Chromosome segregation errors: a double-edged sword - TI Pharma

More documents

Recommendations

Info

Get up, stand up, stand up for your right Get up, stand up, don’t give up the fight Get up, stand up. Life is your right Don’t give up the fight -Bob Marley-
Page 2 and 3: Chromosome segregation errors: a do
Page 4 and 5: Chromosome segregation errors: a do
Page 8: Contents Chapter 1. General introdu
Page 11 and 12: 1 1. Introduction 1.1 The cell cycl
Page 13 and 14: 1 The CCAN network is thought to cr
Page 15 and 16: 1 years before this experimental ev
Page 17 and 18: 1 Besides Borealin and Knl1 116,120
Page 19 and 20: 1 53BP1 does not depend on gH2AX fo
Page 21 and 22: 1 heterogeneity and might therefore
Page 23 and 24: 1 tumor types than mutation of mito
Page 25 and 26: 1 explanation for the occurrence of
Page 27 and 28: 1 models have been generated which
Page 29 and 30: Table I. Mouse models of numerical
Page 32 and 33: Chapter 2 Chromosome Segregation Er
Page 34 and 35: Results & Discussion Tumor cells sh
Page 36 and 37: G No errors hrs:min 0:00 H2B-RFP 53
Page 38 and 39: C D U2OS DAPI RPE-1 γ-H2AX merge +
Page 40 and 41: A C % of cells with 53BP1 foci 100
Page 42 and 43: Live cell imaging Cells were plated
Page 44 and 45: Supplemental data Supplemental text
Page 46 and 47: A % of cells 100 80 60 40 20 0 C Mo
Page 48 and 49: A No errors Actin Actin DAPI B DAPI
Page 50 and 51: A B C % of cells with 53BP1 foci av
Page 52: 51 Chromosome Segregation Errors ca
Page 55 and 56: 3 Abstract Chromosomal instability
Page 57 and 58:
3 may be quite complex, and may dep
Page 59 and 60:
3 recombination arm carrying the de
Page 61 and 62:
3 A B CiMKi 60 Mps1 Loading T649A/T
Page 63 and 64:
3 in human tissues when compared to
Page 65 and 66:
3 1) Ligate conditional part (fragm
Page 67 and 68:
3 GGATTTTATTTTGAAGGTATTGTTCATAGTGAT
Page 69 and 70:
3 DNA was separated on size at 80V
Page 71 and 72:
3 (LabTekII) and imaged after addit
Page 74 and 75:
Chapter 4 Mitosis as an anti-cancer
Page 76 and 77:
1) Delaying Mitosis 1.1 Need for th
Page 78 and 79:
slow but steady rise in caspase 9 a
Page 80 and 81:
A number of alternative models for
Page 82 and 83:
chromosome losses and gains, a phen
Page 84 and 85:
will inevitably lead to severe aneu
Page 86:
Table I. Overview of (Pre-)clinical
Page 89 and 90:
5 Abstract The mitotic checkpoint h
Page 91 and 92:
5 increase in cell death (18% vs. 4
Page 93 and 94:
A U2OS-TetR Mps1 B relative colony
Page 95 and 96:
5 A Mad2 U2OS-TetR MAD2 100 30 B U2
Page 97 and 98:
5 however, this amount was not enha
Page 99 and 100:
5 Cells were grown in 96 wells plat
Page 101 and 102:
5 A B DIC Propidium Iodide C D 100
Page 103 and 104:
5 A C 102 relative colony formation
Page 105 and 106:
5 (+SEM). B) Quantification of time
Page 107 and 108:
5 106 Addendum Targeting the mitoti
Page 109 and 110:
5 Introduction Chromosomal instabil
Page 111 and 112:
5 110 A B percentage of cells 100 8
Page 113 and 114:
5 Flow Cytometry Flow cytometry sam
Page 115 and 116:
5 114
Page 117 and 118:
6 Abstract Developing anti-tumor th
Page 119 and 120:
6 Results Search for a potent and s
Page 121 and 122:
6 120 A B 50 40 30 20 RPE-1 Compoun
Page 123 and 124:
6 severe missegregations in either
Page 125 and 126:
6 these cells with E1A virus 584 .
Page 127 and 128:
6 when compared to diploid untransf
Page 129 and 130:
6 with 400mg/ml Hygromycin. U2OS ce
Page 131 and 132:
6 Supplemental data Supplemental fi
Page 134 and 135:
Chapter 7 Docetaxel affects in vivo
Page 136 and 137:
Introduction Taxanes are among the
Page 138 and 139:
Simultaneously imaging mitotic prog
Page 140 and 141:
treatment respectively. In line wit
Page 142 and 143:
C % abnormal nuclei D E % of cells
Page 144 and 145:
(reviewed in 447) and might explain
Page 146 and 147:
Tissues were isolated and fixed in
Page 148 and 149:
147 Intravital imaging of Docetaxel
Page 150 and 151:
Chapter 8 Summary & Discussion 149
Page 152 and 153:
Discussion 1. Chromosome segregatio
Page 154 and 155:
Since it has been shown that replic
Page 156 and 157:
2.2 Benefits of being CIN Generally
Page 158:
opportunities for the development o
Page 161 and 162:
& References 1. Pines, J., The cell
Page 163 and 164:
& 22(6): p. 1321-9. 84. Hwang, L.H.
Page 165 and 166:
& Oncogene, 2009. 28(10): p. 1366-7
Page 167 and 168:
& p. 1749-53. 256. Miki, Y., et al.
Page 169 and 170:
& of telomeres. EMBO J, 2012. 31(9)
Page 171 and 172:
& 426. Giunta, S., R. Belotserkovsk
Page 173 and 174:
& 511. Andreassen, P.R., et al., Te
Page 175 and 176:
& 4610-7. 601. Beerling, E., et al.
Page 177 and 178:
& Toch balanceren chromosoom instab
Page 179 and 180:
& Curriculum Vitae Aniek Janssen we
Page 181 and 182:
& Dankwoord En dan nu eindelijk het
Page 183 and 184:
& period. Tania, congratulations wi
Page 185 and 186:
& gezelligheid bij borrels en in he
show all

Chromosome segregation errors: a double-edged sword - TI Pharma

Create successful ePaper yourself

Delete template?

Save as template?