Methods in Anopheles Research - MR4

More documents

Recommendations

Info

Chapter 5 : Insecticide Resistance Monitoring5.3 Insecticide Resistance Allele Assay by PCR5.3.3 Dieldrin Resistance – Anopheles gambiae and An. arabiensisPage 1 of 45.3.3 Dieldrin Resistance - An. gambiae and An. arabiensisIntroductionDue to the ban on the use of dieldrin as an insecticide, resistance to dieldrin (Rdl) is not prevalent in thewild; however, several laboratory colonies are maintained that have this mutation. The Rdl mutation hasbeen found to be associated with cross-resistance to newer insecticides that are currently beingemployed (Brooke et al. 2000; Kolaczinski and Curtis 2001). Two PCR assays have been developed todetect the Rdl mutation; one in An. gambiae (Du et al. 2005) and one in An. arabiensis (Wilkins et al.2006). An RT-PCR based assay can be found in Chapter 8.5.1.5.An. gambiae (Du et al. 2005)Prepare PCR Master Mix for 96, 48 or 1 25μl PCR reactions. Add reagents in the order presented.96 48 1 Reagent1555 μl 777.5 μl 15.55 μl sterile H 2 O500 μl 250 μl 5.0 μl 5X GoTaq PCR Buffer100 μl 50 μl 1.0 μl dNTP (2.5 mM mix)100 μl 50 μl 1.0 μl RDLF (F, 25 pmol/µl) [AGTTGGTACGTTCGATGGGTTA]100 μl 50 μl 1.0 μl RDLR (R, 25 pmol/μl) [CCAGCAGACTGGCAAATACC]100 μl 50 μl 1.0 μl DF1RDL (F, 25 pmol/μl) [AATGCTACACCAGCACGTGTTGG]30 μl 15 μl 0.3 μl MgCl 2 (25 mM)15 μl 7.5 μl 0.15 μl Go-Taq DNA polymerase (5 U/μl)2.5 ml 1.25 ml 25 μl TotalTable 5.3.3.1. F and R indicate forward and reverse orientation. Use 1 μl DNA template.An. arabiensis (Wilkins et al. 2006)Prepare PCR Master Mix for 96, 48 or 1 25μl PCR reactions. Add reagents in the order presented.96 48 1 Reagent1455 μl 727.5 μl 14.55 μl sterile H 2 O500 μl 250 μl 5.0μl 5X PCR Buffer100 μl 50 μl 1.0 μl dNTP (2 mM mix)100 μl 50 μl 1.0 μl RDLF (F, 25 pmol/µl) [AGTTGGTACGTTCGATGGGTTA]100 μl 50 μl 1.0 μl RDLR (R, 25 pmol/μl) [CCAGCAGACTGGCAAATACC]100 μl 50 μl 1.0 μl AARDL (F, 25 pmol/μl) [GCTACACCAGCACGTGaTT]100 μl 50 μl 1.0 μl RDLSS (R, 25 pmol/µl) [CAAGACAGTAGTTACACCTAAaGC]30 μl 15 μl 0.3 μl MgCl 2 (25 mM)15 μl 7.5 μl 0.15 μl Go-Taq DNA polymerase (5 U/μl)2.5 ml 1.25 ml 25 μl TotalTable 5.3.3.2. In primer sequence, lower case nucleotides indicates the intentional mismatch, nucleotidesin bold are located at site of SNP (where applicable); F and R indicate forward and reverse orientation.Use 1 μl DNA template.
Chapter 5 : Insecticide Resistance Monitoring5.3 Insecticide Resistance Allele Assay by PCR5.3.3 Dieldrin Resistance – Anopheles gambiae and An. arabiensisPage 2 of 4PCR Cycle conditions for both assays94 o C/3min x 1 cycle(94 o C/1min -0- 53 o C/2min -0- 72 o C/2min) x 30 cycles72 o C/10min x 1 cycle4 o C holdRun samples on a 2% agarose EtBr gel; load 5 μl sample.An. gambiaePrimers create fragments of: control band 390 bp, An. gambiae resistant 160 bpAn. arabiensisPrimers create fragments of: control band 255 bp, An. arabiensis resistant 157 bp, and An. arabiensissusceptible 120 bp (Figure 5.3.3.1)Figure 5.3.3.1 An. arabiensis RDl assay. Lane 1 1kb ladder, lanes 2-9 resistant An. arabiensis, lanes 10-24 susceptible An. arabiensis.ReferencesBrooke BD, Hunt RH, Coetzee M (2000) Resistance to dieldrin + fipronil assorts with chromosomeinversion 2La in the malaria vector Anopheles gambiae. Medical and Veterinary Entomology 14:190-194Du W et al. (2005) Independent mutations in the Rdl locus confer dieldrin resistance to Anophelesgambiae and An. arabiensis. Insect Molecular Biology 14:179-183Kolaczinski J, Curtis C (2001) Laboratory evaluation of fipronil, a phenylpyrazole insecticide, against adultAnopheles (Diptera: Culicidae) and investigation of its possible cross-resistance with dieldrin inAnopheles stephensi. Pest Management Science 57:41-45Wilkins EE, Howell PI, Benedict MQ (2006) IMP PCR primers detect single nucleotide polymorphisms forAnopheles gambiae species identification, Mopti and Savanna rDNA types, and resistance to dieldrin inAnopheles arabiensis. Malar J 5:125
Page 1:
\Methods inAnopheles ResearchSecond
Page 8 and 9:
Preface to Second EditionWhen Mark
Page 10 and 11:
Chapter 1 : Insectary Operation1.1
Page 12 and 13:
Page 14 and 15:
Page 16 and 17:
Page 19 and 20:
Page 21 and 22:
Page 23 and 24:
Page 25 and 26:
Page 27 and 28:
Page 29 and 30:
Page 31 and 32:
Page 33 and 34:
Page 35 and 36:
Chapter 2 : Anopheles Laboratory Bi
Page 37 and 38:
Page 39 and 40:
Page 41 and 42:
Page 43 and 44:
Page 45 and 46:
Page 47 and 48:
Page 49 and 50:
Page 51 and 52:
Page 53 and 54:
Page 55 and 56:
Page 57 and 58:
Page 59 and 60:
Page 61 and 62:
Page 63 and 64:
Page 65 and 66:
Page 67 and 68:
Page 69 and 70:
Page 71 and 72:
Page 73 and 74:
Page 75 and 76:
Page 77 and 78:
Page 79 and 80:
Page 81 and 82:
Page 83 and 84:
Page 85 and 86:
Page 87 and 88:
Page 89 and 90:
Page 91 and 92:
Page 93 and 94:
Chapter 2 : Anopheles Biology Labor
Page 95 and 96:
Page 97 and 98:
Page 99 and 100:
Page 101 and 102:
Page 103 and 104:
Page 105 and 106:
Page 107 and 108:
Chapter 3 : Specific Anopheles Tech
Page 109 and 110:
Page 111 and 112:
Page 113 and 114:
Page 115 and 116:
5. Place eggs in a new Petri dish c
Page 117 and 118:
Page 119 and 120:
Page 121 and 122:
Page 123 and 124:
Page 125 and 126:
Page 127 and 128:
Page 129 and 130:
Page 131 and 132:
Page 133 and 134:
Page 135 and 136:
Page 137 and 138:
Page 139 and 140:
Page 141 and 142:
Page 143 and 144:
Page 145 and 146:
Page 147 and 148:
Page 149 and 150:
Page 151 and 152:
Page 153 and 154:
Page 155 and 156:
Page 157 and 158:
Page 159 and 160:
Chapter 4 : Stock Authentication4.1
Page 161 and 162:
Page 163 and 164:
Page 165 and 166:
Page 167 and 168: Chapter 4 : Stock Authentication4.2
Page 169 and 170: Figure 4.2.3.1 Lane 1 1kb ladder, l
Page 171 and 172: Chapter 5 : Insecticide Resistance
Page 177 and 178: INTRODUCTIONChapter 5 : Insecticide
Page 179 and 180: Chapter 5 : Insecticide Resistance5
Page 217: Chapter 5 : Insecticide Resistance
Page 225 and 226: Chapter 6 : Dissection Techniques6.
Page 227 and 228: Figure 6.2.1. Larval mosquito midgu
Page 253 and 254: Chapter 7 : Taxonomy and Systematic
Page 265 and 266: Collection NumberCountryNumber Le P
Page 267 and 268: MOSQUITO BITING COLLECTION RECORDCo
Page 269 and 270:
Chapter 7 : Taxonomy and Systematic
Page 271 and 272:
Page 273 and 274:
Page 275 and 276:
Page 277 and 278:
Page 279 and 280:
Chapter 8 : Field Techniques8.1 Mol
Page 281 and 282:
Page 283 and 284:
Chapter 8 : Field Techniques8.2 Pla
Page 285 and 286:
Page 287 and 288:
Page 289 and 290:
Page 291 and 292:
Page 293 and 294:
Page 295 and 296:
Page 297 and 298:
Page 299 and 300:
Chapter 8 : Field Techniques8.4 Spe
Page 301 and 302:
Page 303 and 304:
Page 305 and 306:
Page 307 and 308:
Page 309 and 310:
Page 311 and 312:
Page 313 and 314:
Page 315 and 316:
Chapter 8 : Field Techniques8.5 Rea
Page 317 and 318:
Page 319 and 320:
Page 321 and 322:
Page 323 and 324:
Page 325 and 326:
20Chapter 8 : Field Techniques8.5 R
Page 327 and 328:
Page 329 and 330:
Page 331 and 332:
8070Mutant (S1014)Chapter 8 : Field
Page 333 and 334:
Page 335 and 336:
AChapter 8 : Field Techniques8.5 Re
Page 337 and 338:
Page 339 and 340:
Page 341 and 342:
Chapter 9 : Obtaining Live Material
Page 343:
Chapter 9 : Obtaining Live Material
show all

Methods in Anopheles Research - MR4

Create successful ePaper yourself

Delete template?

Save as template?