Myeloid Leukemia

FIP1L1-PDGFRA in Hypereosinophilic Syndrome 179
generation of the FIP1L1-PDGFRA fusion, can be detected by three-color fluorescence
in situ hybridization (FISH).
2. Materials
1. Anti-coagulated (preferably with EDTA) peripheral blood or bone marrow cells.
2. Red blood cell lysis buffer: 150 mM NH 4Cl, 0.1 mM ethylenediamine tetraacetic
acid (EDTA), 10 mM KHCO 3, adjust to pH 7.4
3. Phosphate-buffered saline (PBS): 0.144 g/L KH 2PO 4, 0.795 g/L Na 2HPO 4, 9 g/L
NaCl.
4. Freezing medium: 90% fetal bovine serum, 10% dimethylsulfoxide (DMSO).
5. Trizol (Invitrogen).
6. 70% ethanol: 7 vol 100% ethanol in 3 vol nuclease or RNase-free water.
7. Chloroform.
8. Isopropanol.
9. 8 mM NaOH.
10. DNA wash solution: 0.1 M sodium citrate, 10% ethanol (use autoclaved water).
11. cDNA synthesis kit.
12. Restriction endonuclease AseI.
13. One-phor-all buffer Plus (OPA+, AP Biotech).
14. T4 ligase.
15. ATP.
16. Oligonucleotides (primers): FIP1L1-F1 (exon 7, 5�-acctggtgctgatctttctgat),
FIP1L1-F2 (exon 7, 5�-aaagaggatacgaatgggacttg), PDGFRA-R1 (exon 14, 5�tgagagcttgtttttcactgga),
PDGFRA-R2 (exon 13, 5�-gggaccggcttaatccatag), Ase-
Fa (5�-cagctgacatttgtggagtcct), Ase-Fb (5�-ttccgctagtctttcccatctt), PDGFRA-Ra
(5�-agcaaatttccattgcctagttct), PDGFRA-Rb (5�-ggaggttaccccatggaactta),
ZNF384-F (5�-cccatttcggctcccatgatt) and ZNF384-R (5�-ggtctcggtgtgtgacttgga)
17. Bacterial artificial chromosomes (BACs): RPCI11–120K16, RPCI11–3H20,
RPCI11–24010 (available from http://bacpac.chori.org).
18. The EOL-1 cell line (available from http://www.dsmz.de).
19. RPMI-1640 medium, supplemented with 10% fetal bovine serum.
3. Methods
3.1. Extraction of RNA, DNA, and Proteins From Blood or Bone Marrow
3.1.1. Isolation of White Blood Cells From Blood or Bone Marrow
1. Add 5 vol of red blood cell lysis buffer to the anti-coagulated blood or bone
marrow (see Notes 1 and 2).
2. Incubate the mixture on ice for 10 min.
3. Centrifuge at 450g for 10 min at 4°C.
4. After centrifugation, the cell pellet should be white, with only a small amount of
red cells present. If this is the case, proceed with step 5. If the cell pellet is still
red and no white blood cells are visible, resuspend the pellet again in red blood