John M. S. Bartlett.pdf - Bio-Nica.info

358 Mazars and Theillet
of genomic DNA. P53 primer A1 cttagtacctgaagggtgaaatattc (T m 1 = 60°C), P53 primer
B1 gtagtggtaatctactgggacggaacagc (T m 2 = 69°C), P53 primer A2 taatctactgggacgga
(T m 3 = 50°C), P53 primer B2 cccaagacttagtacctgaagggtg (T m 4 = 64°C). Cycling
conditions were for 25 cycles: 92°C (30 s); T m 1 or 3 (30 s); 72°C (90 s), followed by
10 cycles: 92°C (30 s); T m 2 or 4 (30 s); 72°C (90 s).
3.2. Preparation of the PCR Product
1. Transfer PCR product directly by pipetting in a Centricon 30 and add 2 mL of water.
2. Spin at 5000g in a fixed-angled rotor in a Beckman-type centrifuge for 30 min at room
temperature.
3. Add 2 mL of water. Spin again for 30 min and invert column and spin for 5 min at 1500g.
This procedure efficiently removes the excess of dNTPs from the PCR. Volume recovered
is typically 20 to 50 µL.
4. Typically, 7 µL of this purified product are used for single-strand sequencing according to
the manufacturer’s directions of United States Biochemicals (Cleveland, OH).
3.3. Sequencing Protocol
3.3.1. Annealing Template and Primer
1. For each template, a single annealing (and subsequent labeling) reaction is used. Combine
the following:
a. Primer 0.5 pmol (1 µL)
b. DNA 7 µL
c. Annealing buffer 2 µL
2. Warm the capped tube to 65°C for 2 min, and then allow the mixture to cool slowly to
room temperature over a period of about 30 min.
3.3.2. Labeling Reaction
1. To the annealed template-primer add the following:
a. DTT (0.1M) 1 µL
b. Labeling nucleotide mix 2 µL
c. [α-α- 35 S] dATP 5 µCi (typically 0.5 µL)
d. Sequenase 3 U from United States Biochemicals
2. Total volume should be approx 15 µL; mix thoroughly and incubate for 2 to 5 min at
room temperature.
3.3.3. Termination Reactions
1. Label four tubes “A,” “C,” “G,” and “T.” Fill each with 2.5 µL of the appropriate dideoxy
termination mixture.
2. When the labeling reaction is complete, transfer 3.5 µL of it to the tube (prewarmed to
37°C) labeled G. Similarly, transfer 3.5 µL of the labeling reaction to each of the other
three tubes (A, T, and C).
3. After 2 to 5 min of incubation at 37°C, add 4 µL of stop solution to each termination
reaction, mix, and store on ice.
4. To load the gel, heat the samples to 75 to 80°C for 2 min, and load 2 to 3 µL in each
lane. Prerun a sequencing gel for 30 min, load, and run until bromophenol is just out
of the gel.
5. Fix gel as usual and dry on Whatman 3MM paper. Correct sequencing yields a detectable
signal using a bench-top Geiger counter.
6. Expose overnight without Saran paper at room temperature.