John M. S. Bartlett.pdf - Bio-Nica.info

More documents

Recommendations

Info

Unknown Genomic Sequences 377 1. Primer 1 (P1): a 18-22 mer with a calculated T m around 45 to 50°C. Working concentration: 0.5 pmol/µL. 2. Primer 2 (P2) should have the same melting temperature as the long-linker primer (see Note 4) used for the PCR amplification, in our case a 25 to 27 mer with a calculated T m of 60 to 65°C. The guanine-cytosine content is usually between 45 and 55%. It does not need to overlap with P1, but a 5-bp overlap has worked. It should be internal to primer 2 to increase the specificity of the overall reaction. Working concentration: 10 pmol/µL. 3. Primer 3 (P3): an 18 to 22 mer with a calculated T m around 45 to 50°C, but longer oligos with higher GC contents will also work. It should be internal to P2 to increase the specificity. It will be 32 P kinased with an SA of 10 7 cpm/pmol (see Subheading 3.3.). Working concentration: 0.2 pmol/µL. 4. Long-linker oligonucleotide: 5′ CACCCGGGAGATCTGAATTC 3′ (see Note 4). It is biotinylated at its 5′-end during synthesis by incorporation of a biotin-2-o-propylphosphoramidite. It should be unphosphorylated. 5. Short-linker oligonucleotide: 5′ GAATTCAGATC 3′, dephosphorylated. 6. Oligo loading mix: 10% glycerol in formamide. 7. Denaturing polyacrylamide gel: 14.5% acrylamide, 0.5% bis-acrylamide, 7 M urea, 1× TBE. Size: 25 × 25 × 0.1 cm. 8. Formamide loading buffer: 96% formamide, 0.05% xylene cyanol, 0.05% bromophenol blue, 10 mM EDTA. 9. PE buffer: 50 mM Tris-HCl, pH 7.5, 100 mM NaCl, 1 mM EDTA, 1% phenol (v/v). 10. Chloroformisoamyl alcohol (241; Merck). 11. 5 M LiCl. 12. 1 M MgCl 2 . 13. Ethanol 100%. 14. Ethanol 80%. 15. TBE: 90 mM Tris-borate, 1 mM EDTA, pH 8.3. 2.3. Kinasing of Primer 3 1. P3 at 10 pmol/µL. 2. Polynucleotide kinase buffer 10×: 700 mM Tris-HCl, pH 7.6, 100 mM MgCl 2 , 50 mM DTT. 3. γ 32 PATP, 5000 Ci/mmol (Redivue, Amersham). 4. Polynucleotide kinase 10 U/µL (NE Biolabs). 5. 50 mM EDTA, pH 8.0. 6. G-25 fine spin columns (Boehringer, Mannheim). 2.4. First Primer Extension 1. P1 at 0.5 pmol/µL in TE, pH 7.5. 2. 1 N NaOH. 3. TES buffer: 560 mM TES, free acid (Sigma), 240 mM HCl, 100 mM MgCl 2 . 4. Vent buffer (10×): 100 mM KCl; 100 mM (NH 4 ) 2 SO 4 , 200 mM Tris-HCl, pH 8.8, 20 mM MgSO 4 , 0.1% Triton X-100 (NE Biolabs). 5. dNTP solution: 10 mM dNTPs, (Boehringer, Mannheim); keep in small aliquots at –20°C. Do not freeze/thaw more than three times. 6. Vent Exo DNA polymerase, 2 U/µL (NE Biolabs). 2.5. Ligation 1. Ligase buffer (10×): 500 mM Tris-HCl, pH 7.5, 100 mM MgCl 2 , 100 mM DTT, 10 mM ATP, 250 µg/mL BSA (NE Biolabs).
378 Quivy and Becker 2. Solution of 40% PEG 8000 (Sigma), filtered through a 0.22-µm filter. It will take some time to dissolve the PEG in water. Incubate at room temperature on a rotating wheel for several hours. It also takes some force to filter the solution using a syringe. 3. T4 DNA ligase, 400 U/µL (NE Biolabs). 4. Annealed linker (see Subheading 3.4.). 2.6. PCR 1. TE: 10 mM Tris-HCl, pH 8.5; 1 mM EDTA, pH 8.5. 2. Phenolchloroformisoamyl alcohol (25241; Aurresco). 3. Solution of 7.5 M ammonium acetate containing 25 µg/mL yeast tRNA (Boehringer Mannheim). Crude yeast tRNA has to be cleaned by multiple organic extractions and ethanol precipitation. 4. Vent buffer (see Subheading 2.4.). 5. dNTP solution (see Subheading 2.4.). 6. 100 mM MgSO 4 . 7. P2 solution, 10 pmol/µL (see Subheading 2.2.). 8. Long-linker primer, 10 pmol/µL (see Subheading 2.2.). 9. Vent DNA polymerase 2 U/µL (NE Biolabs). 10. Perkin–Elmer thermal cycler. 11. PCR tubes (Perkin–Elmer). 12. Mineral oil (PCR-grade). 2.7. Tag Selection of the PCR Products 1. Dynabeads M-280 streptavidin (Dynal, Oslo, 10 mg/mL). 2. Magnetic particle concentrator (MPC, Dynal). 3. Phosphate-buffered saline (PBS), pH 7.4. 4. PBS, pH 7.4; 0.01% BSA (molecular biology grade). 5. BW solution: a 11 mixture of TE and 5 M NaCl. 2.8. Sequencing Reaction (see Note 7) 1. MPC. 2. 150 mM NaOH, freshly prepared. 3. TE, pH 7.5. 4. Vent buffer (see Subheading 2.4.). 5. Termination mixes made up in 1× vent buffer: A-mix: 900 µM ddATP, 30 µM dATP, 100 µM dCTP, 100 µM dGTP, 100 µM dTTP. C-mix: 480 µM ddCTP, 30 µM dATP, 37 µM dCTP, 100 µM dGTP, 100 µM dTTP. G-mix: 400 µM ddGTP, 30 µM dATP, 100 µM dCTP, 37 µM dGTP, 100 µM dTTP. T-mix: 720 µM ddTTP, 30 µM dATP, 100 µM dCTP, 100 µM dGTP, 33 µM dTTP. 6. Labeled P3 (see Subheading 3.3.). 7. Circumvent sequencing buffer 10×: 100 mM KCl, 100 mM (NH 4 ) 2 SO 4 , 200 mM Tris-HCl, pH 8.8, 50 mM MgSO 4 (NE Biolabs). 8. Triton X-100 solution, 3% (v/v) in water. 9. Vent Exo DNA polymerase, 2 U/µL (NE Biolabs). 10. Formamide loading buffer (see Subheading 2.2.). 11. Sequencing gel. 12. Fixing solution: 10% acetic acid, 10% methanol. 13. Dupont NEN reflection films and corresponding cassettes.
Page 1 and 2:
TM Methods in Molecular Biology Vol
Page 3 and 4:
Xin Wang and W. Scott Young III 105
Page 5 and 6:
63. Primed In Situ Nucleic Acid Lab
Page 7 and 8:
4 Bartlett and Stirling The thing t
Page 9 and 10:
6 Bartlett and Stirling Fig. 2. Res
Page 11 and 12:
8 Carroll and Casimir of PCR. Such
Page 13 and 14:
10 Carroll and Casimir cost more th
Page 15 and 16:
12 Carroll and Casimir are no longe
Page 17 and 18:
14 Carroll and Casimir Should these
Page 19 and 20:
16 McDonagh Fig. 1. Unidirectional
Page 21 and 22:
18 McDonagh stored. This means that
Page 23 and 24:
20 McDonagh
Page 25 and 26:
22 Stirling which will either not a
Page 27 and 28:
24 Stirling
Page 29 and 30:
28 Bartlett References 1. US Depart
Page 31 and 32:
30 Bartlett and White 11. 5 M sodiu
Page 33 and 34:
32 Bartlett and White
Page 35 and 36:
34 Pearson and Stirling 11. Microfu
Page 37 and 38:
36 Going 3. Methods 3.1. Section Cu
Page 39 and 40:
38 Going pipet filler. Spread the p
Page 41 and 42:
40 Going digitally to record the di
Page 43 and 44:
42 Going
Page 45 and 46:
44 Pearson 7. Add 60 µL of chlorof
Page 47 and 48:
46 Bartlett 3. Methods 3.1. RNA Ext
Page 49 and 50:
48 Pearson 3. Method The method of
Page 51 and 52:
50 Stirling and Bartlett 4. Protein
Page 53 and 54:
52 Stirling and Bartlett
Page 55 and 56:
54 Stirling 3. Methods 3.1. Fungal
Page 57 and 58:
56 McDonagh 2. Add 0.4 mL of TNE bu
Page 59 and 60:
58 Schmerer 2. Materials To apply t
Page 61 and 62:
60 Schmerer 3. The additional purif
Page 63 and 64:
62 Schmerer
Page 65 and 66:
64 Stirling
Page 67 and 68:
66 Bartlett Table 1 Recommended Aga
Page 69 and 70:
68 Bartlett Table 2 Separation of D
Page 71 and 72:
70 Bartlett 2. 5× TBE: 54 g of Tri
Page 73 and 74:
72 Bartlett 7. Remove upper aqueous
Page 75 and 76:
74 Bartlett 4. Many modern electrop
Page 77 and 78:
76 Bartlett
Page 79 and 80:
78 Stirling 11. Store at -20°C for
Page 81 and 82:
82 Hyndman and Mitsuhashi 3.1. Effi
Page 83 and 84:
84 Hyndman and Mitsuhashi Fig. 1. H
Page 85 and 86:
86 Hyndman and Mitsuhashi Fig. 3. H
Page 87 and 88:
88 Hyndman and Mitsuhashi can be ge
Page 89 and 90:
90 Grunenwald may be affected by ea
Page 91 and 92:
92 Grunenwald 50°C will generally
Page 93 and 94:
94 Grunenwald of template DNA, a su
Page 95 and 96:
96 Grunenwald than absolutely neces
Page 97 and 98:
98 Grunenwald 2. Foord, O. S. and R
Page 99 and 100:
100 Grunenwald
Page 101 and 102:
102 Stirling Table 1 Thermal Cycler
Page 103 and 104:
104 Stirling
Page 105 and 106:
106 Wang and Young full-length cDNA
Page 107 and 108:
108 Wang and Young Fig. 1. (A) Nort
Page 109 and 110:
110 Wang and Young Fig. 3. Expresse
Page 111 and 112:
112 Wang and Young 2. First-strand
Page 113 and 114:
114 Wang and Young 3′-RACE outlin
Page 115 and 116:
116 Wang and Young
Page 117 and 118:
118 Dassanayake and Samaranayake co
Page 119 and 120:
120 Dassanayake and Samaranayake 5.
Page 121 and 122:
122 Dassanayake and Samaranayake Re
Page 123 and 124:
124 Iannone et al. Fig. 1. Diagram
Page 125 and 126:
Table 1 Oligonucleotides Descriptio
Page 127 and 128:
128 Iannone et al. 5. For microsphe
Page 129 and 130:
130 Iannone et al. 4. To adjust for
Page 131 and 132:
132 Iannone et al. 6. Target concen
Page 133 and 134:
134 Iannone et al.
Page 135 and 136:
136 Benjamin, Smith, and Waites amp
Page 137 and 138:
138 Benjamin, Smith, and Waites the
Page 139 and 140:
140 Benjamin, Smith, and Waites 2.2
Page 141 and 142:
142 Benjamin, Smith, and Waites 2.
Page 143 and 144:
Page 145 and 146:
Page 147 and 148:
148 Benjamin, Smith, and Waites 8.
Page 149 and 150:
150 Benjamin, Smith, and Waites
Page 151 and 152:
152 Olmos et al. Fig. 1. RT-hemines
Page 153 and 154:
154 Olmos et al. This nested RT-PCR
Page 155 and 156:
156 Olmos et al. Table 2 Volume and
Page 157 and 158:
158 Olmos et al. 8. The sensitivity
Page 159 and 160:
160 Olmos et al.
Page 161 and 162:
162 Abe 5. Moloney murine leukemia
Page 163 and 164:
164 Abe Table 2 Detection Rate of H
Page 165 and 166:
166 Abe 4. For HBV, nested PCR usin
Page 167 and 168:
168 Tellier et al. of Pfu (and ther
Page 169 and 170:
170 Tellier et al. 2. Cline, J., Br
Page 171 and 172:
172 Tellier et al. 38. Tamiya, S.,
Page 173 and 174:
174 Tellier et al. 13. Thin-wall PC
Page 175 and 176:
176 Tellier et al. 13 min for the l
Page 177 and 178:
178 Tellier et al.
Page 179 and 180:
182 Stirling efficiency of the reac
Page 181 and 182:
184 Stirling
Page 183 and 184:
186 Cremer and Moos Fig. 1. Rearran
Page 185 and 186:
188 Cremer and Moos 4. Count cells
Page 187 and 188:
190 Cremer and Moos Fig. 3. Alignme
Page 189 and 190:
192 Cremer and Moos Fig. 4. Testing
Page 191 and 192:
194 Cremer and Moos 5. Compare the
Page 193 and 194:
196 Cremer and Moos 11. Klein, E.,
Page 195 and 196:
198 McDonagh the dilution method is
Page 197 and 198:
200 McDonagh 2.2. Basic PCR 1. dNTP
Page 199 and 200:
202 McDonagh Fig. 2. Quantitative P
Page 201 and 202:
204 McDonagh
Page 203 and 204:
206 Bartlett Table 1 Example Assay
Page 205 and 206:
208 Bartlett 3.4. Calculation of Re
Page 207 and 208:
210 Bartlett 11. Cerenkov counting
Page 209 and 210:
212 Kerr Fig. 1. Fluorescent probes
Page 211 and 212:
214 Kerr after the PCR. This reduce
Page 213 and 214:
218 Bartlett As with any experiment
Page 215 and 216:
220 Bartlett Even once novel regula
Page 217 and 218:
222 Bartlett Notwithstanding these
Page 219 and 220:
224 Bartlett
Page 221 and 222:
226 Dominguez et al. Table 1 Primer
Page 223 and 224:
228 Dominguez et al. 4. Oligonucleo
Page 225 and 226:
230 Dominguez et al. Fig. 2. cDNA n
Page 227 and 228:
232 Dominguez et al. 3.4. Gel Elect
Page 229 and 230:
234 Dominguez et al. 3. If the cont
Page 231 and 232:
236 Dominguez et al. 11. Joshi, C.
Page 233 and 234:
238 Khalturin, Kuznetsov, and Bosch
Page 235 and 236:
Page 237 and 238:
Page 239 and 240:
Page 241 and 242:
246 Ringquist et al. In this chapte
Page 243 and 244:
248 Ringquist et al. 5. Total RNA s
Page 245 and 246:
250 Ringquist et al. 3. Purificatio
Page 247 and 248:
252 Ringquist et al. 2. The present
Page 249 and 250:
254 Ringquist et al.
Page 251 and 252:
256 Case-Green, Pritchard, and Sout
Page 253 and 254:
Page 255 and 256:
Page 257 and 258:
Page 259 and 260:
Page 261 and 262:
Page 263 and 264:
Page 265 and 266:
Page 267 and 268:
272 Oien Fig. 1. A schematic diagra
Page 269 and 270:
274 Oien 4. 100% and 70% ethanol. 5
Page 271 and 272:
276 Oien 2. Purify polyA + mRNA fro
Page 273 and 274:
278 Oien 50-mL conical tubes. Resus
Page 275 and 276:
280 Oien Forward Primer, and then r
Page 277 and 278:
282 Oien 8. PCR. With SAGE, achievi
Page 279 and 280:
284 Oien
Page 281 and 282:
288 Edwards and Bartlett technology
Page 283 and 284:
290 Edwards and Bartlett ing less p
Page 285 and 286:
292 Edwards and Bartlett Stepwise m
Page 287 and 288:
294 Edwards and Bartlett
Page 289 and 290:
296 Rithidech and Dunn 11. Ethidium
Page 291 and 292:
298 Rithidech and Dunn Fig. 1. PCR
Page 293 and 294:
300 Rithidech and Dunn
Page 295 and 296:
302 Edwards and Bartlett Studies th
Page 297 and 298:
304 Edwards and Bartlett 11. Hot st
Page 299 and 300:
306 Edwards and Bartlett Fig. 1. Ex
Page 301 and 302:
308 Edwards and Bartlett 3. Sartor,
Page 303 and 304:
310 Schmerer the investigation conc
Page 305 and 306:
312 Schmerer References 1. Kunkel,
Page 307 and 308:
314 Schmerer
Page 309 and 310:
316 Aubele and Smida 2.2. Chemicals
Page 311 and 312:
318 Aubele and Smida References 1.
Page 313 and 314:
320 Nakashima, Akahoshi, and Tanaka
Page 315 and 316:
322 Nakashima, Akahoshi, and Tanaka
Page 317 and 318: 324 Stirling 9. TAE (20×): 484 g o
Page 319 and 320: 326 Stirling
Page 321 and 322: 328 Han and Robinson Fig. 1. Basic
Page 323 and 324: 330 Han and Robinson sequence diffe
Page 325 and 326: 332 Han and Robinson 4. Notes 1. PC
Page 327 and 328: 334 Han and Robinson
Page 329 and 330: 338 Stirling of simple and improved
Page 331 and 332: 340 Stirling concentrations interfe
Page 333 and 334: 342 Daniels to sequence a 500-bp PC
Page 335 and 336: 344 Daniels 4. Load all of the samp
Page 337 and 338: 346 Daniels References 1. Orita, M.
Page 339 and 340: 348 Kösel et al. Fig. 1. Schematic
Page 341 and 342: 350 Kösel et al. 3. Methods 3.1. P
Page 343 and 344: 352 Kösel et al. Fig. 2. Sequencin
Page 345 and 346: 354 Kösel et al. 5. Kwok, S. and H
Page 347 and 348: 356 Mazars and Theillet Fig. 1. Sch
Page 349 and 350: 358 Mazars and Theillet of genomic
Page 351 and 352: 360 Mazars and Theillet
Page 353 and 354: 362 Suomalainen and Syvänen Fig. 1
Page 355 and 356: 364 Suomalainen and Syvänen detect
Page 357 and 358: 366 Suomalainen and Syvänen temper
Page 359 and 360: 368 Shen et al. ladder. Also, direc
Page 361 and 362: 370 Shen et al. 3. Mineral oil. 4.
Page 363 and 364: 372 Shen et al. extended primers, w
Page 365 and 366: 374 Quivy and Becker Fig. 1. The us
Page 367: 376 Quivy and Becker that decreases
Page 371 and 372: 380 Quivy and Becker 7. Precipitate
Page 373 and 374: 382 Quivy and Becker 7. Prepare a p
Page 375 and 376: 384 Quivy and Becker
Page 377 and 378: 386 Walsh by most, but not all M13
Page 379 and 380: 388 Walsh PCR products are now flus
Page 381 and 382: 390 Walsh 5. For palindromic restri
Page 383 and 384: 392 Walsh
Page 385 and 386: 394 McAleer, Coffey, and Dunham Fig
Page 387 and 388: 396 McAleer, Coffey, and Dunham Tab
Page 389 and 390: 398 McAleer, Coffey, and Dunham Tab
Page 391 and 392: 400 McAleer, Coffey, and Dunham
Page 393 and 394: 402 Stirling 5. Homopolymer Regions
Page 395 and 396: 406 Speel, Ramaekers, and Hopman Ta
Page 397 and 398: 408 Speel, Ramaekers, and Hopman Fi
Page 399 and 400: 410 Speel, Ramaekers, and Hopman po
Page 401 and 402: Table 2 Comparison of PRINS, in Sit
Page 403 and 404: 414 Speel, Ramaekers, and Hopman te
Page 405 and 406: Table 3 Summary of Control Experime
Page 407 and 408: 418 Speel, Ramaekers, and Hopman 3.
Page 409 and 410: 420 Speel, Ramaekers, and Hopman ad
Page 411 and 412: 422 Speel, Ramaekers, and Hopman 25
Page 413 and 414: 424 Speel, Ramaekers, and Hopman 63
Page 415 and 416: 426 Bull and Paskins Fig. 1. Result
Page 417 and 418: 428 Bull and Paskins 2.3. Detection
Page 419 and 420:
430 Bull and Paskins 6. Shake the s
Page 421 and 422:
432 Bull and Paskins
Page 423 and 424:
434 Wiedorn and Goldmann Fig. 1. IS
Page 425 and 426:
436 Wiedorn and Goldmann 41. Protei
Page 427 and 428:
438 Wiedorn and Goldmann 2. Incubat
Page 429 and 430:
440 Wiedorn and Goldmann 3.15. Prim
Page 431 and 432:
442 Wiedorn and Goldmann ficient se
Page 433 and 434:
444 Wiedorn and Goldmann 25. Kommin
Page 435 and 436:
446 Gilchrist and Befus Fig. 1. Sch
Page 437 and 438:
448 Gilchrist and Befus 2. Cells ar
Page 439 and 440:
450 Gilchrist and Befus Fig. 3. RT
Page 441 and 442:
452 Gilchrist and Befus References
Page 443 and 444:
454 Speel, Ramaekers, and Hopman of
Page 445 and 446:
456 Speel, Ramaekers, and Hopman Fi
Page 447 and 448:
458 Speel, Ramaekers, and Hopman 3.
Page 449 and 450:
460 Speel, Ramaekers, and Hopman 4.
Page 451 and 452:
462 Speel, Ramaekers, and Hopman bu
Page 453 and 454:
464 Speel, Ramaekers, and Hopman 26
Page 455 and 456:
468 Pearson and Stirling into PCR p
Page 457 and 458:
470 Wang 2. Materials 2.1. PCR 1. D
Page 459 and 460:
472 Wang Fig. 1. A brief outline of
Page 461 and 462:
474 Wang
Page 463 and 464:
476 Horton, Raju, and Conti-Fine Fi
Page 465 and 466:
478 Horton, Raju, and Conti-Fine th
Page 467 and 468:
480 Horton, Raju, and Conti-Fine 1.
Page 469 and 470:
482 Horton, Raju, and Conti-Fine ot
Page 471 and 472:
484 Horton, Raju, and Conti-Fine
Page 473 and 474:
486 Preston amplification approach
Page 475 and 476:
488 Preston 1. 10× PCR buffer: 100
Page 477 and 478:
490 Preston Fig. 1. Design of degen
Page 479 and 480:
492 Preston 2. Remove the AmpliTaq
Page 481 and 482:
494 Preston 3.3. Cloning and DNA Se
Page 483 and 484:
496 Preston MgCl 2 concentrations b
Page 485 and 486:
498 Preston 21. Hung, T., Mak, K.,
Page 487 and 488:
500 Ravassard et al. Fig. 1. Constr
Page 489 and 490:
502 Ravassard et al. size dispersio
Page 491 and 492:
504 Ravassard et al. 9. ddH 2 O. 10
Page 493 and 494:
506 Ravassard et al. 3.2.2. RNA Mix
Page 495 and 496:
508 Ravassard et al. 4. Wash twice
Page 497 and 498:
510 Ravassard et al.
Page 499 and 500:
512 Pont-Kingdon Fig. 1. Constructi
Page 501 and 502:
514 Pont-Kingdon 9. Invert tube and
Page 503 and 504:
516 Pont-Kingdon
Page 505 and 506:
518 Jones and Winistorfer Fig. 1. D
Page 507 and 508:
520 Jones and Winistorfer Fig. 2. D
Page 509 and 510:
522 Jones and Winistorfer The yield
Page 511 and 512:
524 Jones and Winistorfer 7. Goulde
Page 513 and 514:
526 Burke and Barik Fig. 1. The bas
Page 515 and 516:
528 Burke and Barik concentration o
Page 517 and 518:
530 Burke and Barik purified mutant
Page 519:
532 Burke and Barik
show all

John M. S. Bartlett.pdf - Bio-Nica.info

Create successful ePaper yourself

Delete template?

Save as template?