Myeloid Leukemia

Detecting JAK2 V617F Mutation in MPD 255
ciently sensitive to detect low levels of clonal granulocytes in a background of
normal granulocytes and lymphocytes. Sequencing approaches, which are only
capable of detecting a heterozygous mutation when present in greater than 40%
of cells, are insufficiently sensitive and may give false-negative results. More
sensitive molecular methods are therefore required. We have developed two
sensitive methods for detecting the mutation, one based on allele-specific
amplification of the mutation in a polymerase chain reaction (PCR), and the
other on digestion of the wild-type allele, but not the V617F allele with the
restriction enzyme, BsaXI (11). Both methods are capable of sensitively and
specifically detecting the mutation, even when present in only 1–10% of cells.
The allele-specific PCR method uses a three-primer system, in which there
is a common reverse primer, a mutation-specific forward primer, and a control
forward primer (Fig. 1). The 3� end of the mutation-specific primer is the T
nucleotide, which is mutated (substituted in place of G) in V617F-positive disease,
and the primer also has an intentional mismatch at the third nucleotide
from the 3� end. This increases the specificity of primer binding, helping to
ensure that product only amplifies when the mutation is present. The other
forward primer amplifies both mutant and wild-type DNA, and acts as a control
for the fidelity of the PCR reaction (Fig. 2). The advantages of the allelespecific
PCR approach are that it is sensitive and not particularly
resource-intensive. Potential disadvantages are the fact that it cannot discriminate
between heterozygous and homozygous mutation, and the very small
chance of false-positive reactions due to mispriming of the mutation-specific
primer. One other set of primers has been published that involves a four-primer
system (19). That system allows identification of some patients who have
homozygous V617F mutation, but the significance of this in a routine diagnostic
or clinical setting is yet to be determined.
The restriction enzyme method exploits the observation that the nucleotide
change resulting in the V-to-F alteration in JAK2 perturbs a specific restriction
endonuclease recognition sequence. BsaXI recognizes the nonpalindromic
sequence, 5�...GGAG(N) 5GT...3�, but is unusual in that the enzyme cleaves the
DNA twice, on either side of this motif. A 30-bp fragment is produced as a
result of endonuclease cleavage, such that the true restriction site is:
5� NNNNNNNGGAGNNNNNGTNNNNNNNNNNNN 3�
3� NNNNNNNNNNCCTCNNNNNCANNNNNNNNN 5�
with the recognition sequence highlighted in bold. The BsaXI restriction site
present within exon 14 of JAK2 has the sequence:
*
5� AAATTATGGAGTATGTGTCTGTGGAGACGA 3�
3� AAATTTAATACCTCATACACAGACACCTCT 5�