Proceedings book download - 5Z.com

Proceedings of the 31 st European Peptide SymposiumMichal Lebl, Morten Meldal, Knud J. Jensen, Thomas Hoeg-Jensen (Editors)European Peptide Society, 2010The Transcriptional Activator PhoB: ChemicalSynthesis of Epitopes and Functional StudiesMarkus Ritzefeld 1 , Katrin Wollschläger 1 , André Körnig 2 ,Michael Birlo 2 , Robert Ros 2 , Dario Anselmetti 2 , and Norbert Sewald 11 Organic and Bioorganic Chemistry, Bielefeld University, Bielefeld, 33615, Germany;2 Experimental Biophysics and Applied Nanosciences, Bielefeld University,Bielefeld, 33615, GermanyIntroductionDNA-protein interactions are a key element in the regulation of cellular processes. As amodel system, the transcription factor PhoB from E. coli is investigated on peptide and onprotein level using surface plasmon resonance (SPR) and atomic force spectroscopy(AFM). PhoB belongs to the family of winged helix-turn-helix proteins. Afterphosphorylation of the transactivation domain (amino acids 1-127), two PhoB DNAbinding domains (amino acids 127-229) bind in a head to tail arrangement to specific DNAsequences (pho box) containing two TGTCA consensus sequences and two AT-rich minorgrooves [1].Results and DiscussionTo elucidate the specific DNA binding of the transcription factor, epitopes representingparts of the DNA binding domain were chemically synthesized by microwave assisted solidphase peptide synthesis (PhoB(190-209)). Moreover, the complete DNA binding domainwas synthesized and purified using intein mediated protein splicing (PhoB(127-229)).Response (RU)APhoB(127-229) + MmMm65055045035025015050-500 100 200 300 400 500 600t [s]Response (RU)BPhoB(127-229) + Mmxx65055045035025015050-500 100 200 300 400 500 600t [s]Fig. 1. Surface Plasmon Resonance Results. A,B: Sensograms at different analyte concentrations.PhoB(127-229)WT was used as analyte and the oligonucleotide duplexes as ligands.In order to investigate the binding mechanism of PhoB the specific recognition of differentoligonucleotides based on the pho box sequence of the pstS-regulon were analyzed(Figure 1) using PhoB(127-229). The results indicate equal affinities of PhoB for bothbinding sites in position 5’ and 3’. In addition all findings reveal that two proteins are ableto bind to the complete pho box simultaneously. This trimeric complex (Table 1, entry 1)exhibits a significantly reduced K D in comparison to the 1:1 complexes (Table 1,entries 2,3) due to extensive protein-protein interactions.Table 1: Equilibrium dissociation constants of the investigated PhoB(127-229)-DNAcomplexes. CI = 95% confidence interval.Entry Sequence K D [µM] CI1 CTGTCATAAAACTGTCATATTCCT 1.4 0.0-1.82 CGAGGCTAAAACTGTCATATTCCT 14.5 6.9-21.93 CTGTCATAAAACGAGGCAGCATCT 21.9 10.3-33.44 CGAGGCTAAAACTGTCAAGCATCT --- ---478