Myeloid Leukemia

Duplexed QZyme RT-PCR for APL Analysis 143
6, creating fusion transcripts of varying lengths in individual patients. Approximately
one-third to one-half of V-type patients harbor an identical V-type transcript,
characterized by the loss of 54 bases from the 3� end of PML exon 6. The
5� QZyme primer for the L-type/V-type assay has been designed upstream of
this common breakpoint, and the transcripts of these V-type patients will be
amplifiable. The remaining V-type patients are not amplifiable unless a more 5�
primer with B tag is constructed.
2. QZyme primer sequences (5� to 3�) are as follows:
5� QZyme BCR primer: (Tag D—CACTCAGCCACTGGATTTAA)
3� BCR primer: (GCGTCTTTGCTTTATTCAC)
5� QZyme PML S-type primer: (Tag B—TCAGCTCTTGCATCACC)
5� QZyme PML L-type primer (Tag B—AGGAGCCCCGTCATAGGA)
3'≤ RARα primer: (GGGCACTATCTCTTCAGAAC)
3. The method described in this chapter employs three fluorophores: FAM, ROX,
and the less commonly used Cal Orange. The ABI 7700 needs to be calibrated to
read each of these.
4. Although plasmids provide stable calibrators of exact copy number, they do not
account for the efficiency of the reverse transcriptase. Total RNA remains the
only calibrator that accurately controls for reverse transcriptase activity, and its
suitability as such has been fully explored in this laboratory. Unfortunately, there
are also disadvantages associated with using total RNA from cultured cells as
calibrators. The exact transcript copy number remains unknown, and differences
in expression can hinder direct comparisons and complicate interpretation of results.
Likewise, plasmids diluted in water alone do not account for any differences
in amplification efficiency between the calibrator and test sample. In an
effort to better mimic the complex milieu of patient samples, the plasmid calibrators
containing PML-RARα have been diluted in a background of total RNA that
does not contain the PML-RARα transcript.
5. The PCR amplicon from V-type patients will vary in individual patients. The
authors acknowledge the potential difference in amplification efficiency between
the L-type plasmid calibrator and the V-type patients. To address this, the authors
have previously shown there is no significant difference in the amplification efficiency
between the L-type template (producing a longer amplicon) and the Vtype
template (producing a shorter amplicon) when using identical primers. The
L-type plasmid is therefore considered suitable for estimating expression in Vtype
patients.
6. We have found that RNA degrades over time. Some RNA transcripts are particularly
labile. To minimize degradation, stocks of RNA that are not for immediate
use should be kept in volumes greater then 100 µL at high concentrations (i.e.,
RNA ≥ 100 ng/µL). Calibrators can be stored as multiple aliquots in smaller
volumes but should not be kept for longer than 1 mo.
7. To minimize risk of contamination, we have established several rooms specifically
for PCR experiments. All have positive pressure, a dressing room, and contain
everything necessary for the designated tasks (ensuring nothing is brought in