 36 isolates were K. pneumoniae, 34 isolates were E. coli and 20 isolates were C. freundii. The qnr gene were identified by amino acid sequence (Strahilevitz et al., 2009). All K. pneumoniae, E. coli and C. freundii were isolated from different specimens from 2008 to 2010 in Taizhou Municipal Hospital of China, which sufficient amount of bacteria could be obtained from blood for culturing. The samples were cultured directly on MacConkey agar (Difco) and were identified as K. pneumoniae, E. coli and C. freundii using biochemical procedures (Chen et al., 2004). Conjugation and susceptibility testing According to Wang et al. (2003), conjugation experiments were carried out in LB broth with E. coli J53 Az R (resistance to sodium azide) as the recipients, polymerase chain reaction (PCR) positive strains as donor strains. Cultures of donor and recipient cells in logarithmic phase (0.5 ml of each) were added to 4 ml of fresh LB broth and incubated overnight without shaking. Transconjugants were selected on Trypticase soy agar (TSA) plates containing sodium azide (300 mg/L) and ciprofloxacin (0.03 mg/L), and then incubated to 18-24 h at 35°C. To determine if quinolone resistance was co-transferred, MICs for the donor, recipient, and transconjugant strains were compared (Kim et al., 2010). The MICs were determined by broth dilution and interpreted according to Clinical and Laboratory Standards Institute guidelines (CLSI, 2011). PCR-amplified and sequencing To investigate the genetic characteristics of the qnrB allele gene in K. pneumoniaee, E. coli../../../../Program Files/Youdao/Dict4/resultui/queryresult.html, C. freundii and their E. coli transconjugants, PCR amplification was performed to analyze qnr genes used primers listed in Table 1. Corresponding sense and antisense strands were obtained through positive results of DNA sequencing, then sequencing results were assembled. The analysis of all genes was performed through BLASTn program (http://blast.ncbi.nlm.nih.gov/). Plasmid analysis To study the plasmids carrying qnrB2, qnrB5, qnrB9, qnrB15, qnrB16, qnrB18 and qnrB31 genes mapping, the plasmids DNA was extracted (Axygen kit, USA) and separated by 0.6% agarose gel electrophoresis (60 V, 90 min), and then the different sizes of plasmid DNA fragments were cut and recycled (Promega, USA). Used each of recycled plasmid DNA as template, PCR was conducted to amplify qnrB2, qnrB5, qnrB9, qnrB15, qnrB16, qnrB18 and qnrB31genes, where the initial position of all genes plasmids was determined. The primers used for qnrB were all listed in Table 1. The estimated size of plasmid DNA was referenced (Wang et al., 2003). RESULTS AND DISCUSSION Susceptibility testing The MICs results were shown in Table 2. And we could see that the isolates of K. pneumoniaee, E. coli../../../../
Page 1 and 2:
African Journal of Microbiology Res
Page 3 and 4:
Editors Prof. Dr. Stefan Schmidt Ap
Page 5 and 6:
Electronic submission of manuscript
Page 7 and 8:
Fees and Charges: Authors are requi
Page 9 and 10:
nces Table of Contents: Volume 6 Nu
Page 11 and 12:
Table of Contents: Volume 6 Number
Page 13 and 14:
Page 15 and 16:
Table 1. Overview of the Soil prope
Page 17 and 18:
exactly. MICROBIAL BIOMASS IN ORGAN
Page 19 and 20:
Table 3. Advantages and disadvantag
Page 21 and 22:
analysis of polymerase chain reacti
Page 23 and 24:
Enzyme assay Triplicate samples of
Page 25 and 26:
Figure 2. Effect of a) incubation t
Page 27 and 28:
Page 29 and 30:
Table 2. Plasmid profile. Emerenini
Page 31 and 32:
Page 33 and 34:
Table 1. Properties and identity of
Page 35 and 36:
more understandable by the fact tha
Page 37 and 38:
fertilizers considered the most imp
Page 39 and 40:
Table 3. Effect of NPK levels and s
Page 41 and 42:
Table 4. Effect of NPK levels and s
Page 43 and 44:
Table 5. Effect of NPK levels and f
Page 45 and 46:
with mineral NPK on wheat plant. Eg
Page 47 and 48:
to synthetic antibiotics. In spite
Page 49 and 50:
Among these, the K. pneumonia and V
Page 51 and 52:
Figure 5. Pseudomonas aeruginosa An
Page 53 and 54:
pathogens of their environment (She
Page 55 and 56:
cultivable indigenous fishes of Ind
Page 57 and 58:
Page 59 and 60:
Table 1. Oxidative stress parameter
Page 61 and 62:
of tularemia. Ann N Y Acad. Sci., 1
Page 63 and 64:
al., 1998; Heubuelt 1929) have alre
Page 65 and 66:
Table 2. Influence of organic compo
Page 67 and 68:
NO2 NO2 Zare et al. 5131 Figure 4.
Page 69 and 70:
Sundermeyer-Klinger H, Meyer W, War
Page 71 and 72:
Table 1. Composition of Mueller-Hin
Page 73 and 74:
dose level, and is effective antibi
Page 75 and 76:
wearing a mask is useful during the
Page 77 and 78:
Novel Swine-Origin Influenza A H1N1
Page 79 and 80:
that it produces lactic acid, bacte
Page 81 and 82:
Figure 2. DMRT Graph, effect of var
Page 83 and 84: African Journal of Microbiology Res
Page 85 and 86: Bacillus colony Fig 1. Colony morph
Page 87 and 88: thuringiensis isolate S1 (Figure 6)
Page 91 and 92: Figure 1. The Kinetic of P. aerugin
Page 93 and 94: Figure 3. DNA-dosimeter determined
Page 95 and 96: Relative Fluorescence Unit Figure 4
Page 97 and 98: Conclusion The public health risk i
Page 99 and 100: general are members of the normal i
Page 101 and 102: Table 2. Distribution of Nosocomial
Page 103 and 104: and also to assess the influence of
Page 105 and 106: Table 1. List of decamers used in R
Page 107 and 108: Figure 2. RAPD profile of Fusarium
Page 111 and 112: Table 1. Biosurfactant production p
Page 113 and 114: Figure 3. The correlation of reduct
Page 117 and 118: To estimate the water content, stra
Page 119 and 120: Kraiem et al. 5183 Table 2. Effect
Page 121 and 122: log CFU/g log CFU/g log CFU/g 8.5 7
Page 123 and 124: delays to cooling and wrapping on s
Page 125 and 126: pilus (tcp) that is a subtle of pol
Page 127 and 128: protein. DISCUSSION 70 kda 60 kda 5
Page 131 and 132: Percentage repellency (%) Percentag
Page 133: Fumigant toxicity of essential oils
Page 137 and 138: Table 3. Amino acid substitutions i
Page 139 and 140: composition in qnrB alleles. Althou
Page 143 and 144: Figure 1. Overview the Yongxing isl
Page 145 and 146: standard, XSLJ1, XSLJ2, XSLJ5, XSLJ
Page 147 and 148: Table 1. primer information: sequen
Page 149 and 150: conventional method. The reasons fo
Page 153 and 154: Figure 1. Comparison of amplificati
Page 155 and 156: Table 3. Fruiting-body formation an
Page 157 and 158: Yokoyama E, Yamagishi K, Hara A (20
Page 159 and 160: Table 1. Primer oligonucleotide seq
Page 161 and 162: Figure 2. Nucleotide and putative a
Page 163 and 164: Figure 6. Ghrelin expression induce
Page 167 and 168: Table 1. The SNPs related to the pr
Page 169 and 170: Figure 2. The phylogenetic trees of
Page 171 and 172: a c Rex DNA Tang et al. 5235 Figure
Page 175 and 176: Table 1. Gender and division wise d
Page 177 and 178: 62% were genotype D, A (14%), C (6%
Page 181 and 182: Swimming time (s) 1000 800 600 400
Page 183 and 184: Hepatic glycogen (mg/g) Hemoglobin
Page 185 and 186:
Page 187 and 188:
Table 2. Sporulation index. Sign In
Page 189 and 190:
Table 4. Conidial size of different
Page 191 and 192:
Table 6. Sporulation of Alternaria
Page 193 and 194:
Table 7. Reaction of different geno
Page 195 and 196:
Page 197 and 198:
Table 2. Susceptibility of the clin
Page 199 and 200:
Table 4. Aminoglycoside resistance
Page 201 and 202:
Young, and the Councils on Clinical
Page 203 and 204:
oleaginous microorganisms have been
Page 205 and 206:
Table 2. Actual and predicted value
Page 207 and 208:
Table 4. Analysis of variance (ANOV
Page 209 and 210:
Huang et al. 5273 Figure 3. Respons
Page 211 and 212:
the Central Universities (Grant No.
Page 213 and 214:
Figure 1. Mechanism of enzymatic co
Page 215 and 216:
Enzymatic activity (U/mL) Enzymatic
Page 217 and 218:
prunin so far. By using the HPLC me
Page 219 and 220:
Figure 7. Enzymatic conversion of n
Page 221 and 222:
Page 223 and 224:
vaccine, HBs-Ab is negative in all
Page 225 and 226:
Conferences and Advert August 2012
show all

Microbiology Research - Academic Journals

Create successful ePaper yourself

Delete template?

Save as template?