John M. S. Bartlett.pdf - Bio-Nica.info

212 Kerr
Fig. 1. Fluorescent probes 1 to 4 have different wavelengths as shown. For quantitation of
multiple RNA species in a single sample, probes with the greatest difference in wavelengths
should be selected to minimize overlap in signal detection. In this example probes 1 and 4
would be selected.
3. Primers/probes: Strict conditions must be adhered to for primer/probe design when using
the ABI 7700 quantitative PCR system. These are shown in Table 1 and may be designed
using Primer Express software. Primer and probe concentrations used are 10 pmol/µL
and 5 pmol/µL, respectively.
t-PA forward primer: GCAGGCTGACGTGGGAGTAC
t-PA reverse primer: CCTCCTTTGATGCGAAACTGA
t-PA probe: TGATGTGCCCTCCTGCTCCACCT
These primers generate an amplicon of 91 base pairs, which spans intron 9 (1249 bp)
of the t-PA gene. Because of the large intron size, only t-PA mRNA and not genomic
DNA is amplified, removing the need for a DNase step. The t-PA Taqman probe has a
FAM fluorescent label.
4. 18S rRNA primer-probe mix (supplied premixed). The 18S rRNA probe has a VIC
fluorescent label.
5. PCR mastermix (Stratagene, La Jolla, California): 100 µL (500U) hot start Taq polymerase,
1.7 mL of 10× PCR buffer, 1.44 mL of 50 mM MgCl 2 , 400 µL of 5 mM dNTPs, 6 µL
of reference dye, and 6.354 mL of DEPC distilled H 2 O. This can be stored at –20°C
until needed.
6. Standard wall 0.6-mL capped conical tubes.
7. 96-well reaction plate.
8. ABI Prism 7700 Sequence detection system.
3. Methods
1. Reverse Transcriptase mastermix (9 µL) is added to 0.6-mL conical tubes.
2. To this, 1 µL (approx 100 ng/µL) of total RNA is added.