Mechanisms of Olfaction in Insects - ResearchSpace@Auckland ...

More documents

Recommendations

Info

Functional characterisation of Epiphyas postvittana odorant receptor 1 40 BDH), geranial (96.1%, synthesised by the method of Dess and Martin (1983), geranyl acetate (98%, Sigma), nerol (97%, Sigma), linalool (97%, racemic, Sigma), (+)-limonene (97%, Sigma), 1,8 cineole (90%, Fluka, Ronkonkoma, NY), myrcene (Sigma), -terpineol (98%, Sigma), -farnesene (Sigma), caryophyllene (Koch-light labs, Cambridge, MA), citronellol (95%, racemic, Sigma), humulene (ABD), octanol (99.5%, Fluka), nonanol (98%, Fluka), hexanol (98%, Fluka), hexanal (98%, Sigma), hexyl acetate (99%, Sigma), methyl salicylate (99%, Sigma), eugenol (BDH), ethyl butyrate (Hopkin and Williams, Chadwell Health, Essex, UK), ethyl hexanoate (99%, Sigma), pentyl acetate (99%, Sigma), dodecyl acetate (97%, Sigma), squalene (99%, Sigma), pentanol (99.8%, Fluka), octanol (99.5%, Fluka), ethyl octanoate (99%, Sigma), propyl propanoate (99.7%, Fluka), octyl acetate (99%, Sigma), propyl acetate (99.7%, Fluka) and (E)-11-tetradecenyl acetate (97%, Sigma). Nerol, pentyl acetate, octanol, geranyl acetate and methyl salicylate were stored at RT, while all remaining compounds were stored at 4°C. The assay saline buffer (pH 7.2) contained 21 mM KCl, 12 mM NaCl, 18 mM MgCl2, 3 mM CaCl2.H2O, 170 mM d-glucose, 1 mM probenecid (Sigma–Aldrich) and 10 mM PIPES-dipotassium salt. The assay saline buffer was sterilised by filtration through a 0.22µM SteriCup–GP filter unit (Millipore) and stored at room temperature. 2.2.2 Insect cell culture S. frugiperda Sf9 cells (Invitrogen) were maintained in shaker cultures in 50 mL flasks at 28°C in the dark. The cells were grown to a density of 1 x 10 7 cells/mL in Sf 900 II serum free media (Invitrogen) after which they were seeded in new flasks at 1 x 10 5 cells/mL. 2.2.3 Transfection of cells Viable cells were seeded at a density of 1 x 10 6 cells/mL in 12 well tissue culture Nunclone plates with 400 µL Sf 900 II media. 0.5 µg pIB-EpOR1 (N-myc-tagged EpOR1 in pIB-V5/His vector, constructed by Melissa Jordan) or the empty vector control pIB-V5/His was incubated with 12 µL of the transfection reagent escort IV (Sigma) and 100 µL of Sf 900 II media for each well at room temperature for 15
Functional characterisation of Epiphyas postvittana odorant receptor 1 41 minutes. This mixture was added to the well with the Sf9 cells and incubated at 27°C in the dark for 7 hours. The cells were then washed and topped up with fresh media and left to grow for a further 48 hours. 2.2.4 Detection of mRNA encoding pIB-EpOR1 by RT-PCR A single well of each of the transfected cells (with pIB-V5/His or pIB-EpOR1) was harvested 48 hours post transfection by removing the media and washing the cells twice with 2 mL phosphate buffered saline (PBS). The cells were resuspended in 1 mL PBS, and pelleted by centrifugation at 5000g. The cells were stored at -80°C till required. Total RNA was extracted using TRIzol reagent (Invitrogen) following manufacturer‟s protocol, with the RNA resuspended in 10 µL diethylpyrocarbonate- treated (DEPC-treated) water. Five microlitres of the RNA was used for synthesizing cDNA using iScript cDNA synthesis kit (Bio-Rad) following the manufacturer‟s protocol. A one in ten dilution of the cDNA was made and 2 µL of this was used in a PCR reaction together with 1x PCR buffer including 1.5 mM magnesium (Invitrogen), 0.2 mM of each dNTP (Invitrogen), 2 units of Taq DNA polymerase (Invitrogen) and 0.5 µM of each primer. The final volume was made up to 20 µL with sterile water. The forward and reverse primers used were EpOR1 gene specific primers, EpOR1 forward– 5‟ATGGATGTATTCAATTTAAAATACATGCGA3‟ and EpOR1 reverse– 5‟TCACTGATTTGCAAATGTTCTCAGCATCAG3‟, which amplify the full length coding region of the EpOR1 cDNA (1248bp). The PCR cycling conditions were as follows: initial denaturation at 94°C for two minutes, followed by 35 cycles of 94°C for 20 seconds, 55°C for 30 seconds and 72°C for one minute, and a final extension at 72°C for ten minutes. PCR products were analysed on 1% agarose gel stained with 1x SYBR safe DNA gel stain (Invitrogen) and images captured on an ImageQuant 300 system (GE Healthcare Life Sciences). 2.2.5 Membrane Fraction Isolation and Western Blot The method of isolation of membrane fractions was adapted from Bordier (1980). To pre-condense Triton X-114, 5 mL of Triton X-114 was mixed with 250 mL PBS and cooled to 0°C. The mixture was then heated at 37°C until the phases separated. The top aqueous phase was discarded and 250 mL of PBS was added to the bottom phase
Page 1 and 2:
http://researchspace.auckland.ac.nz
Page 3 and 4:
Abstract Abstract Olfaction or the
Page 5 and 6: Acknowledgements Acknowledgements I
Page 7 and 8: Contents v Contents Abstract……
Page 9 and 10: Contents 4.2.5 Degenerate PCR .....
Page 11 and 12: List of Figures List of Figures Fig
Page 13 and 14: List of Tables List of Tables Table
Page 15 and 16: List of Abbreviations gDNA Genomic
Page 17 and 18: 1.1 General overview 1 General Intr
Page 19 and 20: General Introduction 3 moth in loca
Page 21 and 22: General Introduction 5 Figure 1.1:
Page 23 and 24: General Introduction 7 1.5 Componen
Page 25 and 26: General Introduction 9 OBPs have al
Page 27 and 28: General Introduction 11 A model has
Page 31 and 32: General Introduction 15 Tanaka et a
Page 33 and 34: General Introduction 17 Table 1.1:
Page 37 and 38: General Introduction 21 et al., 200
Page 39 and 40: General Introduction 23 the attract
Page 41 and 42: General Introduction 25 leaves and
Page 45 and 46: General Introduction 29 Expression
Page 47 and 48: General Introduction 31 BmOr2 HvOr2
Page 49 and 50: General Introduction 33 for lepidop
Page 51 and 52: Functional characterisation of Epip
Page 55: Functional characterisation of Epip
Page 73 and 74: 3.1 Introduction 3 The roles of Epi
Page 75 and 76: The roles of Epiphyas postvittana G
Page 95 and 96: 4.1 Introduction 4 Identification o
Page 97 and 98: Identification of putative odorant
Page 107 and 108:
Identification of putative odorant
Page 109 and 110:
Microarray OR 454 Transcriptome OR
Page 111 and 112:
Page 113 and 114:
Page 115 and 116:
Page 117 and 118:
Page 119 and 120:
Page 121 and 122:
Page 123 and 124:
Page 125 and 126:
Page 127 and 128:
Page 129 and 130:
Page 131 and 132:
Page 133 and 134:
Page 135 and 136:
Page 137 and 138:
Page 139 and 140:
Page 141 and 142:
5.1 Introduction 5 Concluding Discu
Page 143 and 144:
Concluding Discussion 127 VOBA sett
Page 145 and 146:
Concluding Discussion 129 redundant
Page 147 and 148:
Concluding Discussion 131 against t
Page 149 and 150:
Concluding Discussion 133 sequencin
Page 151 and 152:
Appendix B 135 Buffered TB (Sambroo
Page 153 and 154:
Appendix C 137 C. Appendix C - Clus
Page 155 and 156:
Appendix D 139 D. Appendix D - Solu
Page 157 and 158:
Appendix E 141 I II
Page 159 and 160:
Appendix E 143 V
Page 161 and 162:
Appendix E 145 VII continued Figure
Page 163 and 164:
References 147 Ansebo, L., Ignell,
Page 165 and 166:
References 149 Butenandt, A., Beckm
Page 167 and 168:
References 151 Fedurco, M., Romieu,
Page 169 and 170:
References 153 Große-Wilde, E., St
Page 171 and 172:
References 155 Hrdy, I., F. Kuldova
Page 173 and 174:
References 157 Kaissling, K. E. (19
Page 175 and 176:
References 159 Krieger, J., Große-
Page 177 and 178:
References 161 Lopez-Gomez, R. and
Page 179 and 180:
References 163 Miura, N., Nakagawa,
Page 181 and 182:
References 165 Pell, J. K., Macaula
Page 183 and 184:
References 167 Røstelien, T., Stra
Page 185 and 186:
References 169 Stowers, L. and Loga
Page 187 and 188:
References 171 Turner, C. T., Davy,
Page 189 and 190:
References 173 Vogt, R. G., Riddifo
Page 191 and 192:
References 175 Widmayer, P., Heifet
show all

Mechanisms of Olfaction in Insects - ResearchSpace@Auckland ...

Create successful ePaper yourself

Delete template?

Save as template?