Methods in Anopheles Research - MR4

More documents

Recommendations

Info

Chapter 4 : Stock Authentication4.2 Authentication by PCR4.2.2 Anopheles arabiensis ND5 Molecular Authentication v 1Page 1 of 24.2.2 Anopheles arabiensis ND5 Molecular AuthenticationLiz WilkinsIntroductionAnopheles arabiensis is a member of the An. gambiae s.l. complex. An. arabiensis strains from differentregions have been found to be variable in the region of the mtDNA dehydrogenase gene subunit 5 (ND5)(Temu and Yan 2005). This region yielded the single nucleotide polymorphisms (SNPs) necessary tocreate a PCR to distinguish two laboratory colonies of An. arabiensis: KGB which originated fromZimbabwe about 1975, and A. arabiensis Dongola which originated from Sudan in 2004. The two aremorphologically indistinguishable in the larval or adult stages and both are susceptible to insecticidesmaking molecular distinction necessary. Part of the ND5 region was amplified and sequenced from eachstrain, and SNP sites were used to create primers using the intentional mismatch primer (IMP) (Wilkins etal. 2006) method of design at the SNP sites. This protocol is useful in distinguishing these two strains onefrom the other.PCR authentication for the members of the Anopheles arabiensis complexPrepare PCR Master Mix for 96, 48 or 1 25μl PCR reactions. Add reagents in the order presented.96 48 1 Reagent1185 μl 592.5 μl 11.85 μl sterile H 2 O500 μl 250 μl 5.0 μl 5X PCR Buffer200 μl 100 μl 2.0 μl dNTP (2.5 mM mix)100 μl 50 μl 1.0 μl DF (F, 25pmol/μl) GATAAAGCAATAATTTTCTTTAAAGCG100 μl 50 μl 1.0 μl KR (R, 25pmol/μl) GGTGCAAATTTTGAATTTGATTTACAA100 μl 50 μl 1.0 μl IPCF (R, 25pmol/μl) GCATGAGTTAATAAATGAAAAAAAGC100 μl 50 μl 1.0 μl IPCR (R, 25pmol/μl) CTATAACTAAAAGTGCCCAAATTC200 μl 100 μl 2.0 μl MgCl 2 (25mM)15 μl 7.5 μl 0.15 μl Go-Taq DNA polymerase (5U/μl)2.5 ml 1.25 ml 25 μl TotalTable 4.2.2.1. F and R indicate forward and reverse orientation.PCR Cycle conditions95°C/5min x 1 cycle(95°C/30sec , 58°C/30sec , 72°C/30sec) x 30 cycles72°C/5min x 1 cycle4°C holdUse a 2% Agarose ethidium bromide gel for visualization.Primers create an internal positive control of 350 bp and a species specific fragment of 260 bp forDongola and 130 bp for KGB (Figure 4.2.2.1).
Chapter 4 : Stock Authentication4.2 Authentication by PCR4.2.2 Anopheles arabiensis ND5 Molecular Authentication v 1Page 2 of 2Figure 4.2.2.1. Lane 1 1Kb marker, lane 2 An. arabiensis KGB,lane 3 An. arabiensis Dongola, Lane 4 1Kb marker.ReferencesTemu EA, Yan G (2005) Microsatellite and mitochondrial genetic differentiation of Anopheles arabiensis(Diptera: Culicidae) from western Kenya, the Great Rift Valley, and coastal Kenya. Am J Trop Med Hyg73:726-733Wilkins EE, Howell PI, Benedict MQ (2006) IMP PCR primers detect single nucleotide polymorphisms forAnopheles gambiae species identification, Mopti and Savanna rDNA types, and resistance to dieldrin inAnopheles arabiensis. Malar J 5:12596 well PCR sample preparation template
Page 1:
\Methods inAnopheles ResearchSecond
Page 8 and 9:
Preface to Second EditionWhen Mark
Page 10 and 11:
Chapter 1 : Insectary Operation1.1
Page 12 and 13:
Page 14 and 15:
Page 16 and 17:
Page 19 and 20:
Page 21 and 22:
Page 23 and 24:
Page 25 and 26:
Page 27 and 28:
Page 29 and 30:
Page 31 and 32:
Page 33 and 34:
Page 35 and 36:
Chapter 2 : Anopheles Laboratory Bi
Page 37 and 38:
Page 39 and 40:
Page 41 and 42:
Page 43 and 44:
Page 45 and 46:
Page 47 and 48:
Page 49 and 50:
Page 51 and 52:
Page 53 and 54:
Page 55 and 56:
Page 57 and 58:
Page 59 and 60:
Page 61 and 62:
Page 63 and 64:
Page 65 and 66:
Page 67 and 68:
Page 69 and 70:
Page 71 and 72:
Page 73 and 74:
Page 75 and 76:
Page 77 and 78:
Page 79 and 80:
Page 81 and 82:
Page 83 and 84:
Page 85 and 86:
Page 87 and 88:
Page 89 and 90:
Page 91 and 92:
Page 93 and 94:
Chapter 2 : Anopheles Biology Labor
Page 95 and 96:
Page 97 and 98:
Page 99 and 100:
Page 101 and 102:
Page 103 and 104:
Page 105 and 106:
Page 107 and 108:
Chapter 3 : Specific Anopheles Tech
Page 109 and 110:
Page 111 and 112:
Page 113 and 114:
Page 115 and 116: 5. Place eggs in a new Petri dish c
Page 117 and 118: Chapter 3 : Specific Anopheles Tech
Page 159 and 160: Chapter 4 : Stock Authentication4.1
Page 165: Chapter 4 : Stock Authentication4.2
Page 169 and 170: Figure 4.2.3.1 Lane 1 1kb ladder, l
Page 171 and 172: Chapter 5 : Insecticide Resistance
Page 177 and 178: INTRODUCTIONChapter 5 : Insecticide
Page 179 and 180: Chapter 5 : Insecticide Resistance5
Page 217 and 218:
Chapter 5 : Insecticide Resistance
Page 219 and 220:
Page 221 and 222:
Page 223 and 224:
Page 225 and 226:
Chapter 6 : Dissection Techniques6.
Page 227 and 228:
Figure 6.2.1. Larval mosquito midgu
Page 229 and 230:
Page 231 and 232:
Page 233 and 234:
Page 235 and 236:
Page 237 and 238:
Page 239 and 240:
Page 241 and 242:
Page 243 and 244:
Page 245 and 246:
Page 247 and 248:
Page 249 and 250:
Page 251 and 252:
Page 253 and 254:
Chapter 7 : Taxonomy and Systematic
Page 255 and 256:
Page 257 and 258:
Page 259 and 260:
Page 261 and 262:
Page 263 and 264:
Page 265 and 266:
Collection NumberCountryNumber Le P
Page 267 and 268:
MOSQUITO BITING COLLECTION RECORDCo
Page 269 and 270:
Page 271 and 272:
Page 273 and 274:
Page 275 and 276:
Page 277 and 278:
Page 279 and 280:
Chapter 8 : Field Techniques8.1 Mol
Page 281 and 282:
Page 283 and 284:
Chapter 8 : Field Techniques8.2 Pla
Page 285 and 286:
Page 287 and 288:
Page 289 and 290:
Page 291 and 292:
Page 293 and 294:
Page 295 and 296:
Page 297 and 298:
Page 299 and 300:
Chapter 8 : Field Techniques8.4 Spe
Page 301 and 302:
Page 303 and 304:
Page 305 and 306:
Page 307 and 308:
Page 309 and 310:
Page 311 and 312:
Page 313 and 314:
Page 315 and 316:
Chapter 8 : Field Techniques8.5 Rea
Page 317 and 318:
Page 319 and 320:
Page 321 and 322:
Page 323 and 324:
Page 325 and 326:
20Chapter 8 : Field Techniques8.5 R
Page 327 and 328:
Page 329 and 330:
Page 331 and 332:
8070Mutant (S1014)Chapter 8 : Field
Page 333 and 334:
Page 335 and 336:
AChapter 8 : Field Techniques8.5 Re
Page 337 and 338:
Page 339 and 340:
Page 341 and 342:
Chapter 9 : Obtaining Live Material
Page 343:
Chapter 9 : Obtaining Live Material
show all

Methods in Anopheles Research - MR4

Create successful ePaper yourself

Delete template?

Save as template?