John M. S. Bartlett.pdf - Bio-Nica.info

428 Bull and Paskins
2.3. Detection
1. Water bath at 45°C, and staining jar (e.g., a Coplin jar).
2. Incubator set at 37°C and sandwich box.
3. 20× SSC: 3.0 M NaCl, 0.30 M tri-sodium citrate, pH 7.3.
4. Wash buffer: 4× SSC (diluted from 20× stock), 0.05% Triton×-100.
5. Dried skimmed milk powder.
6. Blocking buffer: Wash buffer with the addition of 5% skimmed milk powder (which can
be stored for a few days at 4°C).
7. Anti DIG-FITC (Roche Molecular Biochemicals). Store at –20°C in 5-µL aliquots.
8. Antifade mountant (e.g., Vectashield, Vector Laboratories, Burlingame CA).
9. Counterstain: propidium iodide solution (20 µg/mL, Sigma, Dorset, UK) (see Note 5).
10. Fluorescence microscope with appropriate filters for FITC and PI (e.g., Zeiss Axioskop ® ,
Carl Zeiss, Thornwood, NY).
3. Methods
3.1. Primer Design
These protocols were tested using α-satellite-specific primers for DYZ1 (D599:
TGGGCTGGAATGGAAAGGAATCGAAAC), DXZ1 (E563: ATAATTTCCCATA-
ACTAAACACA), D17Z1 (E571: AATTTCAGCTGACTAAACA), D7Z1 (E528:
AGCGATTTGAGGACAATTGC), and D3Z1 (E570: TCTGCAAGTGGATATTTAAA)
(1). It has been suggested that one or more of these are used to set up the technique
when using human cells (see Note 5).
3.2. Cell Preparation
The type of cells you use will of course depend on your experimental system. Aim to
prepare cells in a monolayer, preferably slightly separated from each other, with several
hundred cells in an area of 20 to 30 mm 2 for ease of location at the microscopy stage
(see Note 5). In practice, 10 to 20 cells may be all that is needed for good results.
Human peripheral blood leukocytes provide a robust positive control and, satisfyingly,
are easily available in plentiful and cheap supply (see Note 6). The majority red
cells do not interfere with the PRINS reaction.
1. Obtain a few drops of blood from your finger using a suitable puncture device (e.g..
Haemolance, HaeMedic AB, Munka Ljungby, Sweden).
2. Spot approx 5 µL whole blood onto one end of a slide. Use a second microscope slide to
spread the blood. This is done by holding the end of the second slide at an angle of roughly
45 degrees onto the blood spot, allowing it to spread under the edge, then pushing with
some force to smear the cells. When done properly, a monolayer or “feather” of cells a few
mm wide will form at the end of the smear (see Note 5). With practice, it is easily possible
to make 2 or 3 small smears per slide, each using 1 to 2 µL of blood. This is useful if space
on the flat-block PCR machine is limiting.
3. Allow to air dry.
3.3. Fixation
1. Fix by immersion in ethanol (see Note 7) for 5 min at room temperature (1 min is sufficient
for blood smears).
2. Remove slides, drain, and air dry. Slides can be used immediately or stored at 4°C for
several months.