- Page 2 and 3: Chromosome segregation errors: a do
- Page 4 and 5: Chromosome segregation errors: a do
- Page 6: Get up, stand up, stand up for your
- Page 10 and 11: Chapter 1 General Introduction Anie
- Page 12 and 13: cytoplasms and pinches off the memb
- Page 14 and 15: which sister-chromatids are not pro
- Page 16 and 17: Non-MCC members, but important mito
- Page 18 and 19: completely separated. Following cle
- Page 20 and 21: Two striking features of cancer cel
- Page 22 and 23: predisposition at a very young age,
- Page 24 and 25: that aberrant spindle formation inc
- Page 26 and 27: (Fig.7C). As discussed in section 4
- Page 28 and 29: Thesis outline Chromosome segregati
- Page 30: 286,395,407,408 Increase (thymus) I
- Page 33 and 34: 2 Abstract Various types of chromos
- Page 35 and 36: 2 34 A C D E % of cells Control 100
- Page 37 and 38: 2 assess whether cytokinesis induce
- Page 39 and 40: 2 A Asynchronous Monastrol release
- Page 41 and 42: 2 for 14 hours (unless indicated ot
- Page 43 and 44: 2 Immuno Blotting Cells were lysed
- Page 45 and 46: 2 Supplemental figures 44 A B C % o
- Page 47 and 48: 2 A MCF7 B C 53BP1 foci/cell 46 % o
- Page 49 and 50: 2 A siLuc siATM C 48 p-S1981 ATM me
- Page 51: 2 50 A B C % of EdU positive cells
- Page 55 and 56: 3 Abstract Chromosomal instability
- Page 57 and 58: 3 may be quite complex, and may dep
- Page 59 and 60: 3 recombination arm carrying the de
- Page 61 and 62: 3 A B CiMKi 60 Mps1 Loading T649A/T
- Page 63 and 64: 3 in human tissues when compared to
- Page 65 and 66: 3 1) Ligate conditional part (fragm
- Page 67 and 68: 3 GGATTTTATTTTGAAGGTATTGTTCATAGTGAT
- Page 69 and 70: 3 DNA was separated on size at 80V
- Page 71 and 72: 3 (LabTekII) and imaged after addit
- Page 74 and 75: Chapter 4 Mitosis as an anti-cancer
- Page 76 and 77: 1) Delaying Mitosis 1.1 Need for th
- Page 78 and 79: slow but steady rise in caspase 9 a
- Page 80 and 81: A number of alternative models for
- Page 82 and 83: chromosome losses and gains, a phen
- Page 84 and 85: will inevitably lead to severe aneu
- Page 86: Table I. Overview of (Pre-)clinical
- Page 89 and 90: 5 Abstract The mitotic checkpoint h
- Page 91 and 92: 5 increase in cell death (18% vs. 4
- Page 93 and 94: A U2OS-TetR Mps1 B relative colony
- Page 95 and 96: 5 A Mad2 U2OS-TetR MAD2 100 30 B U2
- Page 97 and 98: 5 however, this amount was not enha
- Page 99 and 100: 5 Cells were grown in 96 wells plat
- Page 101 and 102: 5 A B DIC Propidium Iodide C D 100
- Page 103 and 104:
5 A C 102 relative colony formation
- Page 105 and 106:
5 (+SEM). B) Quantification of time
- Page 107 and 108:
5 106 Addendum Targeting the mitoti
- Page 109 and 110:
5 Introduction Chromosomal instabil
- Page 111 and 112:
5 110 A B percentage of cells 100 8
- Page 113 and 114:
5 Flow Cytometry Flow cytometry sam
- Page 115 and 116:
5 114
- Page 117 and 118:
6 Abstract Developing anti-tumor th
- Page 119 and 120:
6 Results Search for a potent and s
- Page 121 and 122:
6 120 A B 50 40 30 20 RPE-1 Compoun
- Page 123 and 124:
6 severe missegregations in either
- Page 125 and 126:
6 these cells with E1A virus 584 .
- Page 127 and 128:
6 when compared to diploid untransf
- Page 129 and 130:
6 with 400mg/ml Hygromycin. U2OS ce
- Page 131 and 132:
6 Supplemental data Supplemental fi
- Page 134 and 135:
Chapter 7 Docetaxel affects in vivo
- Page 136 and 137:
Introduction Taxanes are among the
- Page 138 and 139:
Simultaneously imaging mitotic prog
- Page 140 and 141:
treatment respectively. In line wit
- Page 142 and 143:
C % abnormal nuclei D E % of cells
- Page 144 and 145:
(reviewed in 447) and might explain
- Page 146 and 147:
Tissues were isolated and fixed in
- Page 148 and 149:
147 Intravital imaging of Docetaxel
- Page 150 and 151:
Chapter 8 Summary & Discussion 149
- Page 152 and 153:
Discussion 1. Chromosome segregatio
- Page 154 and 155:
Since it has been shown that replic
- Page 156 and 157:
2.2 Benefits of being CIN Generally
- Page 158:
opportunities for the development o
- Page 161 and 162:
& References 1. Pines, J., The cell
- Page 163 and 164:
& 22(6): p. 1321-9. 84. Hwang, L.H.
- Page 165 and 166:
& Oncogene, 2009. 28(10): p. 1366-7
- Page 167 and 168:
& p. 1749-53. 256. Miki, Y., et al.
- Page 169 and 170:
& of telomeres. EMBO J, 2012. 31(9)
- Page 171 and 172:
& 426. Giunta, S., R. Belotserkovsk
- Page 173 and 174:
& 511. Andreassen, P.R., et al., Te
- Page 175 and 176:
& 4610-7. 601. Beerling, E., et al.
- Page 177 and 178:
& Toch balanceren chromosoom instab
- Page 179 and 180:
& Curriculum Vitae Aniek Janssen we
- Page 181 and 182:
& Dankwoord En dan nu eindelijk het
- Page 183 and 184:
& period. Tania, congratulations wi
- Page 185 and 186:
& gezelligheid bij borrels en in he