John M. S. Bartlett.pdf - Bio-Nica.info

Unknown Genomic Sequences 377
1. Primer 1 (P1): a 18-22 mer with a calculated T m around 45 to 50°C. Working concentration:
0.5 pmol/µL.
2. Primer 2 (P2) should have the same melting temperature as the long-linker primer (see
Note 4) used for the PCR amplification, in our case a 25 to 27 mer with a calculated T m
of 60 to 65°C. The guanine-cytosine content is usually between 45 and 55%. It does not
need to overlap with P1, but a 5-bp overlap has worked. It should be internal to primer 2 to
increase the specificity of the overall reaction. Working concentration: 10 pmol/µL.
3. Primer 3 (P3): an 18 to 22 mer with a calculated T m around 45 to 50°C, but longer
oligos with higher GC contents will also work. It should be internal to P2 to increase the
specificity. It will be 32 P kinased with an SA of 10 7 cpm/pmol (see Subheading 3.3.).
Working concentration: 0.2 pmol/µL.
4. Long-linker oligonucleotide: 5′ CACCCGGGAGATCTGAATTC 3′ (see Note 4). It is
biotinylated at its 5′-end during synthesis by incorporation of a biotin-2-o-propylphosphoramidite.
It should be unphosphorylated.
5. Short-linker oligonucleotide: 5′ GAATTCAGATC 3′, dephosphorylated.
6. Oligo loading mix: 10% glycerol in formamide.
7. Denaturing polyacrylamide gel: 14.5% acrylamide, 0.5% bis-acrylamide, 7 M urea, 1× TBE.
Size: 25 × 25 × 0.1 cm.
8. Formamide loading buffer: 96% formamide, 0.05% xylene cyanol, 0.05% bromophenol
blue, 10 mM EDTA.
9. PE buffer: 50 mM Tris-HCl, pH 7.5, 100 mM NaCl, 1 mM EDTA, 1% phenol (v/v).
10. Chloroformisoamyl alcohol (241; Merck).
11. 5 M LiCl.
12. 1 M MgCl 2 .
13. Ethanol 100%.
14. Ethanol 80%.
15. TBE: 90 mM Tris-borate, 1 mM EDTA, pH 8.3.
2.3. Kinasing of Primer 3
1. P3 at 10 pmol/µL.
2. Polynucleotide kinase buffer 10×: 700 mM Tris-HCl, pH 7.6, 100 mM MgCl 2 , 50 mM DTT.
3. γ 32 PATP, 5000 Ci/mmol (Redivue, Amersham).
4. Polynucleotide kinase 10 U/µL (NE Biolabs).
5. 50 mM EDTA, pH 8.0.
6. G-25 fine spin columns (Boehringer, Mannheim).
2.4. First Primer Extension
1. P1 at 0.5 pmol/µL in TE, pH 7.5.
2. 1 N NaOH.
3. TES buffer: 560 mM TES, free acid (Sigma), 240 mM HCl, 100 mM MgCl 2 .
4. Vent buffer (10×): 100 mM KCl; 100 mM (NH 4 ) 2 SO 4 , 200 mM Tris-HCl, pH 8.8, 20 mM
MgSO 4 , 0.1% Triton X-100 (NE Biolabs).
5. dNTP solution: 10 mM dNTPs, (Boehringer, Mannheim); keep in small aliquots at –20°C.
Do not freeze/thaw more than three times.
6. Vent Exo DNA polymerase, 2 U/µL (NE Biolabs).
2.5. Ligation
1. Ligase buffer (10×): 500 mM Tris-HCl, pH 7.5, 100 mM MgCl 2 , 100 mM DTT, 10 mM
ATP, 250 µg/mL BSA (NE Biolabs).