Chromosome segregation errors: a double-edged sword - TI Pharma

3
DNA was separated on size at 80V in a 1% Agarose gel for 4 hours. The DNA gel was washed in
denaturalizing solution (0,5 M NaOH and 1.5M NaCl) 2 times for 15’ and Southern blotting was
performed for 14-16 hours using a Hybond-N+ membrane (GE healthcare) in 0,5 M NaOH and
1.5M NaCl. After blotting the membrane was washed for 5’ in 40mM NaPi and subsequently crosslinked
using UV irradiation. Probe labeling was performed using a standard Rediprime II Random
Prime labeling system (GE healthcare) and radioactive [a-32P] dCTP after linearizing the 5’ probe.
Hybridization of the membrane was performed in 0,5M NaPi, 7%SDS, 1mM EDTA pH8.0 overnight at
65 °C and was washed using 40mM NaPi, 1% SDS.
Generation of CiMKi mice
129/Ola-derived IB10 ES embryonic stem (ES) cells were selected in medium containing
puromycin and correct recombination was confirmed by PCR, Southern blots and sequencing
as described above. Targeted ES clones were injected into C57BL/6 blastocysts to generate
chimeric mice, which were bred with C57BL/6 females to obtain germline transmission. CiMKi
mice were backcrossed six times on a C57BL/6 background. Genotypic analysis of offspring
was performed using PCR and sequencing with allele-specific primers as described below.
CiMKi-CreER T2 mice were obtained by crossing heterozygous CiMKi females with homozygous CreER T2
males (B6.129-Gt(ROSA)26Sor tm1(Cre/ERT2)Tyj /J) 449 purchased at the Jackson laboratory (stock number
008463). CiMKi/CreER T2 /LsL LacZ mice were obtained by crossing heterozygous CiMKi/CreER T2 females
with homozygous LsL-LacZ males (B6.129S4-Gt(ROSA_26Sortm1Sor/J) 451 (a kind gift from Dr.Annemieke
Kavelaars) originally purchased at the Jackson laboratory (stock number 003474). All animals were
bred and housed at the animal facility of the Gemeenschappelijk Dieren Laboratorium (GDL), Utrecht,
the Netherlands.
Genotypic analysis
Tails of 3-4 weeks old mice were lysed with Hotshot lysis buffer 456 and PCR was performed to
determine the presence of the CiMKi allele using the following primers:
Exon 21 FW#4: CCAAATGGCTAGGGGAGCCACTGATG
Exon 22 R#4: GGTGAGGTTGTTTCCAACTGGTAG
DNA from CiMKi mice harboring the mutant allele will yield a band of 250bp.
To determine whether mice or embryos were heterozygous or homozygous for the CiMKi allele, tail
DNA was subjected to PCR and sequencing to determine the presence of one or two mutant alleles
(T649A (ACA à GCA) or D637A (GAT à GCT) in exon 17) using the following primers:
PCR: Intron16_Seq_FW#1: CACCCTGAAAATGATGATGATAATG
Intron17_R#: GCCATCCCCACACCTCCACAATGGC
Sequencing: Intron16_Seq_FW#3: GGTACCTGGCCCACAACATTTGC
Genotypic analysis of (CiMKi) CreER T2 and (CiMKi) CreER T2 /LsL-LacZ mice for the presence of the
CreER T2 or LsL LacZ allele was performed using standard primers (sequences can be found on the
Jackson laboratory website).
PCR analysis of Cre-infected MEFs
mRNA from MEFs subjected to Cre-infection was isolated using an RNeasy minikit (Qiagen). cDNA
68