Mechanisms of Olfaction in Insects - ResearchSpace@Auckland ...

More documents

Recommendations

Info

Identification of putative odorant receptors from Epiphyas postvittana 96 4.2.15 Rapid Amplification of cDNA Ends (RACE) For each 3‟RACE-PCR reaction, 3 µL of ten-fold diluted male E. postvittana antennal cDNA was used together with a gene specific forward primer (designed from a known region on the EST of interest) and the reverse oligo dT primer (RoRidT16) that is specific for the mRNA poly A + tail. The gene specific forward primers used are given in Table 4.3. The reaction mix consisted of 1x PCR buffer, 1.5 mM magnesium, 0.2 mM of each dNTP, 2 units of Taq DNA polymerase, 0.5 µM of each primer. The final volume was made up to 25 µL with sterile water. Touchdown PCR was performed as follows: initial denature at 94 o C for 4 minutes followed by 20 cycles at 94 o C for 30 seconds, 60-50 o C for 30 seconds and 72 o C for 30 seconds. This was followed by another 10 cycles at 94 o C for 30 seconds, 50 o C for 30 seconds and 72 o C for 30 seconds. A final extension was carried out at 72 o C for 7 minutes. The products were analysed on 1% agarose gel. Products greater than 300 bp were selected and sequenced. Table 4.3: Gene specific primers used for amplifying 3‟RACE products from OR candidates from the 454 transcriptome assembled contigs. Putative OR Gene Gene Specific Primer (5’ – 3’) EpOR7 GGATCCTAACGCATTGGCAAAGT EpOR23 GCAGCGTACAAAAGCCTGTGGTA EpOR24 GAGTGGAATTCGCTCCCATCGTC EpOR30 TATTTACAGCTTGATCGCTGTCG EpOR32 AACTTTACGCAGCTCGCCGCCAT EpOR33 GATACGAGCGACGAGGTCCCTCT EpOR34 GCTTATTCAGCCTACGCTGGAGA EpOR39 GGAGGATTGGAGCACACGTATAT EpOR41 GATGGGGCCTTATGAGAGCAAAT EpOR48 GACATTTCTTCATAGGTCCGTCG EpOR49 ATGCGCGAGGACTACAGTCGGCT EpOR50 GTTTTGATTTGTATCTGTGCGCC EpOR51 GGAGTTTTAGGGCAAACATAGTT EpOR52 TGATTGCCGTGCTGCTGGCGATT
Identification of putative odorant receptors from Epiphyas postvittana 97 5‟ RACE was used to isolate the 5‟ ends of the coding regions of the genes given in Table 4.4, each PR candidate from the microarray analysis and 454 transcriptomics sampling based on their tissue specific expressions in male E. postvittana antennae (as shown in Figures 4.1 and 4.4). The 5‟RACE System for Rapid Amplification of cDNA ends, Version 2.0 (Invitrogen) was employed according to manufacturer‟s instructions. First strand cDNA was synthesized from male antennae E. postvittana RNA using the outer gene specific primers (GSP) given in Table 4.4. This was done for each of individual ESTs given in Table 4.4 so as to synthesise cDNA specific for these ESTs, thereby enriching the cDNA for the particular gene. The cDNA synthesis was done using either superscript III reverse transcriptase (Invitrogen), or with iscript reverse transcriptase (Bio-Rad) following manufacturer‟s instructions, except that the oligo dT primer was replaced by the primer GSP. The synthesized cDNA was then purified using the PCR purification kit (Roche) following manufacturer‟s instructions. The cDNA was tailed at the 3‟end with Terminal Transferase (TdT) (Roche). This adds a homopolymeric tail of cysteine residues at the 3‟end of the cDNA hence a primer that binds to these residues can be used to amplify up the target gene with GSP at the other end. A 20 µL tailing reaction was carried out as follows: 9 µL purified cDNA, 4 µL of 5x tailing buffer, 2 µL of 10 mM dCTP, 4 µL of 25 mM CoCl2 and 1 µL of TdT enzyme were mixed and incubated for 1 hour at 37°C. This was followed by heat inactivation of the TdT at 65°C for 15 minutes. Each of the tailed cDNA were then used in 5‟RACE reaction together with their respective outer GSPs given in Table 4.4. A 50 µL PCR reaction mix was setup as in section 4.2.5 with 5 µL of the tailed cDNA with 0.5 µM of its corresponding outer GSP and 0.5 µM of AAP primer (Table 4.4). The following PCR cycling conditions were used: 94°C for 2 minutes, followed by 30 cycles of 94°C for 10 seconds, 50°C for 30 seconds, 72°C for 1 minute and a final extension was carried out at 72°C for 10 minutes. One microlitre of this PCR product was used as template in a second round of amplification with the nested GSP and AUAP primer (Table 4.4), using the same reaction components as before. Products from this second round of PCR amplification were analysed on 1% agarose gel and products greater than 500 bp were excised from the gel, the DNA extracted and cloned and sequenced as stated in section 4.2.6.
Page 1 and 2:
http://researchspace.auckland.ac.nz
Page 3 and 4:
Abstract Abstract Olfaction or the
Page 5 and 6:
Acknowledgements Acknowledgements I
Page 7 and 8:
Contents v Contents Abstract……
Page 9 and 10:
Contents 4.2.5 Degenerate PCR .....
Page 11 and 12:
List of Figures List of Figures Fig
Page 13 and 14:
List of Tables List of Tables Table
Page 15 and 16:
List of Abbreviations gDNA Genomic
Page 17 and 18:
1.1 General overview 1 General Intr
Page 19 and 20:
General Introduction 3 moth in loca
Page 21 and 22:
General Introduction 5 Figure 1.1:
Page 23 and 24:
General Introduction 7 1.5 Componen
Page 25 and 26:
General Introduction 9 OBPs have al
Page 27 and 28:
General Introduction 11 A model has
Page 29 and 30:
Page 31 and 32:
General Introduction 15 Tanaka et a
Page 33 and 34:
General Introduction 17 Table 1.1:
Page 35 and 36:
Page 37 and 38:
General Introduction 21 et al., 200
Page 39 and 40:
General Introduction 23 the attract
Page 41 and 42:
General Introduction 25 leaves and
Page 43 and 44:
Page 45 and 46:
General Introduction 29 Expression
Page 47 and 48:
General Introduction 31 BmOr2 HvOr2
Page 49 and 50:
General Introduction 33 for lepidop
Page 51 and 52:
Functional characterisation of Epip
Page 53 and 54:
Page 55 and 56:
Page 57 and 58:
Page 59 and 60:
Page 61 and 62: Functional characterisation of Epip
Page 73 and 74: 3.1 Introduction 3 The roles of Epi
Page 75 and 76: The roles of Epiphyas postvittana G
Page 95 and 96: 4.1 Introduction 4 Identification o
Page 97 and 98: Identification of putative odorant
Page 109 and 110: Microarray OR 454 Transcriptome OR
Page 111: Identification of putative odorant
Page 141 and 142: 5.1 Introduction 5 Concluding Discu
Page 143 and 144: Concluding Discussion 127 VOBA sett
Page 145 and 146: Concluding Discussion 129 redundant
Page 147 and 148: Concluding Discussion 131 against t
Page 149 and 150: Concluding Discussion 133 sequencin
Page 151 and 152: Appendix B 135 Buffered TB (Sambroo
Page 153 and 154: Appendix C 137 C. Appendix C - Clus
Page 155 and 156: Appendix D 139 D. Appendix D - Solu
Page 157 and 158: Appendix E 141 I II
Page 159 and 160: Appendix E 143 V
Page 161 and 162: Appendix E 145 VII continued Figure
Page 163 and 164:
References 147 Ansebo, L., Ignell,
Page 165 and 166:
References 149 Butenandt, A., Beckm
Page 167 and 168:
References 151 Fedurco, M., Romieu,
Page 169 and 170:
References 153 Große-Wilde, E., St
Page 171 and 172:
References 155 Hrdy, I., F. Kuldova
Page 173 and 174:
References 157 Kaissling, K. E. (19
Page 175 and 176:
References 159 Krieger, J., Große-
Page 177 and 178:
References 161 Lopez-Gomez, R. and
Page 179 and 180:
References 163 Miura, N., Nakagawa,
Page 181 and 182:
References 165 Pell, J. K., Macaula
Page 183 and 184:
References 167 Røstelien, T., Stra
Page 185 and 186:
References 169 Stowers, L. and Loga
Page 187 and 188:
References 171 Turner, C. T., Davy,
Page 189 and 190:
References 173 Vogt, R. G., Riddifo
Page 191 and 192:
References 175 Widmayer, P., Heifet
show all

Mechanisms of Olfaction in Insects - ResearchSpace@Auckland ...

Create successful ePaper yourself

Delete template?

Save as template?