John M. S. Bartlett.pdf - Bio-Nica.info

PRINS and Immunocytochemistry 455
Table 1
Sequences of Oligonucleotide Primers Used in PRINS
Name Human origin DNA sequence
E528 Chromosome 7 centromere AGCGATTTGAGGACAATTGC
G33 Chromosome 9 centromere AATCAACCCGAGTGCAATC
G35 Chromosome 11 centromere GAGGGTTTCAGAGCTGCTC
D600 Chromosome X centromere TCCATTCGATTCCATTTTTTTCGAGAA
13. Washing buffer: 1× PBS, 0.05% Triton X-100.
14. Glass coverslips 50 × 24 mm (Menzel Gläzer, Braunschweig, Germany).
15. Humid chamber.
16. Coplin jars (50 or 100 mL).
2.1.2 PRINS DNA Labeling
1. Pepsin from porcine stomach mucosa (2500–3500 U/mg; Sigma).
2. Ultrapure dNTP set (Amaersham Pharmacia Biotech, Little Chalfont, UK): 100 mM
solutions of dATP, dCTP, dGTP, and dTTP.
3. Biotin-16-dUTP, Digoxigenin-11-dUTP, and Fluorescein-12-dUTP (Roche Molecular
Biochemicals, Basel, Switzerland).
4. Oligonucleotide primer (see Table 1 and Note 1).
5. Taq 1 DNA polymerase (Roche) or AmpliTaq (Perkin–Elmer).
6. Bovine serum albumin (BSA; Sigma).
7. Dried skimmed milk powder.
8. FITC-conjugated avidin (AvFITC; Vector, Burlingame, CA).
9. FITC-conjugated sheep anti-digoxigenin Fab fragments (SHADigFITC; Roche).
10. Vectashield (Vector).
11. 4′,6-diamidino-2-phenyl indole (DAPI; Sigma).
12. 0.01 M HCl.
13. 1× PBS: diluted from 10× PBS (see Subheading 2.1.1., item 10).
14. Postfixation buffer: 1% formaldehyde (diluted from 37% formaldehyde (Merck, Darmstadt,
Germany) in 1× PBS.
15. 20 × SSC: 3 M NaCl, 300 mM trisodium citrate, pH 7.0.
16. 10× Taq buffer: 500 mM KCl; 100 mM Tris-HCl, pH 8.3, 15 mM MgCl 2 , 0.1% BSA.
17. PRINS stop buffer: 500 mM NaCl, 50 mM EDTA, pH 8.0.
18. Blocking buffer: 4 × SSC (diluted from stock 20 × SSC), 0.05% Triton X-100, 5%
skimmed milk powder.
19. Washing buffer: 4 × SSC, 0.05% Triton X-100.
20. Coplin jars (50 or 100 mL).
21. Ethanol/37% HCl (1001)-cleaned microscope slides and coverslips (Menzel).
22. Rubber cement.
23. Water bath at 65°C.
24. Thermal cycler (Hybaid Omnigene Flatbed; Hybaid, Ashford, UK; see Note 2).
25. Humid chamber.
26. Incubator set at 37°C.
27. Leica DM fluorescence microscope (Leica, Wetzlar, Germany) equipped with filter sets
for DAPI, FITC, and TRITC.
28. Kodak 400 ASA film.
29. Black and white CCD camera and Isis 4 analysis software (Metasystems, Sandhausen,
Germany).