Methods in Anopheles Research - MR4

Chapter 8 : Field Techniques8.3 Molecular Identification of Mammalian Blood Meals from MosquitoesPage 2 of 4Small Blood Meal PCR and Enzyme Digest (Fornadel and Norris 2008)For samples that fail to produce a reaction product with the multiplexed PCR the following small bloodmeal PCR/enzyme digest may be used. This assay allows identification of host source from partiallydigested blood meals (out to 60 hours post feeding), as well as from partially degraded DNA extractions.The PCR was designed to produce a small 98bp amplicon from the mammals tested above, which canthen be incubated with specific restriction enzymes to determine host source.Prepare PCR Master Mix for 96, 48 or 1 25μl PCR reactions 1 . Add reagents in the order presented.96 48 1 Reagent size (bp)1.83 ml 915 μl 18.3 μl sterile H2O250 μl 125 μl 2.5 μl Taq 10X PCR Buffer with MgCl2100 μl 50 μl 1.0 μl dNTP (final concentration of 100 μM of each dNTP)50 μl 25 μl 0.5 μl UnRev1025 (50 pmol/μl) [ggttgtcctccaattcatgtta]50 μl 25 μl 0.5 μl UniForA (50 pmol/μl) [tccaaacaac[a/g][a/c]agcataatatt] 9820 μl 10 μl 0.2 μl Taq DNA polymerase (5 U/μl)2.3 ml 1.15 ml 23 μl TotalFor DNA template use 2 µl DNA sample (from abdomen extraction eluted in 50μl dH 2 0)Save 6 µl of the PCR products to run as undigested controls on a 3% agarose gel alongside the digestedamplicons.Note: The master mix can be tripled for a total reaction volume of 78 µl. This will allow one to perform upto 4 digests of the amplified product with enough undigested sample leftover as a control.PCR Cycle conditions95°C/5min x 1 cycle(95°C/60sec , 55°C/60sec , 72°C/60sec) x 40 cycles72°C/7min x 1 cycle4°C holdRestriction Enzyme DigestsThe following digests can be performed in whichever order/combination provides the best efficiency forthe samples under study.Host Cut position Enzyme Recognition Seq.Human 59 Fnu4HI GC^N_GCCow 54 BanII G_RGCY^CDog 24 MspI C^CG_GGoat 43 NsiI A_TGCA^TPig 54 SpeI A^CTAG_TRestriction Digest ReactionPer reaction (1)Reagent7.5 µl sterile H2O2.5 µl Taq 10X PCR Buffer with MgCl21-2 U Enzyme15 µl PCR product.025 µl only for SpeI digests BSA 100X~25 µl TotalAll digests are carried out at 37C for at least 3hrs but can be left overnight.