Gene regulation in Streptococcus pneumoniae - RePub - Erasmus ...

More documents

Recommendations

Info

Materials and Methods Bacterial strains and media The pneumococcal strains used in this study are listed in Table 1 and were grown at 37�C in Todd Hewitt Yeast broth (THY), in chemically defined medium (CDM, recipe available on request), or on Colombia base agar (Oxoid) supplemented with 5% sheep blood (Biotrading). Pneumococcal strains were maintained in 10% (v/v) glycerol, 10% skim milk at -80�C. Escherichia coli DH5α (Stratagene) was grown in Luria Broth at 37�C while shaking or on Luria Broth agar. Media were supplemented with antibiotics (50 mg/l ampicillin and/or 20 mg/l trimethoprim) when appropriate. Table 1. Pneumococcal strains used in this study. Strain Gene Identifier Antibiotic resistance Reference D39 wild-type - - NCTC 7466; serotype 2 D39ΔpsaR spd1450 trimethoprim This study TIGR4 wild-type - - ATCC BAA-334; serotype 4 TIGR4ΔpsaR sp1638 trimethoprim This study PsaR and pneumococcal virulence Construction of psaR-mutants The gene encoding psaR was deleted from strain TIGR4 (sp1638) and D39 (spd1450) by allelic replacement with the dfr13 cassette conferring trimethoprim resistance (1). To this end, psaR with 1,000 bp of upstream and downstream flanking sequences was amplified from chromosomal TIGR4 DNA using primer pair psaRSacFw and psaRKnpRv (all primers are listed in Table 2). This amplicon was cloned into pBlueScript KS+ (Stratagene) using the SacII and KpnI restriction sites. The coding sequence of psaR was deleted from the plasmid by performing an inverse PCR with primer pair psaRNotFw and psaRSalRv, amplifying the psaR-flanking sequences and pBlueScript KS+ and introducing NotI and SalI restriction sites for further cloning. This amplicon was ligated to the dfr13-cassette, which was amplified from pKOT (22) with the primers TmpSalFw and TmpNotRv, to create the knockout construct pKOpsaR-T4, and transformed to E. coli DH5α. A 2,620-bp linear DNA fragment containing psaR-flanking DNA and dfr13 was amplified from pKOpsaR-T4 using primer pair psaRSacFw and psaRKnpRv. This PCR product was used to delete psaR from the genome of 65 65
Chapter 3 S. pneumoniae TIGR4 by CSP-2-induced (100 ng/ml) transformation. Transformants were selected on the basis of trimethoprim-resistance and were checked by sequencing for recombination at the desired location on the chromosome, i.e., replacement of psaR by dfr3 (which will be transcribed in the opposite direction of psaR). Wild-type TIGR4 was subsequently transformed with chromosomal DNA isolated from these ΔpsaR transformants to rule out the possibility of any additional mutations on the chromosome. The identical procedure was performed for the construction of D39ΔpsaR, with the exception that the 3’ chromosomal region from TIGR4 of pKOpsaR-T4 was replaced by the D39-specific 3’ psaR- region. This region differs between the two strains: it contains an ISS element in TIGR4, and a small ORF encoding a unique hypothetical protein in D39. Transformation of D39 was induced with CSP-1 (100ng/ml). Table 2. Oligonucleotide primers used in this study. Primername Sequence (5'-3') a Restriction site Strain psaRSacFw GCGCCCGCGGGGAATTTGCATCCTCTTCTCC SacII D39/TIGR4 psaRKnpRv GCGCGGTACCATATTGCCCATCAGCTTTCC KpnI TIGR4 psaRNotFw GCGCGCGGCCGCTCCTCAGTAACGACGAGGATTT NotI D39/TIGR4 psaRSalRv GCGCGTCGACGCAGGTCTATGCCAATTTCA SalI D39/TIGR4 TmpSalFw CGCGGTGGTCGACGGATTTTTGTGAGCTTGGACT SalI D39/TIGR4 TmpNotRv GGGGGGCCGCGGCCGCTTACGACGCGCATAGACG NotI D39/TIGR4 psaRKpnRv-D39 GAAAATGGTACCAGAGAGCAAGAGCCACTC KpnI D39 SeqTmpFw ATAAATGCGGACCGATTCC - D39/TIGR4 SeqTmpRv GCCTTCTTCCCAGTGCTTAAC - D39/TIGR4 a Restriction sites on oligonucleotide primers are underlined Transcriptional profiling of D39 and TIGR4 psaR-mutants 66 66 Microarray analysis was performed essentially as described (22, 24). In short, 500 ml of CDM was inoculated with 10-20 colonies from agar plates, and these cultures were statically grown at 37°C. Samples for RNA isolation were taken when the cultures reached an optical density (OD600) of 0.2 (mid-log growth). RNA was isolated and purified using the High Pure RNA isolation kit (Roche diagnostics) as described (22, 24). Contaminating genomic DNA was removed by treatment with RNase-free DNase I (Roche diagnostics). RNA was isolated from three replicate cultures. Synthesis, subsequent labeling of cDNA, and microarray hybridization was performed as described (24, 33). In all cases, dye-swapping was performed with one of the three biological replicates. Microarrays used in this study were constructed as described (24, 33) and contain amplicons representing 2,087 ORFs of S. pneumoniae TIGR4 and 184 ORFs unique for S. pneumoniae R6, all spotted in duplicate.
Page 1 and 2:
Gene regulation in Streptococcus pn
Page 3 and 4:
Cover image by Duve van Boggelen (w
Page 5 and 6:
Promotiecommissie Promotoren: Prof.
Page 8 and 9:
CHAPTER 1 Introduction 7
Page 10 and 11:
Introduction Figure 1. Infections c
Page 12 and 13:
Interestingly, autolysis induced by
Page 14 and 15:
histidine kinase is the sensor prot
Page 16 and 17: metabolism are often required for v
Page 18 and 19: egulatory systems, aiming to elucid
Page 20 and 21: 11. Cockeran, R., A. J. Theron, H.
Page 22 and 23: 33. Li, S., S. J. Kelly, E. Lamani,
Page 24 and 25: 53. Romero, P., R. Lopez, and E. Ga
Page 26 and 27: CHAPTER 2 Regulation of gene expres
Page 28 and 29: Introduction Streptococcus pneumoni
Page 30 and 31: Materiaals and Meethods Gene regula
Page 32 and 33: (Invitrogen), 0.2 mM aminoallyl dUT
Page 34 and 35: Isolation of pneumococcal RNA durin
Page 36 and 37: Resultss and Discuussion Gene regul
Page 38 and 39: Table 1. Genes regulated by RR09 in
Page 40 and 41: phosphofructokinase, and a fructose
Page 42 and 43: Figure 4. Expression of rlrA and rr
Page 44 and 45: correlated well with our in vitro m
Page 46 and 47: Figure 7. Bacterial loads in blood
Page 48 and 49: Acknowledgments This work was suppo
Page 50 and 51: 10. Ibrahim, Y. M., A. R. Kerr, J.
Page 52 and 53: genome sequence of a virulent isola
Page 54 and 55: Gene regulation by RR09 in S. pneum
Page 56 and 57: Gene regulation by RR09 in S. pneum
Page 58 and 59: Table S4. Genes up- and downregulat
Page 60: Table S6. Genes up- and downregulat
Page 63 and 64: Chapter 3 Abstract 62 62 Previous s
Page 65: Chapter 3 between the wild-type and
Page 69 and 70: Chapter 3 performance liquid chroma
Page 71 and 72: Chapter 3 Results Transcriptional a
Page 73 and 74: Chapter 3 Table 3. Differentially e
Page 75 and 76: Chapter 3 Figure 2. Colonization mo
Page 77 and 78: Chapter 3 than the D39ΔpsaR-infect
Page 79 and 80: Chapter 3 effect was more severe fo
Page 81 and 82: Chapter 3 in TIGR4ΔpsaR. However,
Page 83 and 84: Chapter 3 References 1. Adrian, P.
Page 85 and 86: Chapter 3 21. Hemsley, C., E. Joyce
Page 87 and 88: Chapter 3 40. McCluskey, J., J. Hin
Page 90 and 91: CHAPTER 4 CodY of Streptococcus pne
Page 92 and 93: Introduction Bacteria encounter var
Page 94 and 95: Materials and Methods Bacterial str
Page 96 and 97: Table 2. Oligonucleotide primers us
Page 98 and 99: The CodY regulon of S. pneumoniae I
Page 100 and 101: The CodY regulon of S. pneumoniae w
Page 102 and 103: Accession numbers The microarray da
Page 104 and 105: Table 3. Differentially expressed g
Page 106 and 107: Binding of CodY to target promoters
Page 108 and 109: The CodY regulon of S. pneumoniae E
Page 110 and 111: The CodY regulon of S. pneumoniae F
Page 112 and 113: Discussion CodY has been described
Page 114 and 115: levels of adherence in D39. Using a
Page 116 and 117:
References The CodY regulon of S. p
Page 118 and 119:
Glass. 2001. Genome of the bacteriu
Page 120 and 121:
40. Shivers, R. P., S. S. Dineen, a
Page 122 and 123:
CHAPTER 5 Regulation of glutamine a
Page 124 and 125:
Introduction Regulation of nitrogen
Page 126 and 127:
Materials and Methods Nitrogen Meta
Page 128 and 129:
TK136 D39 Δcps; Km R capsule-less
Page 130 and 131:
gene from pORI28, was fused to the
Page 132 and 133:
Construction of lacZ fusions Chromo
Page 134 and 135:
Enzyme assays Cell-free extracts, u
Page 136 and 137:
Reverse-transcriptase PCR RNA isola
Page 138 and 139:
Table 3. Summary of transcriptome c
Page 140 and 141:
effect caused by altered intracellu
Page 142 and 143:
examine whether zwf is only transcr
Page 144 and 145:
(http://www.bd.com/ds/technicalCent
Page 146 and 147:
H6-GlnR alone at the concentration
Page 148 and 149:
Discussion In this study, we charac
Page 150 and 151:
Acknowledgements TK, JB and HB are
Page 152 and 153:
11. den Hengst, C. D., S. A. van Hi
Page 154 and 155:
Nitrogen Metabolism in S. pneumonia
Page 156 and 157:
52. Wray, L. V., Jr., J. M. Zalieck
Page 158 and 159:
CHAPTER 6 Site-specific contributio
Page 160 and 161:
Introduction GlnR-regulon and pneum
Page 162 and 163:
Materials and Methods Bacterial str
Page 164 and 165:
eferred to as t=0. Bacteriology res
Page 166 and 167:
Results GlnR-regulon and pneumococc
Page 168 and 169:
Figure 3. Colonization model. Bacte
Page 170 and 171:
GlnR-regulon and pneumococcal virul
Page 172 and 173:
Table 2. Differentially expressed g
Page 174 and 175:
Discussion The ability to adequatel
Page 176 and 177:
The microarray data showed that pre
Page 178 and 179:
Acknowledgments WTH is supported by
Page 180 and 181:
12. Ibrahim, Y. M., A. R. Kerr, J.
Page 182 and 183:
33. Zalieckas, J. M., L. V. Wray, J
Page 184 and 185:
CHAPTER 7 Pneumococcal gene regulat
Page 186 and 187:
Introduction Regulation of gene exp
Page 188 and 189:
Gene regulation and metabolism in S
Page 190 and 191:
makes it possible for the pneumococ
Page 192 and 193:
A CcpA homologue exists in the pneu
Page 194 and 195:
double mutant, suggesting direct re
Page 196 and 197:
References Gene regulation and meta
Page 198 and 199:
23. Kerr, A. R., P. V. Adrian, S. E
Page 200 and 201:
45. Sonenshein, A. L. 2005. CodY, a
Page 202 and 203:
CHAPTER 8 Summarizing discussion 20
Page 204 and 205:
that the observed virulence phenoty
Page 206 and 207:
CodY was found to be required for a
Page 208 and 209:
References Summarizing discussion 1
Page 210 and 211:
Summarizing discussion 21. Orihuela
Page 212 and 213:
Samenvatting en discussie Curriculu
Page 214 and 215:
Samenvatting en discussie kunnen ge
Page 216 and 217:
Bevindingen die dit onderbouwen, we
Page 218 and 219:
Curriculum Vitae Curriculum Vitae W
Page 220 and 221:
Dankwoord Jeetje, dat het dan toch
Page 222:
oekje en ik kijk uit naar de bijbeh
show all

Gene regulation in Streptococcus pneumoniae - RePub - Erasmus ...

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?