Myeloid Leukemia

More documents

Recommendations

Info

165 Table 1 Primers for CBFB-MYH11 Reverse-Transcription (RT)-Polymerase Chain Reaction (PCR) Detection Name (ref.) Sequence (5'–3') Locus and position (5'–3') Purpose cd (9) GCAGGCAAGGTATATTTGAAGGC CBFB pos 253–275 First round CBFB-MYH11 PCR mm (9) CTTCCAAGCTCTTGGCTTTCTTC MYH11 pos 2401–2379 First round CBFB-MYH11 PCR cmdI (9) ATGGTATGGGCTGTCTGGAGT CBFB pos 338–358 Nested CBFB-MYH11 PCR mmd2 (9) CTGTGGCAAAGATCTCATCTC MYH11 pos 2365–2345 Nested CBFB-MYH11 PCR RAR-in* CAGCACCAGCTTCCAGTTAG RAR pos 235–254 RAR control PCR RAR-II* GGCGCTGACCCCATAGTGGT RAR pos 414–395 RAR control PCR Mfor (13) AGTAGCCTGTCGGGAAGGAAC MYH11 pos 2497–2517 MYH11 qPCR Mrev (13) GCCTGCTGTGTGGCTTTG MYH11 pos 2639–2622 MYH11 qPCR Mpro (13) CACTCCAGGACGAGAAGCGCCG MYH11 pos 2519–2540 MYH11 qPCR probe Cfor* GAGAAGGACACGCGAATTTGA CBFB pos 420–440 CBFB-MYH11 qPCR type A CproMGB* ATAGAGACAGGTCTCATCG CBFB pos 443–461 CBFB-MYH11 qPCR probe, types A,D,E MrevA* GCTTGGACTTCTCCAGCTCAT MYH11 pos 1945–1925 CBFB-MYH11 qPCR, type A ENF803 (15) CATTAGCACAACAGGCCTTTGA CBFB pos 389–410 CBFB-MYH11 qPCR types D, E ENR863 (15) CCTCGTTAAGCATCCCTGTGA MYH11 pos 1237–1217 CBFB-MYH11 qPCR, type D ENR865 (15) CTCTTTCTCCAGCGTCTGCTTAT MYH11 pos 1038–1016 CBFB-MYH11 qPCR, type E PBGDfor* GGCAATGCGGCTGCAA PBGD pos 40–55 PBGD control qPCR PBGDrev* GGGTACCCACGCGAATCAC PBGD pos 103–85 PBGD control qPCR PBGDpro* CTCATCTTTGGGCTGTTTTCTTCCGCC PBGD pos 83–57 PBGD control qPCR probe *Primers are described here. Please note that the position of the CBFB primers and probe are based on the sequence originally published by Liu et al. (16). The positions in the concomitant GenBank file (accession number L20298) differ by 21 bases because the first 21 bases (from the start codon) of CBFB are not present in the GenBank file. The positions of the MYH11 primers and probe are based on GenBank accession number D10667 (17). The cDNA positions of the RAR primers are based on GenBank sequence X06614. The positions of the PBGD primers and probe are based on GenBank accession number X04808 (18). Diagnosis of CBFB-MYH11-Positive AML 165
166 van der Reijden and Jansen Fig. 1. Schematic representation of exonic junctions in currently known in-frame CBFB-MYH11 fusion transcripts. Relevant CBFB exons (ce) are depicted as gray boxes and numbered. Relevant MYH11 exons (me) are depicted as open boxes and numbered. In the upper panel, unrearranged CBFB and MYH11 transcripts are shown. In the right column, the type of fusion transcript is indicated. Junctions in CBFB occur after exons 4 and 5. Breakpoints in MYH11 occur before exons 28, 29, 30, 32, 33, and 34. Breakpoints in CBFB-MYH11 fusion transcript types C and H occur within MYH11 exons 31 and 28, respectively. MYH11 (see Fig. 1) (1,5–10). In addition, alternative splicing in CBFB may result in additional bands after PCR (8). For the detection of CBFB-MYH11 fusion transcripts at diagnosis, qualitative PCR should be applied that detects all known CBFB-MYH11 fusion transcripts (Fig. 1) (9). To increase the sensitivity of the assay, a two-step CBFB-MYH11 PCR is outlined below (see Subheading 3.1.1.). For the first-round PCR, cDNA is added to a PCR mix. After PCR, an aliquot of the first-round PCR is used in a second-round PCR. Product amplification is subsequently visualized by agarose gel electrophoresis. Because acute myeloid leukemia (AML) is defined as the presence of more than 20% of blasts in bone marrow, a sensitivity of at least 1 in 100 should be obtained. The best and most convenient way to show that the desired sensitivity is achieved is to use a dilution series consisting of RNA isolated from a positive control (the cell line ME-1 [11]) diluted into RNA from a negative
Page 1 and 2:
M E T H O D S I N M O L E C U L A R
Page 3 and 4:
M E T H O D S I N M O L E C U L A R
Page 5 and 6:
© 2006 Humana Press Inc. 999 River
Page 7 and 8:
vi Preface comprehensive review of
Page 9 and 10:
viii Contents 11 Detection of the F
Page 11 and 12:
x Contributors D. GARY GILLILAND
Page 14 and 15:
RNA and DNA From Leukocytes 1 1 Iso
Page 16 and 17:
RNA and DNA From Leukocytes 3 mine
Page 18 and 19:
RNA and DNA From Leukocytes 5 late
Page 20 and 21:
RNA and DNA From Leukocytes 7 9. Us
Page 22 and 23:
RNA and DNA From Leukocytes 9 16. C
Page 24 and 25:
RNA and DNA From Leukocytes 11 3. I
Page 26 and 27:
Cytogenetic and FISH Techniques 13
Page 28 and 29:
Page 30 and 31:
Page 32 and 33:
Page 34 and 35:
Page 36 and 37:
Page 38 and 39:
Page 40 and 41:
Real-Time RT-PCR Strategies 27 3 Ov
Page 42 and 43:
Real-Time RT-PCR Strategies 29
Page 44 and 45:
Real-Time RT-PCR Strategies 31 cifi
Page 46 and 47:
Real-Time RT-PCR Strategies 33 2.1.
Page 48 and 49:
Real-Time RT-PCR Strategies 35 Fig.
Page 50 and 51:
Real-Time RT-PCR Strategies 37 2.1.
Page 52 and 53:
Real-Time RT-PCR Strategies 39 the
Page 54 and 55:
Page 56 and 57:
Real-Time RT-PCR Strategies 43 duri
Page 58 and 59:
MyiQ single color 400 nm 585 nm 96
Page 60 and 61:
Real-Time RT-PCR Strategies 47 side
Page 62 and 63:
Table 2 Real-Time Quantitative Poly
Page 64 and 65:
Real-Time RT-PCR Strategies 51 AML-
Page 66 and 67:
Real-Time RT-PCR Strategies 53 the
Page 68 and 69:
Real-Time RT-PCR Strategies 55 plas
Page 70 and 71:
Real-Time RT-PCR Strategies 57 betw
Page 72 and 73:
Real-Time RT-PCR Strategies 59 Ct C
Page 74 and 75:
Page 76 and 77:
Real-Time RT-PCR Strategies 63 asse
Page 78 and 79:
Real-Time RT-PCR Strategies 65 21.
Page 80 and 81:
Real-Time RT-PCR Strategies 67 50.
Page 82 and 83:
Quantitative PCR for Monitoring CML
Page 84 and 85:
Page 86 and 87:
Page 88 and 89:
Page 90 and 91:
Page 92 and 93:
Page 94 and 95:
Page 96 and 97:
Page 98 and 99:
Page 100 and 101:
Page 102 and 103:
Page 104 and 105:
Page 106 and 107:
Detection of BCR-ABL Mutations 93 5
Page 108 and 109:
Detection of BCR-ABL Mutations 95 F
Page 110 and 111:
Detection of BCR-ABL Mutations 97 2
Page 112 and 113:
Detection of BCR-ABL Mutations 99 o
Page 114 and 115:
Detection of BCR-ABL Mutations 101
Page 116 and 117:
Page 118 and 119:
Page 120 and 121:
Deletion of Derivative Chromosome 9
Page 122 and 123:
Page 124 and 125:
Page 126 and 127:
Page 128 and 129: Diagnosis of PML-RARA-Positive APL
Page 140 and 141: Duplexed QZyme RT-PCR for APL Analy
Page 162 and 163: Diagnosis of AML1-MTG8 (ETO)-Positi
Page 176 and 177: Diagnosis of CBFB-MYH11-Positive AM
Page 190 and 191: FIP1L1-PDGFRA in Hypereosinophilic
Page 202 and 203: FLT3 Mutations in AML 189 12 FLT3 M
Page 204 and 205: FLT3 Mutations in AML 191 3.1.1. DN
Page 206 and 207: FLT3 Mutations in AML 193 Table 2 R
Page 208 and 209: FLT3 Mutations in AML 195 Fig. 2. D
Page 210 and 211: FLT3 Mutations in AML 197 10. Kiyoi
Page 212 and 213: WT1 Expression in AML and MDS 199 1
Page 214 and 215: WT1 Expression in AML and MDS 201 T
Page 218 and 219: WT1 Expression in AML and MDS 205 T
Page 220 and 221: WT1 Expression in AML and MDS 207 F
Page 226 and 227: Classification of AML by DNA-Oligon
Page 228 and 229:
Classification of AML by DNA-Oligon
Page 230 and 231:
Page 232 and 233:
Page 234 and 235:
Page 236 and 237:
Page 238 and 239:
Page 240 and 241:
Page 242 and 243:
Page 244 and 245:
Page 246 and 247:
233 Classification of AML by DNA-Ol
Page 248 and 249:
Page 250 and 251:
Page 252 and 253:
Page 254 and 255:
Classification of AML by Monoclonal
Page 256 and 257:
Page 258 and 259:
Page 260 and 261:
247 Classification of AML by Monocl
Page 262 and 263:
Page 264 and 265:
Page 266 and 267:
Detecting JAK2 V617F Mutation in MP
Page 268 and 269:
Page 270 and 271:
Page 272 and 273:
Page 274 and 275:
Page 276 and 277:
Page 278 and 279:
PRV-1 Overexpression in PV and ET 2
Page 280 and 281:
Page 282 and 283:
Page 284 and 285:
Page 286 and 287:
Page 288 and 289:
Chimerism Analysis 275 18 Chimerism
Page 290 and 291:
Chimerism Analysis 277 1.2. Detecti
Page 292 and 293:
Chimerism Analysis 279 3. Extractio
Page 294 and 295:
Chimerism Analysis 281 14. 310 Gene
Page 296 and 297:
Chimerism Analysis 283 12. Upon com
Page 298 and 299:
Chimerism Analysis 285 Fig. 2. Calc
Page 300 and 301:
Chimerism Analysis 287 4. Allow the
Page 302 and 303:
Chimerism Analysis 289 capillary el
Page 304 and 305:
Chimerism Analysis 291 and recipien
Page 306 and 307:
Chimerism Analysis 293 Table 2 Comm
Page 308:
Chimerism Analysis 295 12. Maas, F.
Page 311 and 312:
298 Index management, 128 AML, see
Page 313 and 314:
300 Index and AML, 213, 236, 238, 2
Page 315 and 316:
302 Index chimerism analysis in sex
Page 317 and 318:
304 Index minimal residual disease
Page 319:
306 Index Stem cell transplantation
show all

Myeloid Leukemia

Create successful ePaper yourself

Delete template?

Save as template?