Mechanisms of Olfaction in Insects - ResearchSpace@Auckland ...

More documents

Recommendations

Info

Identification of putative odorant receptors from Epiphyas postvittana 86 4.2 Materials and Methods 4.2.1 Materials All the PCR reagents were from Invitrogen unless otherwise stated. 4.2.2 Total RNA Extraction RNA was extracted from two pools of 100 antennae pairs each for male and female E. postivttana and from two pools of moth female body without the head, with three bodies per pool. TRIzol Reagent (Invitrogen) was used for isolating RNA following manufacturer‟s instructions, and the resulting pellet resuspended in 20 µL of TE buffer. The concentration of the samples was measured on a nanodrop at an optical density of 260-280 (OD260/280) (Thermo Sceintific) and the samples stored at -80°C until use. 4.2.3 mRNA Isolation mRNA from male and female E. postvittana antennae was isolated using the Ambion MicroPoly(A)Purist Kit (Applied Biosystems) and the quality assessed on an Agilent 2100 Bioanalyzer, following manufacturer‟s instructions. 4.2.4 cDNA Synthesis cDNA was synthesised from 1µg of RNA using either Superscript III reverse transcript (Invitrogen) or the iscript cDNA synthesis kit (Bio-Rad), following manufacturer‟s instructions. A no reverse transcriptase control was included for every sample, and the synthesised cDNA stored at -20°C until required. 4.2.5 Degenerate PCR To identify conserved regions between E. postvittana OR1 and ORs from three other insect species belonging to the same phylogenetic clade (M. sexta, B. mori and H. virescens), multiple sequence alignment of the following OR protein sequences were conducted using clustalX 1.81 (MsOR1, BmOR3, HvOR6, HvOR16, HvOR14,
Identification of putative odorant receptors from Epiphyas postvittana 87 HvOR15, HvOR11, BmOR5, BmOR7, HvOR13, BmOR4, BmOR1, EpOR1, BmOR6) with default settings. Two regions each containing the highest levels of conservation within the alignment were selected to design outer and inner nested degenerate primers for degenerate PCR using the Ro and Ri primers, given in Table 4.1 (See appendix B for sequence alignment). Table 4.1: Outer and nested degenerate primers used in degenerate PCR of male E. postvittana antennal cDNA. Primer Name Primer Sequence (5’ – 3’) Outer ARNYTNATHGAYGCNGTNTA Nested GGNYTNCCNTGGGARTRYATGGA Ro (outer reverse) ATCGATGGTCGACGCATGCGGATCC Ri (nested reverse) GGATCCAAAGCTTGAATTCGAGCTC Five microlitres of ten-fold-diluted cDNA was used as template in the first PCR together with 1x PCR buffer including 1.5 mM magnesium, 0.2 mM of each dNTP, 2 units of Taq DNA polymerase and 0.5 µM of each outer primer. The final volume was made up to 50 µL with sterile water. The PCR cycling conditions were as follows: initial denature at 94°C for 2 minutes, followed by 35 cycles of 94°C for 20 second, 55°C for 30 seconds and 72°C for 1 minutes, and a final extension at 72°C for 10 minutes. One microlitre of product from the first round of PCR was used as template in a second round of PCR using the nested primers. The same PCR conditions were used as in the first round of PCR. 10 µL of PCR product was analysed on 1% agarose gel with 1x SYBR safe DNA gel stain (Invitrogen) and visualised on the ImageQuant 300 system (GE Healthcare Life Sciences). 4.2.6 Cloning and Sequencing Products greater than 500 bp were excised from the gel and DNA extracted using the gel purification kit (Qiagen), following manufacturer‟s instructions, after which they were ligated into pGEM-T Easy vector (Promega) using T4 DNA ligase following manufacturer‟s instructions. The plasmids were transformed into chemically competent DH5α cells. Briefly, 2 µL of the plasmid was mixed gently with 25 µL
Page 1 and 2:
http://researchspace.auckland.ac.nz
Page 3 and 4:
Abstract Abstract Olfaction or the
Page 5 and 6:
Acknowledgements Acknowledgements I
Page 7 and 8:
Contents v Contents Abstract……
Page 9 and 10:
Contents 4.2.5 Degenerate PCR .....
Page 11 and 12:
List of Figures List of Figures Fig
Page 13 and 14:
List of Tables List of Tables Table
Page 15 and 16:
List of Abbreviations gDNA Genomic
Page 17 and 18:
1.1 General overview 1 General Intr
Page 19 and 20:
General Introduction 3 moth in loca
Page 21 and 22:
General Introduction 5 Figure 1.1:
Page 23 and 24:
General Introduction 7 1.5 Componen
Page 25 and 26:
General Introduction 9 OBPs have al
Page 27 and 28:
General Introduction 11 A model has
Page 29 and 30:
Page 31 and 32:
General Introduction 15 Tanaka et a
Page 33 and 34:
General Introduction 17 Table 1.1:
Page 35 and 36:
Page 37 and 38:
General Introduction 21 et al., 200
Page 39 and 40:
General Introduction 23 the attract
Page 41 and 42:
General Introduction 25 leaves and
Page 43 and 44:
Page 45 and 46:
General Introduction 29 Expression
Page 47 and 48:
General Introduction 31 BmOr2 HvOr2
Page 49 and 50:
General Introduction 33 for lepidop
Page 51 and 52: Functional characterisation of Epip
Page 73 and 74: 3.1 Introduction 3 The roles of Epi
Page 75 and 76: The roles of Epiphyas postvittana G
Page 95 and 96: 4.1 Introduction 4 Identification o
Page 97 and 98: Identification of putative odorant
Page 101: Identification of putative odorant
Page 109 and 110: Microarray OR 454 Transcriptome OR
Page 141 and 142: 5.1 Introduction 5 Concluding Discu
Page 143 and 144: Concluding Discussion 127 VOBA sett
Page 145 and 146: Concluding Discussion 129 redundant
Page 147 and 148: Concluding Discussion 131 against t
Page 149 and 150: Concluding Discussion 133 sequencin
Page 151 and 152: Appendix B 135 Buffered TB (Sambroo
Page 153 and 154:
Appendix C 137 C. Appendix C - Clus
Page 155 and 156:
Appendix D 139 D. Appendix D - Solu
Page 157 and 158:
Appendix E 141 I II
Page 159 and 160:
Appendix E 143 V
Page 161 and 162:
Appendix E 145 VII continued Figure
Page 163 and 164:
References 147 Ansebo, L., Ignell,
Page 165 and 166:
References 149 Butenandt, A., Beckm
Page 167 and 168:
References 151 Fedurco, M., Romieu,
Page 169 and 170:
References 153 Große-Wilde, E., St
Page 171 and 172:
References 155 Hrdy, I., F. Kuldova
Page 173 and 174:
References 157 Kaissling, K. E. (19
Page 175 and 176:
References 159 Krieger, J., Große-
Page 177 and 178:
References 161 Lopez-Gomez, R. and
Page 179 and 180:
References 163 Miura, N., Nakagawa,
Page 181 and 182:
References 165 Pell, J. K., Macaula
Page 183 and 184:
References 167 Røstelien, T., Stra
Page 185 and 186:
References 169 Stowers, L. and Loga
Page 187 and 188:
References 171 Turner, C. T., Davy,
Page 189 and 190:
References 173 Vogt, R. G., Riddifo
Page 191 and 192:
References 175 Widmayer, P., Heifet
show all

Mechanisms of Olfaction in Insects - ResearchSpace@Auckland ...

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?