Gene regulation in Streptococcus pneumoniae - RePub - Erasmus ...

More documents

Recommendations

Info

Materiaals and Meethods Gene regulation by RR09 in S. pneumoniae Pneumoococcal strains WWild-type SS. pneumonniae strainss D39 (= NCTC N 74666; serotypee 2) and TI IGR4 (= ATCC BBAA-334; serotype 4) ) were usedd in this stu udy. The rr09 derivaative of TIG GR4 was construccted by inseertional inacctivation using an eryth hromycin reesistance caassette, as described d previouusly for D399 rr09 (3). Pneumococccal strains were grownn on Colummbia blood base b agar supplemmented withh 5% (vol/vvol) defibrinnated sheep p blood (annd supplemeented with 1 µg/ml erythrommycin for thhe rr09 mutant strains) . For RNA isolation annalyses, culttures were grown g in Todd-HHewitt brothh supplemennted with 5 g/liter yea ast extract ( (THY brothh) or in bra ain heart infusionn broth (BHHI broth) wiithout erythromycin un ntil they reaached the deesired turbid dity. For construcction of thee sp0063 muutant (annottated spr0062 in R6), aapproximateely 100-bp portions of up- aand downstrream regionns of the targgeted sequence were ammplified by PCR using g primers 50L (TCTATGATTTGGTATT TTCTATCG GTAGG) aand 50M (GGCGGCGCCTGA AGGTAAGGATCATGT TAAAGGT TAACC) and primers 50N (TCTTAACCTCAGGGCGCGCC CACTGCCTTTATCTTCTGGTTTGCTTGG) and 50O (CAAAATTTAGCA AGTAAATTTCTTCTGG GG), respe ectively. Thhese fragmeents were jo oined by overlap extension PCR due tto overlap iin the 50 M and 50N primers. TThis proced dure also introducced an AscII site betweeen the upstrream and do ownstream sequences vvia the prim mers. The fusion PPCR producct was cloneed into TOPPO-pCR4 (I Invitrogen) and confirmmed by sequ uencing. The speectinomycin n resistancee cassette frrom pDL27 78 was clonned into thee AscI site, and the resultingg construct was used foor transformmation of D3 39. Spectinomycin-resistant colon nies were verifiedd by PCR. TThis mutatioon resulted in replacem ment of nuccleotides 1776 to 676 of f sp0063 with thee spectinommycin resistaance cassettee. Mice an F Olac, B anesthet 10 6 nd infectionns Female outtbred MF1 mice (bodyy weight, 25 2 to 30 g) ) were purcchased from m Harlan Bicester, Unnited Kingddom. For ppneumonia infection, 99-week-old mice were e lightly tized with 22.5% (vol/vvol) halothanne, after wh hich an infeection dose consisting of 1.0 x CFUU of wild-ttype strain TIGR4 andd the ∆rr09 9 mutant reesuspended in 50 µl of o sterile phosphaate-bufferedd saline (PBBS) was admministered in n the nostriils of mice hheld vertica ally (12). At predeetermined times after iinfection, grroups of mice were saccrificed by ccervical disl location, and blood sampless were remooved by carrdiac punctu ure using a 1-ml syringge. Broncho oalveolar lung lavvage and saampling off the lungs were perfo ormed as ddescribed prreviously (1 13). The 29 29
Chapter 2 viable bacteria in lung and blood samples were counted by plating serial 10-fold dilutions on blood agar base no. 2 (Oxoid, United Kingdom) supplemented with 5% (vol/vol) defibrinated horse blood (13). Mice infected with wild-type strain D39 and the ∆sp0063 mutant were inoculated intraperitoneally with 100 µl PBS containing 1 x 10 6 CFU. 30 30 Survival times were analyzed using the Mann-Whitney U test. The bacteriology results are expressed below as geometric means ± standard errors of the means. Bacterial loads obtained in the time experiment were compared using Student's t test. In all analyses, a P value of
Page 1 and 2: Gene regulation in Streptococcus pn
Page 3 and 4: Cover image by Duve van Boggelen (w
Page 5 and 6: Promotiecommissie Promotoren: Prof.
Page 8 and 9: CHAPTER 1 Introduction 7
Page 10 and 11: Introduction Figure 1. Infections c
Page 12 and 13: Interestingly, autolysis induced by
Page 14 and 15: histidine kinase is the sensor prot
Page 16 and 17: metabolism are often required for v
Page 18 and 19: egulatory systems, aiming to elucid
Page 20 and 21: 11. Cockeran, R., A. J. Theron, H.
Page 22 and 23: 33. Li, S., S. J. Kelly, E. Lamani,
Page 24 and 25: 53. Romero, P., R. Lopez, and E. Ga
Page 26 and 27: CHAPTER 2 Regulation of gene expres
Page 28 and 29: Introduction Streptococcus pneumoni
Page 32 and 33: (Invitrogen), 0.2 mM aminoallyl dUT
Page 34 and 35: Isolation of pneumococcal RNA durin
Page 36 and 37: Resultss and Discuussion Gene regul
Page 38 and 39: Table 1. Genes regulated by RR09 in
Page 40 and 41: phosphofructokinase, and a fructose
Page 42 and 43: Figure 4. Expression of rlrA and rr
Page 44 and 45: correlated well with our in vitro m
Page 46 and 47: Figure 7. Bacterial loads in blood
Page 48 and 49: Acknowledgments This work was suppo
Page 50 and 51: 10. Ibrahim, Y. M., A. R. Kerr, J.
Page 52 and 53: genome sequence of a virulent isola
Page 54 and 55: Gene regulation by RR09 in S. pneum
Page 56 and 57: Gene regulation by RR09 in S. pneum
Page 58 and 59: Table S4. Genes up- and downregulat
Page 60: Table S6. Genes up- and downregulat
Page 63 and 64: Chapter 3 Abstract 62 62 Previous s
Page 65 and 66: Chapter 3 between the wild-type and
Page 67 and 68: Chapter 3 S. pneumoniae TIGR4 by CS
Page 69 and 70: Chapter 3 performance liquid chroma
Page 71 and 72: Chapter 3 Results Transcriptional a
Page 73 and 74: Chapter 3 Table 3. Differentially e
Page 75 and 76: Chapter 3 Figure 2. Colonization mo
Page 77 and 78: Chapter 3 than the D39ΔpsaR-infect
Page 79 and 80: Chapter 3 effect was more severe fo
Page 81 and 82:
Chapter 3 in TIGR4ΔpsaR. However,
Page 83 and 84:
Chapter 3 References 1. Adrian, P.
Page 85 and 86:
Chapter 3 21. Hemsley, C., E. Joyce
Page 87 and 88:
Chapter 3 40. McCluskey, J., J. Hin
Page 90 and 91:
CHAPTER 4 CodY of Streptococcus pne
Page 92 and 93:
Introduction Bacteria encounter var
Page 94 and 95:
Materials and Methods Bacterial str
Page 96 and 97:
Table 2. Oligonucleotide primers us
Page 98 and 99:
The CodY regulon of S. pneumoniae I
Page 100 and 101:
The CodY regulon of S. pneumoniae w
Page 102 and 103:
Accession numbers The microarray da
Page 104 and 105:
Table 3. Differentially expressed g
Page 106 and 107:
Binding of CodY to target promoters
Page 108 and 109:
The CodY regulon of S. pneumoniae E
Page 110 and 111:
The CodY regulon of S. pneumoniae F
Page 112 and 113:
Discussion CodY has been described
Page 114 and 115:
levels of adherence in D39. Using a
Page 116 and 117:
References The CodY regulon of S. p
Page 118 and 119:
Glass. 2001. Genome of the bacteriu
Page 120 and 121:
40. Shivers, R. P., S. S. Dineen, a
Page 122 and 123:
CHAPTER 5 Regulation of glutamine a
Page 124 and 125:
Introduction Regulation of nitrogen
Page 126 and 127:
Materials and Methods Nitrogen Meta
Page 128 and 129:
TK136 D39 Δcps; Km R capsule-less
Page 130 and 131:
gene from pORI28, was fused to the
Page 132 and 133:
Construction of lacZ fusions Chromo
Page 134 and 135:
Enzyme assays Cell-free extracts, u
Page 136 and 137:
Reverse-transcriptase PCR RNA isola
Page 138 and 139:
Table 3. Summary of transcriptome c
Page 140 and 141:
effect caused by altered intracellu
Page 142 and 143:
examine whether zwf is only transcr
Page 144 and 145:
(http://www.bd.com/ds/technicalCent
Page 146 and 147:
H6-GlnR alone at the concentration
Page 148 and 149:
Discussion In this study, we charac
Page 150 and 151:
Acknowledgements TK, JB and HB are
Page 152 and 153:
11. den Hengst, C. D., S. A. van Hi
Page 154 and 155:
Nitrogen Metabolism in S. pneumonia
Page 156 and 157:
52. Wray, L. V., Jr., J. M. Zalieck
Page 158 and 159:
CHAPTER 6 Site-specific contributio
Page 160 and 161:
Introduction GlnR-regulon and pneum
Page 162 and 163:
Materials and Methods Bacterial str
Page 164 and 165:
eferred to as t=0. Bacteriology res
Page 166 and 167:
Results GlnR-regulon and pneumococc
Page 168 and 169:
Figure 3. Colonization model. Bacte
Page 170 and 171:
GlnR-regulon and pneumococcal virul
Page 172 and 173:
Table 2. Differentially expressed g
Page 174 and 175:
Discussion The ability to adequatel
Page 176 and 177:
The microarray data showed that pre
Page 178 and 179:
Acknowledgments WTH is supported by
Page 180 and 181:
12. Ibrahim, Y. M., A. R. Kerr, J.
Page 182 and 183:
33. Zalieckas, J. M., L. V. Wray, J
Page 184 and 185:
CHAPTER 7 Pneumococcal gene regulat
Page 186 and 187:
Introduction Regulation of gene exp
Page 188 and 189:
Gene regulation and metabolism in S
Page 190 and 191:
makes it possible for the pneumococ
Page 192 and 193:
A CcpA homologue exists in the pneu
Page 194 and 195:
double mutant, suggesting direct re
Page 196 and 197:
References Gene regulation and meta
Page 198 and 199:
23. Kerr, A. R., P. V. Adrian, S. E
Page 200 and 201:
45. Sonenshein, A. L. 2005. CodY, a
Page 202 and 203:
CHAPTER 8 Summarizing discussion 20
Page 204 and 205:
that the observed virulence phenoty
Page 206 and 207:
CodY was found to be required for a
Page 208 and 209:
References Summarizing discussion 1
Page 210 and 211:
Summarizing discussion 21. Orihuela
Page 212 and 213:
Samenvatting en discussie Curriculu
Page 214 and 215:
Samenvatting en discussie kunnen ge
Page 216 and 217:
Bevindingen die dit onderbouwen, we
Page 218 and 219:
Curriculum Vitae Curriculum Vitae W
Page 220 and 221:
Dankwoord Jeetje, dat het dan toch
Page 222:
oekje en ik kijk uit naar de bijbeh
show all

Gene regulation in Streptococcus pneumoniae - RePub - Erasmus ...

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?