Mechanisms of Olfaction in Insects - ResearchSpace@Auckland ...

Functional characterisation of Epiphyas postvittana odorant receptor 1 41
minutes. This mixture was added to the well with the Sf9 cells and incubated at 27°C
in the dark for 7 hours. The cells were then washed and topped up with fresh media
and left to grow for a further 48 hours.
2.2.4 Detection of mRNA encoding pIB-EpOR1 by RT-PCR
A single well of each of the transfected cells (with pIB-V5/His or pIB-EpOR1) was
harvested 48 hours post transfection by removing the media and washing the cells
twice with 2 mL phosphate buffered saline (PBS). The cells were resuspended in 1
mL PBS, and pelleted by centrifugation at 5000g. The cells were stored at -80°C till
required. Total RNA was extracted using TRIzol reagent (Invitrogen) following
manufacturer‟s protocol, with the RNA resuspended in 10 µL diethylpyrocarbonate-
treated (DEPC-treated) water. Five microlitres of the RNA was used for synthesizing
cDNA using iScript cDNA synthesis kit (Bio-Rad) following the manufacturer‟s
protocol. A one in ten dilution of the cDNA was made and 2 µL of this was used in a
PCR reaction together with 1x PCR buffer including 1.5 mM magnesium
(Invitrogen), 0.2 mM of each dNTP (Invitrogen), 2 units of Taq DNA polymerase
(Invitrogen) and 0.5 µM of each primer. The final volume was made up to 20 µL with
sterile water. The forward and reverse primers used were EpOR1 gene specific
primers, EpOR1 forward– 5‟ATGGATGTATTCAATTTAAAATACATGCGA3‟ and
EpOR1 reverse– 5‟TCACTGATTTGCAAATGTTCTCAGCATCAG3‟, which
amplify the full length coding region of the EpOR1 cDNA (1248bp). The PCR
cycling conditions were as follows: initial denaturation at 94°C for two minutes,
followed by 35 cycles of 94°C for 20 seconds, 55°C for 30 seconds and 72°C for one
minute, and a final extension at 72°C for ten minutes. PCR products were analysed on
1% agarose gel stained with 1x SYBR safe DNA gel stain (Invitrogen) and images
captured on an ImageQuant 300 system (GE Healthcare Life Sciences).
2.2.5 Membrane Fraction Isolation and Western Blot
The method of isolation of membrane fractions was adapted from Bordier (1980). To
pre-condense Triton X-114, 5 mL of Triton X-114 was mixed with 250 mL PBS and
cooled to 0°C. The mixture was then heated at 37°C until the phases separated. The
top aqueous phase was discarded and 250 mL of PBS was added to the bottom phase