John M. S. Bartlett.pdf - Bio-Nica.info

332 Han and Robinson
4. Notes
1. PCR-SSCP is a very sensitive method for detecting point mutations in a DNA fragment
shorter than 300 bp. A single base change may effect the overall conformation more easily
on small fragments than large fragments. Therefore, primers used in your experiment are
better designed for amplifying a 100- to 300-bp DNA fragment. If long genomic or cDNA
segments are to be screened, it is important to find comparable electrophoresis conditions
in which mutations in long DNA fragments are efficiently detected (see Note 10). If the
primers used do not allow detection of known substitutions, moving the primer sequence
further 5′ or 3′ may make it possible to distinguish the fragments. The sequences of the
oligo primers used to amplify the human CD1a gene, as shown in Fig. 2, are as follows:
CD1a.ex2F1 AGACGGGCTCAAGGAGCCTC and CD1a.ex2R1 TCCAGTTCCTTC
CACTCCTC.
2. Long Ranger stock gel solution contains acrylamide, a neurotoxin, which may cause cancer
and /or heritable genetic damage. It is advisable to wear gloves while handling.
3. Acrylamide gel electrophoresis supplies and equipment format used in PCR-SSCP method
may vary between laboratories. In our laboratory, we use a set of glass plates (44.5 × 37.5 cm
and 42 × 37.5 cm) and corresponding electrophoresis supplies. Mini-gel format is also
frequently used by some other investigators and which is often followed by silver-staining
DNA bands rather than labeling with 32 P.
4. All procedures involved in dealing with [ 32 P]-dCTP should be performed in a lab safety
area and handled by behind a protection screen. Radioactive waste should only be thrown
into specialized trash cans.
5. The final concentration of 1 µM primer in our PCR amplification provides clear migration
bands, and we have never failed to detect known mutations using this primer concentration.
However, it has been reported that lowering the upstream primer concentration improves
DNA migration. Because the SSCP technique is not 100% effective in detecting any given
substitution, it might be worthwhile to try lowering upstream primer concentrations if
known base changes are not detected in your SSCP gel. The template can either be genomic
or cDNA depending upon your interest. But do not forget to include DNA samples with
known sequence in your PCR amplification, which will serve as a control SSCP pattern
for reading allelic distributions of your test samples.
6. Annealing temperature may vary depending upon the primers used. Usually the annealing
temperature is determined empirically with estimates made by the following formula:
[(G + C) × 4] °C + [(A + T) × 2] °C = annealing temperature °C.
7. Some bubbles may appear between the plates if the plates are not very clean. You can get
the bubbles out by further angling the plates with one hand and tapping on the plates with
the other hand until the bubbles are out.
8. It is important to ensure that the comb is very clean when casting the gel. Leftover
acrylamide present between the teeth of the comb may cause shorter wells or a gel surface
that will not hold your samples.
9. Denaturation of amplified DNA samples can be performed by heating at 95°C or by both
chemical agents (NaOH) and heating because the denaturation of the fragment to single
strands is often incomplete.
10. The optimum balance for band separation versus gel run time depends upon the size
of amplified DNA fragment. For a DNA fragment around 150 to 300 bp, 4 h would be
ideal. The migration pattern of a certain single-strand conformer may be improved by
modification of a number of electrophoresis conditions, including lowering the buffer pH,
changing the temperature of the gel, or increasing the acrylamide concentration (up to
15%). Difficulties detecting certain mutations when using the routine protocol may be
circumvented by adjusting one or more of these three gel conditions.