Methods in Anopheles Research - MR4

Chapter 8 : Field Techniques8.4 Species Complex Authentication by PCR8.4.1 Anopheles gambiae Complex – Scott et al.Page 1 of 28.4 Species Complex Authentication by PCR8.4.1 Anopheles gambiae complex (Scott et al.)MR4 StaffIntroductionThe Anopheles gambiae complex is comprised of 7 cryptic species: An. gambiae s.s, An. arabiensis, An.bwambe, An. melas, An. merus, An. quadriannulatus A and B, some of which are sympatric.Distinguishing the members of the complex was first done based on karyotype and chromosomalinversions (Coluzzi et al. 1979). Recently, however, easier PCR based assays have been developed thatdistinguished several of the members based on species-specific single nucleotide polymorphisms (SNPs)in the intergenic spacer region (IGS) (Scott et al. 1993; Fettene and Temu 2003; Besansky et al. 2006;Wilkins et al. 2006). A good overview and the fine points of this assay has been published (Cornel andCollins 1996). Alternatives to this assay can be found in Chapters 8.4.3 and 8.5.1.1.PCR authentication for the members of the Anopheles gambiae complex (Scott et al. 1993)Prepare PCR Master Mix for 96, 48 or 1 25μl PCR reactions. 1 Add reagents in the order presented.96 48 1 Reagent835 μl 417.5 μl 8.35 μl sterile H 2 O500 μl 250 μl 5.0 μl GoTaq 5X PCR Buffer with MgCl 2250 μl 125 μl 2.5 μl dNTP (2.5 mM mix G,A,T,C)100 μl 50 μl 1.0 μl MgCl 2 (25 mM)100 μl 50 μl 1.0 μl UN (F, 25 pmol/μl) [GTGTGCCCCTTCCTCGATGT]100 μl 50 μl 1.0 μl AR (R, 25 pmol/μl) [AAGTGTCCTTCTCCATCCTA]100 μl 50 μl 1.0 μl GA (R, 25 pmol/μl) [CTGGTTTGGTCGGCACGTTT]100 μl 50 μl 1.0 μl ME (R, 25 pmol/μl) [TGACCAACCCACTCCCTTGA]200 μl 100 μl 2.0 μl QD (R, 25 pmol/μl) [CAGACCAAGATGGTTAGTAT] OR200 μl 100 μl 2.0 μl QDA (R, 25 pmol/µl) [CATAATGAGTGCACAGCATA] )15 μl 7.5 μl 0.15 μl Taq DNA polymerase (5 U/μl)2.5 ml 1.25 ml 24 μl Total (To each 24 ul reaction add 1 μl template DNA)Table 8.4.1.1. F and R indicate forward and reverse orientation. It may improve specificity to leave outprimers for species that do not occur in the area of sample collection. If removing a primer, replace primervolume with an equal volume of sterile water. Use the QDA primer instead of the QD primer in areaswhere An. merus and An. quadriannulatus are sympatric. Use 1 μl DNA template.PCR cycle conditions95°C/5min x 1 cycle(95°C/30sec , 50°C/30sec , 72°C/30sec) x 30 cycles72°C/5min x 1 cycle4°C holdRun samples on a 2% agarose EtBr gel; load 5 μl sample (Figure 8.4.1.1).1 Amounts for larger master mixes have been adjusted upwards to be sufficient for 50 and 100 rxnscompensate for imprecise measurements.