CONSERVATION OF ARABIAN GAZELLES - Nwrc.gov.sa

• Sequencing: With the advent of the Polymerase Chain Reaction (PCR) (Saiki, 1988) this
most versatile of the DNA· based techniques is becoming more practicable for the general
biochemical or biological laboratory. The PCR technique has two key features:
a) Specificity: The ability to select precisely the segment of DNA studied from the three
billion or so bases of the typical mammalian genome.
b) Amplification: The ability to amplify the segment of DNA selected by over a million-fold
in a matter of an hour or so, to give sufficient quantities of DNA for sequencing.
Sequencing is not a difficult method to apply, although it needs some skills, understand ing of
basic biochemistry, and experience. It is surprisingly effective even on poor quality or old starting
material. Figure 6.3 illustrates DNA sequence data from three related taxa which have been aligned ­
not always a trivial task - to provide data for either distance measures (counts of the pairwise
proportion of shared bases) or cladistic characters (although the latter will always require at least four
taxa in the analysis). Taxa 1 and 2 have two base differences giving a proportion of shared bases of
30/32 =0.94, or a sequence divergence of (1-0.94) x 100 =6%. Taxa I and 3 show a 22% sequence
divergence, as do taxa 2 and 3. Given time, sequencing can provide unlimited amounts of data for
use at all levels of investigation, but is of most use in detailed systematic studies.
1. GGACTGAGTCCTCTCAAAAGCTAGCATGGATC
2. GAACTGAGTCCTCTCAAGAGCTAGCATGGATC
3. GAATCGAGTTCTCCCAAAGGCTAGCAAGGATC
Figure 6.3 Schematic illustration of DNA sequence data from three related taxa whi ch have been aligned to
provide data for either distance measures or cladistic characters.
Conclusion
Although DNA-based methods provide large quantities of objective data for cladistic or distance
based studies, they are not infallible. With more distantly-related taxa, the data sets can present many
homoplasies. This impairs the ability of cladistic (e.g. maximum parsimony) methods to reveal the
correct topology. For closely related-taxa, accumulating sufficient data to overcome stochastic error
is difficult, and this impairs the ability of distance-based methods to reveal the correct topology even
when the rate of change in the DNA is the same (see Figu re 6.1 ). DNA methods are best seen as an
excellent complement to morphological, cytogenetic and allozyme approaches. Taken in this context,
provided the appropriate quantity and quality of data are selected and analyzed correctly, DNA
approaches are becomi ng increasingly valuable in providing answers of practical value in
conservation management .
Acknowledgements
We would particularly like to acknowledge H.R.H. Prince Saud AI Faisal, Prof. Abdulaziz Abuzinada
and all the people who organized the meeting in Riyadh. We thank Laurent Granjon for useful
comments on an early draft of the manuscript.
74