Mechanisms of Olfaction in Insects - ResearchSpace@Auckland ...

More documents

Recommendations

Info

Identification of putative odorant receptors from Epiphyas postvittana 98 Table 4.4: Primers used for amplifying 5‟ RACE products from the two candidate PRs identified from microarray screening and the three PR candidates identified from the 454 transcriptome sequencing of E. postvittana. EST Identified from: Microarray screening 454 Transcriptome sequencing Primer Nucleotide Sequence (5’ – 3’) 25174 (outer) AGATTTCTCTGATTATTTACACAATGTATA 25174 (nested) GTTGCACAGTGGCGACAGACCGGCACTTTT 25214 (outer) TTATTACTAAAATTACCCTCGTAACAACAA 25214 (nested) CCCGAATGATATTCCAAATGCTTACAAACT 1032444 (outer) GTGGCCCAAAAGGCGCAAAGCCCGAAT 1032444 (nested) GCCATAACTTCGATACCCACTGCCCTC 1037459 (outer) GCGGGAACAGCGCGCAGTTCACACAAC 1037459 (nested) GAAGTCATCCCCTTTATGTCGACAGCG 1042257 (outer) GTATGAGTATTGTACCGTTTGTGCCCCG 1042257 (nested) CTTCCAGGCAGACAGCCCTGAACACCG Abridged anchor primer (AAP) GGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIG Abridged universal amplification primer (AUAP) 4.2.16 Bioinformatics GGCCACGCGTCGACTAGTAC The predicted OR proteins from the low coverage genomic scaffolds were translated into the six reading frames and compared with the B. mori OR exons for determining the exons of the proteins. The program SplicePredictor (http://deepc2.psi.iastate.edu/cgi-bin/sp.cgi) was also used for predicting the exon/intron boundaries. A phylogenetic tree was constructed using the PHYLIP3.6a3 package (Felsenstein, 2005) of all the known and putative E. postvittana ORs together with the ORs from B. mori (Warren et al., 2007; Tanaka et al., 2009), H. virescens (Krieger et al., 2002; Krieger et al., 2004), P. xylostella, M. separata, and D. indica (Mitsuno et al., 2008). The protein sequence of EpOR34 was submitted to seven different transmembrane prediction programs including HMMTOP (Tusnady and Simon, 2001), TMPred (Hofmann and Stoffel, 1993), TMHMM (Krogh et al., 2001), DAS (Cserzo et al., 1997), SPLIT (Juretic et al., 1993), TMMOD (Kahsay et al., 2005) and TOPPRED (Claros and von Heijne, 1994). The predicted TM regions were compared and a
Identification of putative odorant receptors from Epiphyas postvittana 99 consensus of the different domains was made manually. A topology map of EpOR34 was then drawn in TOPO2 (http://www.sacs.ucsf.edu/TOPO-run/wtopo.pl) using the consensus sequence above. 4.3 Results 4.3.1 Microarray Analysis A microarray analysis of 1809 ESTs from a male antennal cDNA library of E. postvittana was carried out to identify male-specific genes. From the microarray screening, four ESTs had more than two times higher expression in male than female antennae (EST numbers 23893, 25116, 25174 and 25214). The sex-biased expression of two (ESTs 25174 and 25214) of the four ESTs were confirmed by qRT-PCR (Figure 4.1). Figure 4.1: Quantitative RT-PCR of four candidates PRs as identified from a differential microarray screening of EST oligos. The error bars represent standard errors of three technical replicates for each tissue type. ND = not detectable. 3‟RACE-PCR was not done on ESTs 25174 and 25214 as the original sequences already had the poly A + tail sequence. The 5‟RACE-PCR was only able to extend the original EST sequences by 350–400 bp. Further 5‟RACE to extend the sequences
Page 1 and 2:
http://researchspace.auckland.ac.nz
Page 3 and 4:
Abstract Abstract Olfaction or the
Page 5 and 6:
Acknowledgements Acknowledgements I
Page 7 and 8:
Contents v Contents Abstract……
Page 9 and 10:
Contents 4.2.5 Degenerate PCR .....
Page 11 and 12:
List of Figures List of Figures Fig
Page 13 and 14:
List of Tables List of Tables Table
Page 15 and 16:
List of Abbreviations gDNA Genomic
Page 17 and 18:
1.1 General overview 1 General Intr
Page 19 and 20:
General Introduction 3 moth in loca
Page 21 and 22:
General Introduction 5 Figure 1.1:
Page 23 and 24:
General Introduction 7 1.5 Componen
Page 25 and 26:
General Introduction 9 OBPs have al
Page 27 and 28:
General Introduction 11 A model has
Page 29 and 30:
Page 31 and 32:
General Introduction 15 Tanaka et a
Page 33 and 34:
General Introduction 17 Table 1.1:
Page 35 and 36:
Page 37 and 38:
General Introduction 21 et al., 200
Page 39 and 40:
General Introduction 23 the attract
Page 41 and 42:
General Introduction 25 leaves and
Page 43 and 44:
Page 45 and 46:
General Introduction 29 Expression
Page 47 and 48:
General Introduction 31 BmOr2 HvOr2
Page 49 and 50:
General Introduction 33 for lepidop
Page 51 and 52:
Functional characterisation of Epip
Page 53 and 54:
Page 55 and 56:
Page 57 and 58:
Page 59 and 60:
Page 61 and 62:
Page 63 and 64: Functional characterisation of Epip
Page 73 and 74: 3.1 Introduction 3 The roles of Epi
Page 75 and 76: The roles of Epiphyas postvittana G
Page 95 and 96: 4.1 Introduction 4 Identification o
Page 97 and 98: Identification of putative odorant
Page 109 and 110: Microarray OR 454 Transcriptome OR
Page 113: Identification of putative odorant
Page 141 and 142: 5.1 Introduction 5 Concluding Discu
Page 143 and 144: Concluding Discussion 127 VOBA sett
Page 145 and 146: Concluding Discussion 129 redundant
Page 147 and 148: Concluding Discussion 131 against t
Page 149 and 150: Concluding Discussion 133 sequencin
Page 151 and 152: Appendix B 135 Buffered TB (Sambroo
Page 153 and 154: Appendix C 137 C. Appendix C - Clus
Page 155 and 156: Appendix D 139 D. Appendix D - Solu
Page 157 and 158: Appendix E 141 I II
Page 159 and 160: Appendix E 143 V
Page 161 and 162: Appendix E 145 VII continued Figure
Page 163 and 164: References 147 Ansebo, L., Ignell,
Page 165 and 166:
References 149 Butenandt, A., Beckm
Page 167 and 168:
References 151 Fedurco, M., Romieu,
Page 169 and 170:
References 153 Große-Wilde, E., St
Page 171 and 172:
References 155 Hrdy, I., F. Kuldova
Page 173 and 174:
References 157 Kaissling, K. E. (19
Page 175 and 176:
References 159 Krieger, J., Große-
Page 177 and 178:
References 161 Lopez-Gomez, R. and
Page 179 and 180:
References 163 Miura, N., Nakagawa,
Page 181 and 182:
References 165 Pell, J. K., Macaula
Page 183 and 184:
References 167 Røstelien, T., Stra
Page 185 and 186:
References 169 Stowers, L. and Loga
Page 187 and 188:
References 171 Turner, C. T., Davy,
Page 189 and 190:
References 173 Vogt, R. G., Riddifo
Page 191 and 192:
References 175 Widmayer, P., Heifet
show all

Mechanisms of Olfaction in Insects - ResearchSpace@Auckland ...

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?