John M. S. Bartlett.pdf - Bio-Nica.info

396 McAleer, Coffey, and Dunham
Table 1
Oligonucleotide Sequences for Vectorette PCR
Vectorette oligonucleotides (for blunt-ended ligations)
“Top” strand
CAAGGAGAGGACGCTGTCTGTCGAAGGTAAGGAACGGACGAGAGA
AGGGAGAG
“Bottom” strand
CTCTCCCTTCTCGAATCGTAACCGTTCGTACGAGAATCGCTGTCCTC
TCCTTG
Universal vectorette primer 224
CGAATCGTAACCGTTCGTACGAGAATCGCT
pYAC4-specific primers
Centric (“left”) arm
1089 CACCCGTTCTCGGAGCACTGTCCGACCGC
Sup4-2
GTTGGTTTAAGGCGCAAGAC
pYACL (13)
AATTTATCACTACGGAATTC
Acentric (“right”) arm
1091 ATATAGGCGCCAGCAACCGCACCTGTGGCG
Sup4-3
GTCGAACGCCCGATCTCAAG
pYACR (13)
CCGATCTCAAGATTACGGAATTC
All oligonucleotide sequences are written in the 5′→3′ direction.
3. PCR is performed using a GeneAmp PCR reagent kit (Perkin–Elmer, Warrington, UK)
in 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl 2 , 0.01% (w/v) gelatin containing
200 µM of each dNTP and 1.0 µM of each primer. Amplitaq is added to a concentration
of 1.25 U/50 µL reaction and Perfect Match (Stratagene, Cambridge, UK) to a concentration
of 5 U/50 µL reaction and overlaid with mineral oil (Sigma, Poole, UK). DNA
amplification is performed in an Omnigene thermocycler (Hybaid, Teddington, UK).
3. Methods
1. Take half an agarose plug (approx 50–100 µL containing 1–2 µg DNA) of miniprep YAC
DNA (DNA in solution may also be used; see Note 1) and wash as follows: 3 × 20 min
in 10 mM Tris-HCl, 0.1 mM EDTA, pH 7.4 (1 mL/plug) at 50°C. 1 × 20 min in 10 mM
Tris-HCl, 0.1 mM EDTA, pH 7.4 (1 mL/plug) at room temperature.
2. Preincubate plugs for 30 min at 37°C in 100 µL of the appropriate enzyme buffer (see
manufacturer’s recommendation).
3. Remove buffer, and replace with 100 µL of fresh enzyme buffer containing 20 to 30 U
of restriction enzyme (see Note 2), and incubate overnight at the recommended temperature
(usually 37°C). After digestion, the plug may be cut into three, and one portion
electrophoresed through a 1.0% agarose mini gel alongside a similar amount of untreated
YAC DNA to test for complete digestion. One slice may be stored dry at 4°C and redigested
if incomplete digestion has occurred.
4. Incubate one third of the agarose plug from step 3 in 1 mL of 1× ligation buffer for
1 h on ice.
5. Replace with 100 µL of fresh 1× ligation buffer. To this add 10 µL of preannealed bluntended
vectorette linker (at 1 µM; see Subheading 2., item 2), that is, 10 pmol of linker.
6. Heat to 65°C for 15 min to melt the agarose plug, and then equilibrate at 37°C
(approx 5 min).