Chromosome segregation errors: a double-edged sword - TI Pharma

More documents

Recommendations

Info

Primers: pGH_pA_FW#2: TCTATGGCTTCTGAGGCGG Intron18_Reverse#1: AAGGGACATCAGGGAAGCAA Southern analysis Probe design 5’ probe (500bp) was obtained from genomic DNA (from 129/Ola-derived IB10 ES cells, (kind gift from Dr. Hans Clevers)) by PCR using the following primers: FW_EcoRV_1: CTTTCTCCTCCAATTTACCATTTTGTTCAC Rev_EcoRV_1: GGTCAAATCCAGAGTCCTAAGGCAAGGTAC 500 bp fragment was ligated into pGEM-T-easy to further increase DNA yield. Digestion of genomic DNA from ES cells with EcoRV and hybridization with the 5’ probe resulted in a 9,5 kb band (when wildtype) or 4, 7 kb band (when targeted with CiMKi allele) (see below): DNA purification ES cells were lysed using 10mM Tris (pH 7.5), 10mM EDTA,10mM NaCl, 0.5% Sarkosyl and 2mg/ml Proteinase K (added freshly), dissolved in dH2O. ES cell DNA was precipitated using NaCl (50mM) mixed with ice-cold Ethanol (100%) and subsequently restricted using EcoRV. Southern blot 67 Cre-inducible Mps1 knock-in mouse model (CiMKi) 3
3 DNA was separated on size at 80V in a 1% Agarose gel for 4 hours. The DNA gel was washed in denaturalizing solution (0,5 M NaOH and 1.5M NaCl) 2 times for 15’ and Southern blotting was performed for 14-16 hours using a Hybond-N+ membrane (GE healthcare) in 0,5 M NaOH and 1.5M NaCl. After blotting the membrane was washed for 5’ in 40mM NaPi and subsequently crosslinked using UV irradiation. Probe labeling was performed using a standard Rediprime II Random Prime labeling system (GE healthcare) and radioactive [a-32P] dCTP after linearizing the 5’ probe. Hybridization of the membrane was performed in 0,5M NaPi, 7%SDS, 1mM EDTA pH8.0 overnight at 65 °C and was washed using 40mM NaPi, 1% SDS. Generation of CiMKi mice 129/Ola-derived IB10 ES embryonic stem (ES) cells were selected in medium containing puromycin and correct recombination was confirmed by PCR, Southern blots and sequencing as described above. Targeted ES clones were injected into C57BL/6 blastocysts to generate chimeric mice, which were bred with C57BL/6 females to obtain germline transmission. CiMKi mice were backcrossed six times on a C57BL/6 background. Genotypic analysis of offspring was performed using PCR and sequencing with allele-specific primers as described below. CiMKi-CreER T2 mice were obtained by crossing heterozygous CiMKi females with homozygous CreER T2 males (B6.129-Gt(ROSA)26Sor tm1(Cre/ERT2)Tyj /J) 449 purchased at the Jackson laboratory (stock number 008463). CiMKi/CreER T2 /LsL LacZ mice were obtained by crossing heterozygous CiMKi/CreER T2 females with homozygous LsL-LacZ males (B6.129S4-Gt(ROSA_26Sortm1Sor/J) 451 (a kind gift from Dr.Annemieke Kavelaars) originally purchased at the Jackson laboratory (stock number 003474). All animals were bred and housed at the animal facility of the Gemeenschappelijk Dieren Laboratorium (GDL), Utrecht, the Netherlands. Genotypic analysis Tails of 3-4 weeks old mice were lysed with Hotshot lysis buffer 456 and PCR was performed to determine the presence of the CiMKi allele using the following primers: Exon 21 FW#4: CCAAATGGCTAGGGGAGCCACTGATG Exon 22 R#4: GGTGAGGTTGTTTCCAACTGGTAG DNA from CiMKi mice harboring the mutant allele will yield a band of 250bp. To determine whether mice or embryos were heterozygous or homozygous for the CiMKi allele, tail DNA was subjected to PCR and sequencing to determine the presence of one or two mutant alleles (T649A (ACA à GCA) or D637A (GAT à GCT) in exon 17) using the following primers: PCR: Intron16_Seq_FW#1: CACCCTGAAAATGATGATGATAATG Intron17_R#: GCCATCCCCACACCTCCACAATGGC Sequencing: Intron16_Seq_FW#3: GGTACCTGGCCCACAACATTTGC Genotypic analysis of (CiMKi) CreER T2 and (CiMKi) CreER T2 /LsL-LacZ mice for the presence of the CreER T2 or LsL LacZ allele was performed using standard primers (sequences can be found on the Jackson laboratory website). PCR analysis of Cre-infected MEFs mRNA from MEFs subjected to Cre-infection was isolated using an RNeasy minikit (Qiagen). cDNA 68
Page 2 and 3:
Chromosome segregation errors: a do
Page 4 and 5:
Chromosome segregation errors: a do
Page 6:
Get up, stand up, stand up for your
Page 10 and 11:
Chapter 1 General Introduction Anie
Page 12 and 13:
cytoplasms and pinches off the memb
Page 14 and 15:
which sister-chromatids are not pro
Page 16 and 17:
Non-MCC members, but important mito
Page 18 and 19: completely separated. Following cle
Page 20 and 21: Two striking features of cancer cel
Page 22 and 23: predisposition at a very young age,
Page 24 and 25: that aberrant spindle formation inc
Page 26 and 27: (Fig.7C). As discussed in section 4
Page 28 and 29: Thesis outline Chromosome segregati
Page 30: 286,395,407,408 Increase (thymus) I
Page 33 and 34: 2 Abstract Various types of chromos
Page 35 and 36: 2 34 A C D E % of cells Control 100
Page 37 and 38: 2 assess whether cytokinesis induce
Page 39 and 40: 2 A Asynchronous Monastrol release
Page 41 and 42: 2 for 14 hours (unless indicated ot
Page 43 and 44: 2 Immuno Blotting Cells were lysed
Page 45 and 46: 2 Supplemental figures 44 A B C % o
Page 47 and 48: 2 A MCF7 B C 53BP1 foci/cell 46 % o
Page 49 and 50: 2 A siLuc siATM C 48 p-S1981 ATM me
Page 51 and 52: 2 50 A B C % of EdU positive cells
Page 54 and 55: Chapter 3 Studying Chromosomal inst
Page 56 and 57: Introduction Aneuploidy is a common
Page 58 and 59: activity by ~80% 170-172 . With the
Page 60 and 61: A WT/CiMKi T649A Embryo’s: Figure
Page 62 and 63: control treated MEFs (unpaired t te
Page 64 and 65: Materials and Methods Cloning targe
Page 66 and 67: - Loop out BamHI site with site-dir
Page 70 and 71: was prepared using standard procedu
Page 72: 71 Cre-inducible Mps1 knock-in mous
Page 75 and 76: 4 Abstract Most of the current drug
Page 77 and 78: 4 Two other interesting mitotic tar
Page 79 and 80: 4 inhibition of the anti-apoptotic
Page 81 and 82: 4 cluster their centrosomes. This
Page 83 and 84: 4 of checkpoint function can be ach
Page 85 and 86: 4 4.5 Disadvantages of exploiting m
Page 88 and 89: Chapter 5 Elevating the frequency o
Page 90 and 91: Introduction Error-free chromosome
Page 92 and 93: Partial depletion of Mps1 or BubR1
Page 94 and 95: death is not induced in the short t
Page 96 and 97: had survived growth for 7 days in t
Page 98 and 99: The following antibodies have been
Page 100 and 101: Supplemental data Supplemental figu
Page 102 and 103: A BubR1 α-tubulin Hela-TetRBubR1 -
Page 104 and 105: - doxycycline + doxycycline - doxyc
Page 106 and 107: A B C percentage of cells % PI posi
Page 108 and 109: Abstract One of the most common hal
Page 110 and 111: clear accumulation of cells in mito
Page 112 and 113: the mice did not receive any doxycy
Page 114 and 115: 113 Chromosome missegregations kill
Page 116 and 117: Chapter 6 Aneuploid tumor cells are
Page 118 and 119:
Introduction Equal segregation of t
Page 120 and 121:
S1A, data not shown). Based on thes
Page 122 and 123:
A B U2OS + H2B-YFP percentage of ce
Page 124 and 125:
tumor cells, leaving diploid cells
Page 126 and 127:
A B p-S10-Histone H3 DAPI C µmol/l
Page 128 and 129:
Supplemental Figure-1. Protein bioc
Page 130 and 131:
Bioavailability of compound-5 after
Page 132:
A B U2OS (7.5nM) Hela (10nM) RPE-1
Page 135 and 136:
7 Abstract Taxanes, such as docetax
Page 137 and 138:
7 of mitotic aberrations. These dat
Page 139 and 140:
7 A Low CFP lifetime High CFP lifet
Page 141 and 142:
7 docetaxel treatment in vitro resu
Page 143 and 144:
7 chromosome unstable, which means
Page 145 and 146:
7 Cells (~50.000/well) were plated
Page 147 and 148:
7 Supplemental data Supplemental fi
Page 149 and 150:
7 148
Page 151 and 152:
8 Thesis summary Unequal separation
Page 153 and 154:
8 exerted through contraction of th
Page 155 and 156:
8 1.4 NoCut: preventing the inducti
Page 157 and 158:
8 tumorformation using intravital i
Page 160 and 161:
Addendum References Nederlandse sam
Page 162 and 163:
41. McEwen, B.F., et al., CENP-E is
Page 164 and 165:
2010. 6(5): p. 359-68. 124. Liu, S.
Page 166 and 167:
210. Stucki, M., et al., MDC1 direc
Page 168 and 169:
tumors in mice. Cancer Res, 2007. 6
Page 170 and 171:
adiotherapy in breast cancer. Breas
Page 172 and 173:
470. Marcus, A.I., et al., Mitotic
Page 174 and 175:
559. Kienitz, A., et al., Partial d
Page 176 and 177:
Nederlandse Samenvatting Celdeling,
Page 178 and 179:
verdeling van tumorcellen compleet
Page 180 and 181:
Publications A. Janssen, R.H.Medema
Page 182 and 183:
En dan zijn er nu nog een aantal li
Page 184 and 185:
promotie-stukjes! Je bent een voorb
Page 186:
edankt voor al jullie hulp bij de i
show all

Chromosome segregation errors: a double-edged sword - TI Pharma

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?